CN107556385A - Bicyclic peptide Fc 4C and its application in antibody test and expression of recombinant proteins - Google Patents

Abstract

The invention provides bicyclic peptide Fc 4C, its amino acid sequence is CDCAWHLGELVWCTC.It is demonstrated experimentally that the bicyclic peptides of Fc 4C can be efficiently applied to the fields such as the expression and purification of antibody test and recombinant protein, have broad application prospects.

Description

Bicyclic peptide Fc-4C and its application in antibody test and expression of recombinant proteins

Technical field

The present invention relates to protein engineering field, in particular to bicyclic peptide Fc-4C and its in antibody test and restructuring Application in protein expression and purification.

Background technology

Bacteriophage is demonstrated and polypeptide simulation is all the technical way for finding target protein polypeptide ligand【1-3】.By part Polypeptide is coupled to agarose gel particle, magnetic bead or is connected with fluorescence molecule, and can apply to detect or purify therewith has high parent With the destination protein of power.In addition, polypeptide ligand can also be used as affinity tag to be recombinantly expressed with destination protein, can by affinity chromatography Destination protein is isolated and purified【4-7】.In recent years, it is pure for the expression of recombinant protein to have developed many affinity tags by people Change, for example, His labels, Flag labels, glutathione-sulfurtransferase (GST) label, maltose-binding protein (MBP) label with And Fc-III labels【8-13】.Different affinity tags has its respective scope of application and limitation, therefore develops newly affine Label technique is particularly significant with purification art for Protein Detection.

Fc-III polypeptides are initially to be screened from cyclic peptide library by display technique of bacteriophage to come, and it is for IgG-Fc Fragment has special compatibility.The amino acid sequence of Fc-III fragments is DCAWHLGELVWCT, and it can pass through in fragment two and half Disulfide formation between cystine has the cyclic peptide of β-hairpin structure【14】.As albumin A (ProA) or Protein G (ProG) Analog, Fc-III is the same as there is stronger affinity (dissociation constant 185nM) between IgG Fc fragments【15】.Before inventor Develop the amalgamation and expression and purification system of protein using Fc-III cyclic peptide, while also demonstrate Fc-III labels for purpose The structure of albumen and activity influence very little【16-17】.

However, only a pair of disulfide bond are for stablizing the support force of β-hairpin structure of whole polypeptide in Fc-III polypeptides It is limited.Ricardo et al. adds left and right rotation proline (D-Pro-L-Pro) at Fc-III N, C both ends and forms acid amides respectively Key so that Fc-III becomes the FcBP-2 with twin nuclei.FcBP-2 and IgG affinity is higher than original Fc-III closely 80 times【15】.But containing Dextrorotatory amino acids and its cyclization is relied in FcBP-2, this causes FcBP-2 to be difficult to apply to albumen Recombinantly express purification system.

The content of the invention

We have carried out improvement and design for Fc-III sequences, and two and half are added respectively at N, C both ends of Fc-III polypeptides Cystine, D-Pro-L-Pro connection is simulated by forming disulfide bond between cysteine.This polypeptide is named as by we Fc-4C.Fc-4C equally has twin nuclei, and it is higher than Fc-III 35 times with the affinity of human IgG.Meanwhile Fc-4C with it is small The IgG of the species such as mouse, rabbit, rat, ox, sheep, horse and pig dissociation constant (K_d) all within 30nM；Compared to albumin A or Fc-III, Fc-4C had both improved the affinity with IgG, it may have species broad spectrum activity.Fc-4C is coupled to agarose and coagulated by us Effectively the IgG in serum can be isolated and purified out on glue particle.Fc-4C also can be used for recombinant protein as affinity tag Expression and purification.It has been found that Fc-4C can combine the metal ion of the First Transition systems such as Zn, Ni, Co, Cu, and lifted with metal Ion is the activity of the recombinant protein of coenzyme.It was proved that the bicyclic peptides of Fc-4C can efficiently and rapidly be applied to antibody and again The purification art of histone, it is very easily instrument.

One aspect of the present invention provides a kind of polypeptide Fc-4C, and its amino acid sequence is CDCAWHLGELVWCTC (SEQ ID NO：1).

