CN115825424A - ELISA kit for detecting triclosan residue based on nano antibody and application thereof - Google Patents

Abstract

The invention provides an ELISA kit for detecting triclosan residue based on a nano antibody and application thereof. The kit comprises a kit body, a detachable ELISA plate arranged in the kit body and a reagent arranged in the kit body; wherein, each hole of the ELISA plate is coated with a triclosan artificial antigen, and the reagent comprises a nano antibody shown in SEQ ID NO. 1, a triclosan standard solution, an ELISA secondary antibody, a PBS buffer solution, a PBST cleaning solution, a developing solution, a reaction stopping solution and the like. The mobile phone number can accurately and sensitively detect triclosan residues in environments such as water, soil, vegetables and the like, the pretreatment process of the sample is simple, the time consumption is low, a large number of samples can be detected simultaneously, and the sample detection cost is far lower than that of a traditional instrument detection method.

Description

ELISA kit for detecting triclosan residue based on nano antibody and application thereof

Technical Field

The invention relates to the technical fields of genetic engineering, phage display technology and ELISA (enzyme-linked immunosorbent assay) detection, in particular to an ELISA kit for detecting triclosan residues based on a nano antibody and application thereof.

Background

Triclosan (TCS) is widely used in personal care and medical products as a commonly used antimicrobial agent. The widespread use of TCS has led to its presence in surface water, ground water, soil and vegetables. TCS poses a threat to aquatic organisms, mammals and humans due to its lipophilic, bioaccumulating and biotoxic properties. Research shows that TCS can interfere hormone secretion of human body, inhibit growth of algae and produce harmful and toxic substances such as dioxin under the conditions of light and the like. Therefore, the detection of triclosan residue needs to be enhanced to ensure ecological safety and human health.

The triclosan residue detection methods reported at present are mainly instrumental analytical methods, including High Performance Liquid Chromatography (HPLC) and combined gas or liquid chromatography-mass spectrometry (GC-MS or LC-MS). However, these methods require specialized laboratories, specialized instruments and equipment, and specialized operators, and are complicated in sample pretreatment and high in analysis cost, and it is difficult to meet the demand of rapid field monitoring of a large number of samples. The immunoassay technology has the advantages of simplicity, convenience, rapidness, low price, high efficiency, strong specificity, high sensitivity and the like, and is widely applied to the fields of diagnosis, environmental monitoring, food quality, agriculture and the like.

The enzyme-linked immunosorbent assay method based on the conventional antibodies (polyclonal antibodies and monoclonal antibodies) is relatively low in stability and specificity, and the nano antibody has the advantages of high specificity, strong affinity, low production cost, strong resistance to severe environment and the like, can be produced in a large scale in a prokaryotic expression system, so that the enzyme-linked immunosorbent assay method is established on the basis of the anti-triclosan nano antibody.

Disclosure of Invention

The invention aims to provide an ELISA kit for detecting triclosan residues based on a nano antibody and application thereof.

Based on the conventional antibody (polyclonal antibody and monoclonal antibody) triclosan residue enzyme-linked immunosorbent assay method has relatively low stability, and the invention uses the anti-triclosan nano antibody as the basis and adopts the enzyme-linked immunosorbent assay method to detect the residue.

To achieve the object of the present invention, in a first aspect, the present invention provides an anti-triclosan nanobody, which comprises or consists of the following amino acid sequence:

i) 1, SEQ ID NO; or

ii) an amino acid sequence obtained by connecting a label at the N end and/or the C end of the i); or

iii) And the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the antibody with the same function.

In a second aspect, the invention provides nucleic acid molecules encoding the nanobodies.

In a third aspect, the invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors or engineered bacteria.

In a fourth aspect, the invention provides a triclosan detection reagent or kit, the effective component of which is the nano antibody.

In a fifth aspect, the invention provides an ELISA kit for detecting triclosan residue based on a nano antibody, which comprises a kit body, a detachable ELISA plate arranged in the kit body and a reagent arranged in the kit body; each hole of the ELISA plate is coated with a triclosan artificial antigen, and the reagent comprises the nano antibody and at least one of a triclosan standard solution, an ELISA secondary antibody, a PBS buffer solution, a PBST cleaning solution, a color development solution, a reaction stop solution and the like.