In embodiments of the invention, Fc-4C can be coupled with label, for example, with horseradish peroxidase, alkalescence Phosphatase or fluorescein coupling.

Present invention also offers Fc-4C polypeptides and its conjugate (such as the conjugate to be formed is coupled with label) to purify Application in IgG or its Fc fragment.

Present invention also offers the application of Fc-4C polypeptides and its conjugate in immune detection, such as Western blotting or exempt from Epidemic disease fluorescence.

Present invention also offers application of the Fc-4C polypeptides as fusion tag.

In embodiments of the invention, Fc-4C polypeptides can be connected as fusion tag with destination protein, will pass through Purification system based on IgG or its Fc fragment purifies to the destination protein.

In a preferred embodiment of the invention, Fc-4C polypeptides are particularly suitable for application as fusion tag and with transition metal Ion connects for the destination protein of coenzyme.Preferably, wherein the transition metal ions is the metal ion of First Transition system, example Such as Zn²⁺、Ni²⁺、Co²⁺、Cu²⁺.The destination protein using transition metal ions as coenzyme can be carbonic anhydrase.

Present invention also offers fusion protein, includes Fc-4C polypeptides and the protein being coupled.

Present invention also offers solid-phase matrix, and wherein Fc-4C polypeptides or its conjugate or fusion protein is fixed on described In solid-phase matrix.The solid-phase matrix can be agarose particle or magnetic bead.

Present invention also offers the nucleic acid molecules of the polypeptide of coding claim 1.For example, the base sequence of the nucleic acid molecules Can be：TGTGACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTTGT(SEQ ID NO：2).

Present invention also offers expression vector, and it includes nucleic acid molecules described above, and necessary expression regulation member Part.

Present invention also offers the IgG in detection sample or the method for its Fc fragment, including：By the sample and Fc-4C Polypeptide or the contact of its conjugate or fusion protein；And measure Fc-4C polypeptides or its conjugate or fusion protein and the sample In IgG or its Fc fragment combination it is horizontal.

Present invention also offers purifying, enrichment from sample or IgG or the method for its Fc fragment are removed, including：It will contain IgG or the sample of its Fc fragment contact with Fc-4C polypeptides or its conjugate or fusion protein；And isolated from sample with The IgG or its Fc fragment that Fc-4C polypeptides or its conjugate or fusion protein combine.For example, Fc-4C polypeptides or its conjugate or melting Hop protein can be fixed in solid-phase matrix, such as agarose particle or magnetic bead.

Present invention also offers the method for purifying or being enriched with destination protein, including：Restructuring produces fusion protein, the fusion egg Include destination protein and Fc-4C polypeptides in vain；Sample containing the fusion protein is contacted with IgG or its Fc fragment；And from sample The fusion protein combined with IgG or its Fc fragment is isolated in this.If it is necessary, then it can be released from the fusion protein Release the destination protein.

Present invention also offers for detection or the kit of IgG purification or its Fc fragment, Fc-4C polypeptides or its idol are included Join thing or fusion protein, or solid-phase matrix, wherein Fc-4C polypeptides or its conjugate or fusion protein are fixed on the solid phase In matrix.

Brief description of the drawings

Fig. 1 shows the identification of Fc-4C disulfide bond.A schemes：Ring-type Fc-4C and the Fc-4C first mass spectrometrics after Asp-N digestions Figure.B schemes：Fc-4C second order mses figures after Asp-N digestions.C schemes：The Sequence annotation of second order mses characteristic peak.

Fig. 2 shows albumin A coupling particle and Fc-4C coupling particle purifying human serum IgGs and rabbit anteserum IgG effects pair Than figure.A schemes：Swimming lane is respectively from left to right, 1, whole human blood albumin；2nd, the effluent after Protein A purification；3rd, Protein A purification Eluted product；4th, the effluents of Fc-4C after purification；5th, the eluted products of Fc-4C after purification；6th, the outflows of Fc-III after purification Thing；7th, the eluted products of Fc-III after purification；8th, the effluent of negative control after purification；9th, the elution production of negative control after purification Thing；10th, molecular weight of albumen scale.B schemes：Swimming lane is respectively from left to right, 1, full rabbit serum proteins；2nd, Protein A purification rabbit anteserum Product；3rd, the product of the Fc-4C purifying rabbit anteserums of 1 batch coupling；4th, the Fc-4C purified rabbit sera products of 2 batches coupling；5、 Molecular weight of albumen scale；6th, whole human blood albumin；7th, the product of Protein A purification human serum；8th, the Fc-4C purifying of 1 batch coupling The product of human serum；9th, the product of the Fc-4C purifying human serums of 2 batches coupling.

Fig. 3 shows that albumin A coupling particle is coupled particle in different temperature, pH equilibrium conditions and denaturation from Fc-4C Purification efficiency under the conditions of agent.A schemes：Swimming lane is respectively from left to right, 1, whole human blood albumin；2nd, after 55 DEG C of processing, albumin A is pure Effluent after change；3rd, after 55 DEG C of processing, Protein A purification eluted product；4th, after 55 DEG C of processing, the effluents of Fc-4C after purification； 5th, after 55 DEG C of processing, the eluted products of Fc-4C after purification；6th, molecular weight of albumen scale；7th, when pH 6.0 is balanced, Protein A purification Effluent afterwards；8th, when pH 6.0 is balanced, the eluted product after Protein A purification；9th, when pH 6.0 is balanced, Fc-4C is after purification Effluent；10th, when pH 6.0 is balanced, the eluted products of Fc-4C after purification.B schemes：Albumin A is coupled particle and Fc-4C coupling particles Purification efficiency under pH 5.0-8.0 equilibrium conditions.C schemes：Albumin A is coupled particle and is coupled particle in different denaturation from Fc-4C Purification efficiency after agent processing.

Fig. 4 shows that Fc-4C is used for the detection of albumen as secondary antibody.A schemes：Pass through Immunofluorescence test with FITC-Fc-4C β-tubulin Subcellar location.B schemes：Subcellar location with FITC-Fc-4C by Immunofluorescence test PCNA.C schemes： Pass through the PRDX3 in immune-blotting method 293T cells, CA II, CD38 albumen with HRP-Fc-4C.

Fig. 5 shows the Fc-4C polypeptide fragment mass spectrograms of reduction and non-reducing recombination expression.A schemes：Upper figure is fusion First mass spectrometric peak of the CA Fc-4C fragments after enzymolysis, mass spectra peak of the minimum isotopic peak in 1005.88m/z are EFCDCAWHLGELVWCTC(SEQ ID NO：1) divalence polypeptide fragment.Figure below is that the Fc-4C fragments for having merged CA are reducing And be alkylated, digest after first mass spectrometric peak, mass spectra peak of the minimum isotopic peak in 1121.94m/z be EFCDCAWHLGELVWCTC(SEQ ID NO：1) divalence polypeptide fragment is in the structure that disulfide bond is opened and is alkylated.B schemes：Two The 1121.94m/z of valency second order mses peak.Related b, y ion, which has marked out, to be come.

Fig. 6 is to move (MST) by micro thermophoresis to determine fusion protein F c-4C-CA, Fc-III-CA and Z-CA with human IgG Affinity, its dissociation constant are respectively 2.28,23.0 and 13.7nM.

Fig. 7 is the electrophoretogram with His label purification of recombinant proteins using Fc-4C labels.A schemes：Swimming lane is distinguished from left to right It is 1＆5, the full bacterium lysate albumen of recombinant protein Fc-4C labels and His tag fusions CA；2nd, Fc-4C merges the cracking after CA Liquid supernatant；3rd, the purifying effluent of IgG particle rich is used after Fc-4C fusions CA；4th, Fc-4C uses IgG particle rich after merging CA Purified product；6th, His tag fusions CA lysate supernatant；7th, the effluent being enriched with after His tag fusions CA with Ni posts；8、 The eluted product being enriched with after His tag fusions CA with Ni posts；9th, molecular weight of albumen scale.B schemes：Swimming lane is respectively from left to right, 1st, recombinant protein Fc-4C tag fusions CK full bacterium lysate albumen；2nd, Fc-4C merges the lysate supernatant after CK；3、Fc-4C The purifying effluent of IgG particle rich is used after fusion CK；4th, the purified product of IgG particle rich is used after Fc-4C fusions CK.