Further, the triclosan artificial antigen is obtained by coupling the triclosan hapten shown in the formula I) with carrier protein;

wherein the carrier protein can be at least one selected from bovine serum albumin, keyhole limpet hemocyanin, ovalbumin, thyroid protein, human serum albumin and the like, and is preferably selected from bovine serum albumin and keyhole limpet hemocyanin.

Further, the preparation method of the antigen coating solution for coating the ELISA plate comprises the following steps:

(1) Dissolving 7.5mg of the triclosan hapten of formula I), 2.65mg of N-hydroxysuccinimide and 4.8mg of N, N' -dicyclohexylcarbodiimide in 200. Mu.L of anhydrous dimethylformamide, and stirring at room temperature overnight to effect a reaction; centrifuging the reaction solution, removing the precipitate, and collecting the supernatant;

(2) Dissolving 20mg of bovine serum albumin in 2mL of 0.05M carbonate buffer solution with pH of 9.6, dropwise adding the supernatant under stirring, and continuously stirring at room temperature for reaction for 4 hours after the addition is finished;

(3) After the reaction is finished, putting the reaction solution into a dialysis bag and dialyzing with PBS; changing the solution once every 6h, and changing the solution for 5-6 times; and centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen coating solution.

Preferably, the ELISA plate is a 96-well ELISA plate, and the coating concentration of the coating antigen is 50-70ng/mL.

Preferably, the concentration of the nanobody is 90-100ng/mL.

Preferably, the enzyme-labeled secondary antibody is an anti-HA-labeled antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL.

Preferably, the color developing solution comprises solution A and solution B, wherein the solution A is prepared from carbamide peroxide 1g, citric acid 10.3g and Na ₂ HPO ₄ ·12H ₂ 35.8g of O, 100 mu L of tween-20 and 1000mL of distilled water, and the pH value is 5; the solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4.

Preferably, the reaction terminating solution is a 2M sulfuric acid solution.

In a sixth aspect, the invention provides any one of the following uses of the nanobody:

1) The method is used for triclosan detection;

2) Used for preparing a triclosan detection reagent or a kit;

3) Used for the enrichment and purification of triclosan;

4) An enrichment and purification reagent for preparing triclosan.

In a seventh aspect, the invention provides the use of the detection reagent or the kit and the ELISA kit in detecting triclosan residues in a sample.

In the detection process of the ELISA kit, the coating antigen adsorbed on the pore wall of the ELISA plate and the triclosan to be detected compete with each other to react with the antibody, and the result is observed through a chromogenic reaction. The concentration of the triclosan in the sample to be detected can be calculated by detecting the triclosan with known concentration and drawing a standard curve.

The method has the advantages that the method can accurately and sensitively detect the triclosan residues in the environments such as water, soil, vegetables and the like, the pretreatment process of the sample is simple, the consumed time is less, a large number of samples can be detected simultaneously, and the sample detection cost is far lower than that of the traditional instrument detection method. The invention can realize the on-site monitoring of the triclosan residues of a large batch of samples and has wide application prospect.

Drawings

FIG. 1 is a standard inhibition curve for nanobody-based triclosan in a preferred embodiment of the invention. Wherein the regression equation of the curve is y =0.014+0.9932/[1+ (x/7.56) ^1.7672](R ² = 0.99), the inhibitory median concentration is IC ₅₀ =7.7ng/mL, with the lowest detection limit of IC ₂₀ ＝3.6ng/mL。

Detailed Description

Aiming at the defects of high cost, complex pretreatment, poor specificity, low sensitivity, difficult field test and the like of the existing pesticide residue instrument analysis method, the invention provides the ELISA detection kit for analyzing the triclosan residue, which has the advantages of high specificity, high sensitivity, high accuracy, high precision and simple operation method, can be used for rapidly detecting mass samples and is simple in operation method. The method is suitable for rapidly determining the triclosan residue in samples such as water, soil, vegetables and the like.

The invention adopts the following technical scheme:

in a first aspect, the present invention provides a nanobody against triclosan comprising or consisting of an amino acid sequence as follows:

i) 1, SEQ ID NO; or

ii) an amino acid sequence obtained by connecting a label at the N end and/or the C end of the i); or

iii) And the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the antibody with the same function.