Fig. 8 shows influence of the Fc-4C labels to the structure and heat endurance of destination protein.A schemes：Circular dichroism spectra determines Fc-4C merges CA and His tag fusions CA secondary structure.B schemes：Utilize the CA that circular dichroism spectra merges to Fc-4C and His labels The CA heat endurances of fusion are probed into.

Fig. 9 shows the CA and His tag fusions CA of Zn ion pairs Fc-4C fusions influence.A schemes：Various concentrations melt The measure of hop protein CA enzyme activities.B schemes：Supplement 1mM Zn²⁺The measure of the CA enzyme activities of various concentrations afterwards.

Figure 10 Fc-4C that have been 293T cell transfectings fusions GFP fluorogram.A schemes：Untransfected GFP；B schemes：Transfect wild The GFP of type；C schemes：The GFP of N-terminal fusion Fc-4C labels is transfected；D schemes：The GFP of C-terminal fusion Fc-4C labels is transfected.

Figure 11 shows influence of the transition metal ions such as Zn, Ni, Co, Cu of various concentrations to Fc-4C.A schemes：It is different dense Quenching of the transition metal ions such as Zn, Ni, Co, Cu of degree to Fc-4C endogenous fluorescences.B schemes：The transition metal such as Zn, Ni, Co, Cu Ion and Fc-4C combination metering ratio.

Table 1 shows the IgG of different plant species and the binding constant of Fc-4C, Fc-III, Z- domain.

Table 2 shows the metal ion derived by theoretical calculation and Fc-4C binding constants and dissociation constant.

Embodiment

Term " Fc-4C " used herein, " Fc-4C peptides " or " Fc-4C polypeptides " are interchangeable, and refer to that sequence is CDCAWHLGELVWCTC(SEQ ID NO：1) peptide, it has four cysteines, can be formed with two pairs by oxidation The stable twin nuclei of disulfide bond.

Term " peptide ", " polypeptide " and " protein " used herein is interchangeable, and refers to pass through peptide bond by amino acid The polymer for connecting and being formed.

Term " label " used herein refers to be connected with Fc-4C polypeptides and has the material of indicative function, example Such as fluorescein, alkaline phosphatase or horseradish peroxidase.For example, horseradish peroxidase, alkaline phosphatase etc. are available Amplify in the signal of immunoblotting reaction.

Term " conjugate of Fc-4C polypeptides " used herein refers to that Fc-4C polypeptides are connected the idol to be formed with coupling part Join thing.For example, Fc-4C polypeptides can be coupled with label such as fluorescein, can also be with the modification group such as polyethylene glycol (PEG) Coupling.

Term " solid-phase matrix " used herein refers to the basic medium in solid phase, such as agarose gel particle or magnetic Pearl.For example, in specific embodiments of the present invention, Fc-4C peptide fragments are coupled on agarose gel particle can be efficiently fast Prompt ground isolates and purifies to IgG.

Term " fusion protein " used herein has implication well known in the art, refer to have derive from two or more The protein or polypeptide of the amino acid sequence of individual protein.As it is known by the man skilled in the art, fusion protein can also include ammonia Base acid bonding pad.

Term " antibody " used herein or " immunoglobulin " have an implication well known in the art, including whole antibody or Its any antigen-binding fragment (i.e. " with reference to antigen part ") or single-stranded.Naturally occurring " antibody " is to include to pass through disulfide bond phase At least two heavy chains (H) and the glycoprotein of two light chains (L) to connect.

Term IgG used herein " Fc fragments " refers to the fragment in the Fc areas comprising IgG." Fc fragments " can include single CH2 the and CH3 domains of the heavy chain of the heavy chain hinge polypeptide and immunoglobulin of aggressiveness or dimeric forms.In some embodiment party In case, term " Fc areas " can refer to the region being made up of CH2 the and CH3 domains of H chains." Fc areas " can be contained in " Fc pieces In section ".