The nano-antibody can be prepared by the following method: synthesizing a triclosan hapten T1 shown as a formula I) by using a chemical reaction: 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid, hapten and keyhole limpet hemocyanin are coupled to be used as immunogen, an immune experimental animal camel is used for extracting total RNA of peripheral hemolymphocytes, a nano antibody heavy chain (VHH) gene fragment is cloned through reverse transcription and nested PCR, the gene fragment is cloned to a phagemid carrier through enzyme digestion connection, the gene fragment is efficiently converted into escherichia coli, a phage nano antibody library is constructed through assistant phage rescue, an anti-triclosan nano antibody is screened out, and the anti-triclosan nano antibody with high sensitivity is obtained through expression and purification. The prepared nano antibody has small molecules, strong solubility, high temperature resistance, easy purification and easy expression.

In a second aspect, the invention provides nucleic acid molecules encoding the nanobodies.

In a third aspect, the invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, phage vectors, viral vectors or engineered bacteria.

In a fourth aspect, the invention provides a triclosan detection reagent or kit, wherein the effective component is the nano antibody.

In a fifth aspect, the invention provides a triclosan hapten T1 which is 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid. The structural formula is shown in formula I):

in a sixth aspect, the invention provides a triclosan artificial antigen, which is obtained by coupling the triclosan hapten with a carrier protein.

Wherein the carrier protein is selected from bovine serum albumin and keyhole limpet hemocyanin. And coupling the carrier protein to the carboxyl group of the triclosan hapten by adopting an activated ester method.

In a seventh aspect, the invention relates to an ELISA detection kit for analyzing triclosan residues, comprising a kit body, a detachable ELISA plate arranged in the kit body and a reagent arranged in the kit body, wherein each hole of the ELISA plate is coated with a triclosan antigen T1, and the reagent comprises at least one of a nano antibody, a triclosan standard solution, an enzyme-labeled secondary antibody, a buffer solution PBS, a washing solution PBST, a developing solution (solution A), a developing solution (solution B), a reaction termination solution and the like.

Wherein, the triclosan hapten T1 can be prepared by the following method:

a mixture of triclosan (400mg, 1.38mmol), tert-butyl 4-bromo-butyrate (399mg, 1.79mmol) and potassium carbonate (286mg, 2.07mmol) was reacted in 2mL anhydrous DMF at 100 ℃ for 3 hours. The resulting mixture was filtered to remove excess K produced in the reaction ₂ CO ₃ And HBr. The 20mL of ethyl acetate diluted filtrate was washed twice with 20mL of distilled water. The organic layer was dried over anhydrous sodium sulfate, and the solvent was removed by rotary evaporation. The residue was chromatographed on silica gel, eluting with a mixture of ethyl acetate/hexane (1, 2,v/v). The fractions containing the pure product were stripped by thin layer chromatography under high vacuum to give 179mg of a clear oily compound.

0.5mL of trifluoroacetic acid (TFA) was added to the above clear oily compound, and the mixture was allowed to stand at ambient temperature for 30 minutes. After addition of 50mL of distilled water and acidification to pH 2 with 6N HCl, the mixture was extracted twice with 50mL of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and the solvent was removed by rotary evaporation. The concentrate was recrystallized from a mixture of ethyl acetate and hexane to give triclosan hapten T1.

The triclosan coating antigen is a coupling compound of hapten T1 and bovine serum albumin, and the preparation method of the coating antigen comprises the following steps: (1) 7.5mg of hapten, 2.65mg of N-hydroxysuccinimide and 4.8mg of N, N' -dicyclohexylcarbodiimide were dissolved in 200. Mu.L of anhydrous dimethylformamide and stirred at room temperature overnight to effect a reaction. The reaction mixture was centrifuged (5000 rpm, 10min), the precipitate was discarded, and the supernatant containing the active ester was collected. (2) Bovine serum albumin (20 mg) was dissolved in 2mL of 0.05M, pH 9.6 carbonate buffer, and the supernatant was added dropwise with stirring, slowly at the end of about 20 min. The reaction was then stirred for a further 4h at room temperature. (3) After the reaction, the reaction solution was filled into a dialysis bag and dialyzed with PBS (0.01 mol/L, pH 7.4); the liquid is changed once every 6h, and the liquid is changed for 5-6 times. And centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen coating solution.

The ELISA plate is a 96-hole ELISA plate, and the coating concentration of the coating antigen is 60ng/mL.

The concentration of the nano antibody is 100ng/mL.

The enzyme-labeled secondary antibody is an anti-HA label antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL. Purchased from Abcam, trade number: ab1265.

The color developing solution A consists of carbamide peroxide 1g, citric acid 10.3g and Na ₂ HPO ₄ ·12H ₂ 35.8g of O, 100 mu L of Tween-20 and 1000mL of distilled water, and the pH value is 5.

The color developing solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4.

The reaction termination solution is a 2M sulfuric acid solution.

In an eighth aspect, the invention provides an application of the polypeptide in detecting triclosan residues in a sample by an ELISA method.

In a ninth aspect, the invention provides a triclosan ELISA detection reagent, and the effective component is the nano antibody.

In a tenth aspect, the invention provides the use of the kit or the reagent in detecting triclosan residues in a sample by an ELISA method.

During analysis and detection, a to-be-detected triclosan sample and the nano antibody are sequentially added into each hole of the enzyme label plate coated with the triclosan coating antigen, the solid phase coating antigen and the to-be-detected triclosan compete with each other to react with the nano antibody, and because the contents of the solid phase antigen and the added single chain antibody in each hole are consistent, when the concentration of the to-be-detected triclosan is high, the amount of the antibody bound on the solid phase antigen is small, the binding amount of the added enzyme-labeled secondary antibody and the fixed antibody is small, and finally, a substrate solution and a developing solution are added, so that the developing reaction is light, the OD value detected by an enzyme label analyzer is low, and the inhibition rate is high; on the contrary, when the concentration of the triclosan to be detected is low, the detected OD value is high, and the inhibition rate is low. The concentration of the triclosan to be detected can be calculated according to a standard curve drawn by using a triclosan standard solution with a known concentration.

The invention further provides a triclosan ELISA detection reagent, and the effective component of the reagent is the anti-triclosan nano antibody.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or the conditions as recommended by the manufacturer's instructions. EXAMPLE 1 preparation of triclosan-coated antigen

Hapten 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid and bovine serum albumin are used for preparing a coupling compound which is used as a coating antigen. The preparation method comprises the following steps:

(1) Dissolving 7.5mg of 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid, 2.65mg of N-hydroxysuccinimide and 4.8mg of N, N' -dicyclohexylcarbodiimide in 200. Mu.L of anhydrous dimethylformamide, and stirring at room temperature overnight to effect a reaction; centrifuging the reaction solution, removing the precipitate, and collecting the supernatant;

(2) Dissolving 20mg of bovine serum albumin in 2mL of 0.05M carbonate buffer solution with pH of 9.6, dropwise adding the supernatant under stirring, and continuously stirring at room temperature for reaction for 4 hours after the addition is finished;

(3) After the reaction is finished, putting the reaction solution into a dialysis bag and dialyzing with PBS; changing the liquid once every 6h, and changing the liquid 5-6 times in total; and centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen coating liquid.

Example 2 construction of triclosan Nanobody library

The hapten and keyhole limpet hemocyanin of example 1 were coupled by an active ester method, which was as follows:

equimolar amounts of 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid, NHS and DCC were dissolved in DMF and stirred at room temperature overnight for reaction. The reaction solution is centrifuged and the precipitate is discarded, and the supernatant is the active ester. And adding the supernatant into the keyhole limpet hemocyanin solution under the stirring state, and continuously stirring and reacting for 4 hours at room temperature. The reaction solution was filled in a dialysis bag and dialyzed with PBS. Centrifuging, collecting supernatant, and freeze drying to obtain the conjugate of 4- (5-chloro-2- (2,4-dichlorophenoxy) phenoxy) butyric acid and keyhole limpet hemocyanin.

Dissolving 1mg of conjugate in 1mL of physiological saline, mixing with 1mL of complete Freund's adjuvant, emulsifying completely, injecting into camel, enhancing immunity once every two weeks, mixing with immunogen, performing subcutaneous multipoint immunization on neck and back for 5 times. Starting from the third immunization, serum titers were measured from jugular vein blood sampling one week after each immunization.

Separating white blood cells from peripheral blood after 5 th immunization, extracting total RNA, cloning a VHH gene fragment through reverse transcription PCR and nested PCR, modifying a cohesive end with restriction enzyme SfiI, connecting the VHH gene fragment to phagemid pComb3x through T4 ligase, and performing high-efficiency electric transformation to escherichia coli ER2738 to construct a triclosan phage nano antibody library. The primary reservoir volume is determined to be 10 ⁸ cfu, adding helper phage (multiplicity of infection is 20) M13KO7 for rescue, and obtaining a phage nanobody library with the library capacity of 10 ¹² pfu/mL, the diversity of the library was good.