IgG Fc fragments can be obtained by protease hydrolytic IgG, can also be obtained by other method known in the art .

The Fc-4C polypeptides of the present invention not only have high affinity to human IgG, and have species broad spectrum activity.Test table Bright, Fc-4C polypeptides of the invention all exist to the IgG of the species such as mouse, rabbit, rat, ox, sheep, horse and pig dissociation constant Within 30nM.Therefore, term " IgG " used herein is not limited to human IgG, its be likewise covered by from mouse, rabbit, rat, The IgG of the species such as ox, sheep, horse and pig.

Term " purification system of the Fc fragments based on IgG or IgG " refers to produce purpose using IgG or IgG Fc fragments The system that thing is purified.For example, IgG or its Fc fragment can be fixed on solid phase carrier for example on agarose gel particle, In order to be isolated and purified to destination protein (such as carbonic anhydrase with Fc-4C peptide fusions).

Term " immune detection " (immunoassay) refers to the method for applied immunology technology measure sample.Including for example Immune-blotting method and Immunofluorescence test.

Term " fusion tag " (fusion tag) refers to be connected with destination protein in order to such as destination protein Purifying or the material of detection.Common fusion tag includes such as polyhistidine label (His-Tag), GST-Tag, Trx- Tag, Flag-Tag, S-Tag etc..

The bicyclic peptide Fc-4C of embodiment 1 preparation and property research

Research overview

Fc-III is one section of polypeptide being made up of 13 amino acid residues, and its conformation is ring-type hairpin structure, and is contained The intrachain disulfide bond that two cysteine residues are formed.Have been reported prove Fc-III can have with IgG Fc hinge area it is stronger Affine combination.In order to lift affinity therebetween, we have been designed and synthesized based on Fc-III contains four and half Guang ammonia The polypeptide Fc-4C of acid, the stable twin nuclei with two pairs of disulfide bond can be formed by oxidation.Determination data shows Fc-4C 35 times are improved than Fc-III with the affinity of human IgG, while to species such as mouse, rabbit, rat, ox, sheep, horse and pigs IgG dissociation constant is all within 30nM；Fc-4C had both improved the affinity to IgG, it may have species broad spectrum activity.By Fc-4C Peptide fragment, which is coupled on agarose gel particle, efficiently and rapidly to be isolated and purified to IgG；Fc-4C connection horseradish peroxidating Western blotting can be additionally operable to after thing enzyme HRP or fluorescein FITC, immunofluorescence experiment carries out the positioning and detection of protein.Separately Outside, fusion tag is also used as after Fc-4C recombination expressions, fusion protein is isolated and purified by the IgG fillers being coupled. Further, heat denaturation experiment proves that Fc-4C fusion tags have no significant effect to the structure of destination protein carbonic anhydrase (CA).And Fusion tag shows that Fc-4C can be with first to the vitality test and metal combination mensuration of destination protein carbonic anhydrase (CA) The configuration metal ions Zn of transition system, Ni, Co, Cu are combined.Not only can be with purifying protein, and can promote as fusion tag Fc-4C Enter the fusion protein vigor using transition metal ions as coenzyme.Cumulated volume experimental study, the bicyclic peptides of Fc-4C are pure in the detection of antibody Change and the expression and purification of recombinant protein aspect has good application.

As a result with discussion

Fc-4C can form stable twin nuclei

Fc-4C polypeptides synthesize to obtain by conventional solid, can make the linear peptides of reduced form overnight in 37 DEG C of gentle agitations Form the cyclic peptide with two pairs of disulfide bond for losing 4 hydrogen atoms.Fc-4C polypeptides after oxidation can by HPLC quick separatings, And oxidation reaction is identified by HPLC and generates the efficiency high of purpose structured product up to 95% (see Fig. 7).In order to accurately point out The forming position of disulfide bond in Fc-4C, polypeptide using CID (collision induced dissociation) fragmentations and carry out matter after Asp-N is digested Spectrum identification.The peak that the mass-to-charge ratio (m/z) of divalence is 867.83 in Figure 1A illustrates that Fc-4C peptides form two pairs of disulfide bond；By After Asp-N enzymolysis, Fc-4C enzymolysis product than originally adds 18Da.Figure 1B is the second order mses figure of enzymolysis product, therein y₁(241.03m/z) and y₂(342.08m/z) is the characteristic peak that Cys1-Cys15 and Cys3-Cys13 forms disulfide bond.In Figure 1B Structure corresponding to other fragment peaks is as shown in Figure 1 C.Result above proves, the bicyclic peptides of Fc-4C can simply be prepared out and The rock mechanism of its two pairs of disulfide bond is consistent with design.

Fc-4C and IgG has high affinity and has species broad spectrum activity

We determine people respectively by surface plasma resonance (Surface Plasmon Resonance, SPR) technology Affinity between IgG and Fc-4C, Fc-III and albumin A Z domains.By IgG albumen couplings on CM5 chips, polypeptide 5 different concentration are then diluted to respectively, and the IgG through being coupled in microfluidic circuit and chip interacts, by detecting SPR angles Change to reflect the affinity of polypeptide ligand and IgG.Report before shows, FcBP-2 and IgG affinity than albumin A or Fc-III will be strong more than 10 times【15】.With their report trend and order-of-magnitude agreement, it has been found that Fc-4C and human IgG Dissociation constant is 2.45nM, and Fc-III is only 70nM.SPR experimental results show affinity and FcBP-2 phase of the Fc-4C with IgG Closely, and all it is far above albumin A and Protein G.In addition we also determined respectively by surface plasma resonance technology mouse, rabbit, Affinity between the IgG and Fc-4C and Fc-III of the species such as rat, ox, sheep, horse and pig and the Z domains of albumin A (being shown in Table 1).Data show that within 30nM, the Z for contrasting Fc-III and albumin A is tied the dissociation constant of Fc-4C and different plant species Structure domain, Fc-4C have the advantage of high-affinity and species broad spectrum activity concurrently.

Antibody purification and Protein Detection are done using Fc-4C

Fc-4C is coupled on agarose gel particle by amino reaction and is together incubated with human serum, by multiple Rinsing and pickling take off, and the albumen under eluting passes through one-dimensional electrophoretic separation (Fig. 2).During purifying, isometric Protein-A Sepharose is used Sugared particle is compared with Fc-4C agarose particles, by electrophoretogram gray scale, what the two kinds of particles of same volume can be enriched with IgG amount is roughly the same.Further, by two kinds of agarose particles after 55 DEG C and sera incubation, the IgG of albumin A particle Purifying amount about 30% (Fig. 3 A) lower than Fc-4C particle.We adjust the pH of cushioning fluid of balance agarose particle, contrast in addition The purification efficiency of two kinds of particles in pH 5-8, the purification efficiency highest both when pH is 6.5, is reduced, two kinds with pH Grain has decline, but Fc-4C particles are more preferable (Fig. 3 B) to the tolerance of acid than albumin A particle.And use the hydrochloric acid of various concentrations Guanidine and purification enrichment of the urea processing Fc-4C particles with carrying out IgG after albumin A particle, equally it can be found that Fc-4C particles compare albumen A particles are more tolerant to denaturant (Fig. 3 C).The above result illustrates that the particle of Fc-4C polypeptides coupling is more more stable than albumin A.