Reverse transcription PCR:

the reverse transcription kit adopts PrimeScript ^TM RT-PCR Kit, purchased from TaKaRa, under the trade designation: AK2701.

The reverse transcription system is as follows:

the reaction was carried out at 65 ℃ for 5min. Taking out and placing on ice, loading the sample according to the following system, and carrying out first strand cDNA synthesis.

Reaction conditions are as follows: 10min at 30 ℃; 1h at 42 ℃; 5min at 72 ℃.

Nested PCR:

first round PCR:

the reaction system is as follows:

the reaction procedure was as follows: pre-denaturation at 94 ℃ for 3min; 30s at 94 ℃, 30s at 55 ℃, 50s at 72 ℃ and 25 cycles; 5min at 72 ℃.

Second round PCR:

the reaction system is as follows:

the reaction procedure was as follows: pre-denaturation at 94 ℃ for 3min; 30s at 94 ℃, 40s at 62 ℃, 40s at 72 ℃ and 25 cycles; 5min at 72 ℃.

The nested PCR primer sequences were as follows (5 '-3'):

GSP-RT：CGCCATCAATRTACCAGTTGA

LP-leader：GTGGTCCTGGCTGCTCTW

F：CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC

R：CATGCCATGACTCGCGGCCGGCCTGGCCTGGTTGTGGTTGTGGTTGT

wherein R represents a base A/G, W represents a base A/T, and K represents a base G/T.

Example 3 screening of triclosan Nanobodies

Coating the coated antigen prepared in the example 1 on the 1 st hole of a 96-hole enzyme label plate, wherein the coating concentration is 50ng/mL, and the temperature is 4 ℃ overnight; the next day, pouring out the coating solution, washing with PBST for 3 times, blocking the 1 st and 2 nd holes of the ELISA plate with BSA, and incubating for 1h at 37 ℃; pouring out the blocking solution, and washing with PBST for 3 times; adding the phage antibody library of example 2 into the 1 st well, and reacting for 2h; pouring out the liquid, patting dry on clean absorbent paper, and washing with PBST for 5 times; adding 100 mu L of triclosan standard into the 1 st hole, and reacting for 1h; sucking out the liquid in the 1 st hole, adding the liquid into the 2 nd hole, reacting for 1h, and removing the phage bound with the BSA; the eluate was collected, 5. Mu.L was used for titer determination, and the remainder was used for amplification.

Adding the phage eluate into fresh Escherichia coli ER2738 bacterial liquid, and standing at 37 deg.C for 15min; adding carbenicillin and SB culture medium, culturing at 37 deg.C and 220rpm for 2 hr; adding helper phage M13KO7 (multiplicity of infection MOI = 20) and kanamycin, and culturing overnight; the next day, the supernatant was centrifuged and purified by adding PEG-NaCl solution.

And (3) carrying out next round of screening on the amplification products to ensure that the addition amount of each round of screening is the same, the antigen coating concentration and the triclosan standard substance competitive elution concentration are decreased progressively according to 2 times, calculating the titer of each round, and selecting a monoclonal for amplification and ELISA identification. Positive monoclone is obtained through 4 rounds of panning.

Example 4 expression of triclosan Nanobodies

Extracting positive monoclonal plasmid, transforming to escherichia coli TOP10F' competent cell, recovering, coating on solid culture medium for overnight culture. The next day, selecting a single clone, culturing in a SB-benzyl carboxylate culture medium, and adding IPTG to induce overnight expression; the next day, cells are cracked by an ultrasonic crusher, the cells are filtered by a filter membrane and then purified by a nickel column, namely, the affinity chromatography of a histidine tag and nickel chloride in the nickel column is utilized to separate and purify the nano antibody to obtain the high-purity anti-triclosan nano antibody, and the amino acid sequence of the obtained nano antibody is shown as SEQ ID NO. 1 through amino acid sequencing analysis.

Example 5 Cross-reactivity of anti-triclosan Nanobodies

Selecting triclosan structural analogues to determine and evaluate the specificity of the VHH-ELISA method, diluting triclosan hapten T1-BSA, coating the diluted triclosan hapten T1-BSA on a 96-hole ELISA plate, enabling each hole to be 100 mu L, and carrying out overnight reaction at 4 ℃; the next day, the liquid in the wells was thrown off, washed 3 times with PBST containing 0.05% tween, and the elisa plate was inverted on absorbent paper and patted dry; adding a sealing solution, incubating at 37 ℃ for 30 minutes, throwing the liquid in the hole, washing for 3 times by using 0.05% PBST, and inverting the ELISA plate on water-absorbent paper to dry; respectively prepare 0ng/mL,1ng/mL,4ng/mL,12ng/mL,37ng/mL,111ng/mL,333ng/mL,1000ng/mL of triclosan structural analog (Table 1) standard solution, adding 50 μ L of standard sample to each well, repeating for 2-4 times, adding 50 μ L of diluted antibody, incubating for 30 minutes at 37 ℃; throwing the liquid in the hole, washing for 3 times by PBST, inverting the ELISA plate on water-absorbent paper, and patting to dry; adding enzyme-labeled secondary antibody, and incubating for 30 minutes at 37 ℃; the liquid in the wells was spun off, washed 3 times with PBST and patted dry; and (3) uniformly mixing the solution A and the solution B in equal volume, adding 100 mu L of solution A into each hole, performing light-shielding color development for 10-15 minutes, adding a stop solution to terminate the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme-labeling instrument. Separately calculating IC of each analog to be measured ₅₀ Values, using the following formula: cross reaction rate = [ IC = ₅₀ (triclosan)/IC ₅₀ (analogues)]The cross-reactivity was calculated at 100% (Table 1).

TABLE 1

Example 6 construction and application of ELISA detection kit for triclosan residue analysis

The kit comprises a kit body, a 96-hole elisa plate which is arranged in the kit body in a detachable manner and a reagent arranged in the kit body, wherein each Kong Bao of the elisa plate is coated with the triclosan coated antigen of the embodiment 1, and the reagent comprises an anti-triclosan nano antibody (SEQ ID NO: 1), a triclosan standard solution, an elisa secondary antibody, a buffer solution PBS (phosphate buffered saline), a washing solution PBST (PBST), a substrate solution (solution A), a color development solution (solution B), a reaction stop solution and the like.

The concentration of the nano antibody is 100ng/mL.

The enzyme-labeled secondary antibody is an anti-HA-labeled antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL. Purchased from Abcam, inc, under the trade designation: ab1265.

The solution A comprises carbamide peroxide 1g, citric acid 10.3g and Na ₂ HPO ₄ ·12H ₂ 35.8g of O, 100 mu L of Tween-20 and 1000mL of distilled water, and the pH value is 5.

The solution B is prepared from 700mg of tetramethyl benzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4.

The reaction termination solution was 2M sulfuric acid solution.

Coating the coated antigen on a 96-well enzyme label plate, wherein the coating concentration of each well is 60ng/mL, and reacting at 4 ℃ overnight; the next day, the liquid in the wells was spun off, washed 3 times with PBST containing 0.05% tween, and the microplate was inverted and patted dry on absorbent paper; adding confining liquid, incubating at 37 ℃ for 30 minutes, throwing off liquid in holes, washing with 0.05% PBST for 3 times, inverting the ELISA plate on absorbent paper, and patting dry; preparing triclosan standard solution with the concentration of 0ng/mL,1ng/mL,4ng/mL,12ng/mL,37ng/mL,111ng/mL,333ng/mL and 1000ng/mL, adding 50 mu L of standard sample or treated sample into each well, repeating the standard sample and the sample for 2-4 times, adding 50 mu L of diluted antibody, and incubating at 37 ℃ for 30 minutes; throwing the liquid in the hole, washing with PBST for 3 times, and inversely arranging the ELISA plate on water-absorbent paper for patting dry; adding enzyme-labeled secondary antibody, and incubating for 30 minutes at 37 ℃; the liquid in the wells was thrown out, the plates were washed 3 times with PBST and patted dry; and (3) uniformly mixing the solution A and the solution B in equal volume, adding 100 mu L of solution A into each hole, performing light-shielding color development for 10-15 minutes, adding a stop solution to terminate the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme-labeling instrument.