Immunofluorescence can be used for detecting the positioning of specific protein in the cell.Because Fc-4C and IgG Fc fragments have height Special affinity, we can be used for immunofluorescence experiment by fluorescein on Fc-4C polypeptide markers and with reference to primary antibody.In order to demonstrate,prove Bright Fc-4C specificity, we have chosen two kinds of albumen with different Subcellar locations and are studied：'beta '-tubulin (β- Tubulin) it is typically located at endochylema【18】, and PCNA (proliferating cell nuclear antigen) is a seed nucleus Albumen, played a role in the DNA synthesis phases of cell cycle as the confactor of archaeal dna polymerase【19-20】.We first will Cell is fixed on slide, with the monoclonal 'beta '-tubulin antibody in mouse source and the monoclonal PCNA antibody point in rabbit source Other incubated cell, the Fc-4C for adding FITC couplings afterwards dye as secondary antibody, and with Hochest 33342 to nucleus. Fluorescence microscopy Microscopic observation, 'beta '-tubulin are distributed widely in endochylema, and PCNA all bunchings into distribution of particles in core (figure 4A&4B).Western blotting is commonly used to some specific proteins in detection of complex sample.We are equally by Fc-4C polypeptides and horseradish peroxide Compound enzyme (HRP) is coupled, and is used for immunoblot experiment as secondary antibody.In order to prove its specificity, we have chosen three kinds of molecules The approximate albumen that but can be effectively distinguished by electrophoresis of amount is studied：CA2 molecular size ranges are 30kD, PRDX3 molecular size range It is 35kD for 26kD, CD38 molecular size range.We are collected and crack 293T cells with RIPA, and cell pyrolysis liquid is passed through into SDS- PAGE is separated, and is gone to albumen on pvdf membrane using semidry method.With 5% skim milk closing pvdf membrane, primary antibody corresponding to incubation, Wherein CD38 is the monoclonal antibody in mouse source, and CA2 and PRDX3 is that rabbit is more anti-；The Fc-4C of HRP couplings is added afterwards as secondary antibody, is used Chemiluminescence nitrite ion is developed the color.It can be seen that more special band (Fig. 4 C) can be seen in corresponding molecular size range. The above result explanation, FITC-Fc-4C and HRP-Fc-4C have the specificity of height, are effective immunofluorescences, exempt from Epidemic disease blotting detection reagent.

Establish Fc-4C expressing fusion protein systems

We select carbonic anhydrase (Carbonic anhydrase, CA) as model proteins and Fc-4C tag fusions, structure Build expression of recombinant proteins system.CA can be catalyzed to high speed reversible the conversion between carbonic acid and carbon dioxide, and be used as pattern Albumen is widely used in protein folding and enzymology【21】.The DNA sequence dna of Fc-4C labels will be encoded (TGTGACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTTGT)(SEQ ID NO：2) it is inserted into carbonic anhydrase CDNA C-terminal, and be building up on plasmid pet-28a.Recombinant plasmid transformed extremely has the e. coli bl21 (ED3) of T7 promoters In pLySs bacterial strains, after IPTG induced expressions, with the visible dyeing strip for having coloring deeper near 33kD of one-dimensional electrophoretic separation Band, this is consistent with having merged the CA sizes of Fc-4C labels.In order to further identify the albumen of expression, this section of dyeing strip Band is cut and digested with pancreatin, is identified using mass spectrum.The one-level matter of the peptide for including Fc-4C sequence labels after enzymolysis Spectrogram is shown in Fig. 5 A.The bicyclic peptide minimum isotopic peak for including Fc-4C sequences of divalence is 1005.88m/z, if being revived by two sulphur After sugar alcohol (DTT) reduction is handled with iodoacetamide (IAA), disulfide bond of this section containing Fc-4C polypeptides is opened, its 4 sulfydryls Modification is partially alkylated or alkylated, therefore mass-to-charge ratio will increase and then migrate to 1121.94m/z.What is reduced and be alkylated is more containing Fc-4C The second order mses figure displaying of peptide is in figure 5b.These results illustrate that Fc-4C labels can recombinantly express with destination protein, and again The label of group expression has the twin nuclei of two pairs of disulfide bond.

In order to probe into whether Fc-4C label of the fusion on destination protein can also carry out affine combination, Wo Menyong with IgG MST measurings compared for merging the CA and IgG of Fc-4C CA, Fc-III CA and Z domains affinity (Fig. 6).Knot Fruit shows that Fc-4C-CA and IgG dissociation constant are 2.28nM, and Z-CA is 13.7 nM, and Fc-III-CA and IgG dissociation is normal Number is 235nM.This explanation Fc-4C label has similar affine property after amalgamation and expression with the Fc-4C polypeptides of synthesis.Before Our laboratories are reported by the use of Fc-III as label, using the egg for being coupled IgG-Fc agarose gel particle affinity purifications White purification system.Similar, the CA of Fc-4C fusions can equally effectively utilize IgG agarose gel particles and be purified.Such as Shown in Fig. 7, destination protein CA is similar to the efficiency that His labels purify by the purification efficiency of Fc-4C labels, and specificity is good Good (Fig. 7 A).Similar, destination protein CK can also pass through Fc-4C labels to the purification effect (Fig. 7 B) arrived very much.Result above Illustrate that Fc-4C labels can preferably be applied in protein recombination expression purification system.