The OD value of the standard well containing 0ng/mL minus the OD value of the standard well containing the maximum concentration is determined as B ₀ The OD values of the other holes corrected by the same method are set as B; with B/B ₀ The values are plotted on the ordinate and the corresponding standard concentrations are plotted on the abscissa, and a triclosan standard inhibition curve is plotted (FIG. 1). The concentration of the corresponding sample can be obtained according to the regression equation of the curve, and the concentration IC in the triclosan inhibition can also be obtained ₅₀ (B/B ₀ = 50%) and minimum detection limit IC ₂₀ (B/B ₀ ＝80％)。

In the actual sample detection process, the coating antigen (the coating concentration is 60 ng/mL) adsorbed on the pore wall of the ELISA plate and the triclosan to be detected compete with each other to react with the antibody, and the competitive result is obtained through a color reaction. The concentration of the triclosan in the sample to be detected can be calculated by detecting the triclosan with the known concentration and drawing a standard curve.

The method has the advantages that the method can accurately and sensitively detect the triclosan residues in water, soil and vegetables, the pretreatment process of the sample is simple, the consumed time is less, a large number of samples can be detected simultaneously, and the sample detection cost is far lower than that of the traditional instrument detection method.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Claims (10)

1. An anti-triclosan nanobody, wherein the nanobody comprises or consists of an amino acid sequence as follows:

i) 1, SEQ ID NO; or

ii) an amino acid sequence obtained by connecting a tag to the N-terminal and/or C-terminal of i); or

iii) And the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the antibody with the same function.

2. A nucleic acid molecule encoding the nanobody of claim 1.

3. Biological material comprising a nucleic acid molecule according to claim 2, wherein the biological material is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium.

4. The triclosan detection reagent or kit, characterized in that the effective ingredient is the nanobody of claim 1.

5. The ELISA kit for detecting the triclosan residue based on the nano antibody is characterized by comprising a kit body, a detachable ELISA plate and a reagent, wherein the ELISA plate is arranged in the kit body; each hole of the ELISA plate is coated with a triclosan artificial antigen, and the reagent comprises the nano antibody of claim 1 and at least one of a triclosan standard solution, an ELISA secondary antibody, a PBS buffer solution, a PBST cleaning solution, a color development solution and a reaction stop solution.

6. The ELISA kit of claim 5 wherein the triclosan artificial antigen is obtained by coupling a triclosan hapten of formula I) to a carrier protein;

wherein the carrier protein is selected from at least one of bovine serum albumin, keyhole limpet hemocyanin, ovalbumin, thyroid protein and human serum albumin, preferably bovine serum albumin and keyhole limpet hemocyanin.

7. The ELISA kit of claim 6, wherein the preparation method of the antigen coating solution for coating the ELISA plate comprises:

(1) Dissolving 7.5mg of the triclosan hapten of formula I), 2.65mg of N-hydroxysuccinimide and 4.8mg of N, N' -dicyclohexylcarbodiimide in 200. Mu.L of anhydrous dimethylformamide, and stirring at room temperature overnight to effect a reaction; centrifuging the reaction solution, removing the precipitate, and collecting the supernatant;

(2) Dissolving 20mg of bovine serum albumin in 2mL of 0.05M carbonate buffer solution with pH of 9.6, dropwise adding the supernatant under stirring, and continuously stirring at room temperature for reaction for 4 hours after the addition is finished;

(3) After the reaction is finished, putting the reaction solution into a dialysis bag and dialyzing with PBS; changing the liquid once every 6h, and changing the liquid 5-6 times in total; centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen coating solution;

preferably, the ELISA plate is a 96-well ELISA plate, and the coating concentration of the coating antigen is 50-70ng/mL.

8. The ELISA kit of any one of claims 5 to 7 wherein the concentration of the nanobody is 90-110ng/mL; and/or

The enzyme-labeled secondary antibody is an anti-HA label antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL; and/or

The color development liquid comprises liquid A and liquid B, wherein the liquid A is prepared from 1g of carbamide peroxide, 10.3g of citric acid and Na ₂ HPO ₄ ·12H ₂ 35.8g of O, 100 mu L of tween-20 and 1000mL of distilled water, and the pH value is 5; the solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4; and/or

The reaction termination solution is a 2M sulfuric acid solution.

9. The nanobody of claim 1 for any one of the following uses:

1) The method is used for triclosan detection;

2) Used for preparing a triclosan detection reagent or a kit;

3) Used for the enrichment and purification of triclosan;

4) An enrichment and purification reagent for preparing triclosan.

10. Use of a detection reagent or kit according to claim 4 or an ELISA kit according to any of claims 5-8 for detecting triclosan residues in a sample.

Images