Influence of the Fc-4C labels to the structure and heat endurance of fusion protein

Further, we by circular dichroism and measure enzyme activity Experimental comparison with His labels and Fc-4C marks The CA of label secondary structure and enzyme activity.CA with Fc-4C labels and the CA secondary structures with His labels are similar (see figure 8A).Thermal denaturation enables to secondary structure depolymerization, and when temperature is lifted, the CA of His labels and Fc-4C fusions gradually loses two Level structure, and both rules are similar (Fig. 8 B).

Result above all illustrates that Fc-4C labels all have no significant effect to destination protein CA Structure and stability, this work To be very excellent property for fusion tag.

Effect of vigor of the Fc-4C labels to fusion protein

For the activity of fusion protein, the CA that we compared for CA and the His label of Fc-4C labels is catalyzed to nitro Phenylacetic acid ester hydrolysis activity.It was found that when CA concentration relatively low (8 μM), CA and His the tag fusion CA of Fc-4C tag fusions Poor activity away from little.With the lifting of CA concentration, the CA vigor of Fc-4C labels is higher than the CA of His labels under same concentrations Activity.When protein concentration reaches 100 μM, Fc-4C label Cs A vigor is 2.5 times of (figures of His label Cs A under comparable sodium 9A).Because CA catalytic reaction is with Zn²⁺For coenzyme, we guess that different labels may be for the capture of metal ion Ability is different and then has influence on the activity of enzyme.Therefore we supplement 1mM ZnSO in live body system₄, it can be found that Zn²⁺'s The vigor difference (Fig. 9 B) that compensate for His labels is added, also illustrates that Fc-4C can effectively be captured and be utilized Zn²⁺Help CA liftings Vigor.

In order to probe into influence of the Fc-4C labels in vivo to fusion destination protein functional character, we used GFP conducts Mode system, the fluorescence intensity to observe GFP are used as evaluation and test condition.As shown in Figure 10, wild type GFP, Fc-III has been transfected to melt The fluorescence intensity of the GFP of GFP and the Fc-4C fusion of conjunction 293T cells has no significant difference.

Fc-4C and metal ion combination

In order to further confirm that Fc-4C labels can be combined to promote the enzyme activity using metal as coenzyme with metal ion, We are tested by fluorescent quenching【24】, determine the combination of Fc-4C and various metals ion.Fc-4C polypeptides have two color ammonia Sour residue, there is Inner sources fluorescence can be monitored.We are to Zn²⁺、Cu²⁺、Co²⁺、Ni²⁺、Mn²⁺、 Fe²⁺、Fe³⁺、Ca²⁺、Al³⁺With And Mg²⁺Binding ability etc. different kinds of ions and Fc-4C is determined.It was found that add various concentrations in Fc-4C polypeptide solutions The Zn of multiple proportions²⁺、Ni²⁺、Co²⁺、Cu²⁺Afterwards, endogenous fluorescence intensity has more significant quenching phenomenon (Figure 11 A).When metal ion is dense When degree tends to saturation, the peak intensity of titration curve significantly reduces.By drawing Δ F/F curve map, can be calculated single The binding site number of peptide molecule and metal ion (Figure 11 B).Fc-4C can actually have stronger phase with a variety of transition metal Interaction, Zn²⁺、Cu²⁺、Co²⁺、Ni²⁺The site that ion is combined with Fc-4C polypeptides is 3,8,4 and 3 respectively.Counted by theory Calculate, the binding constants of polypeptide and each metal ion can be drawn respectively_app(being shown in Table 2), binding constant is 10⁵L/mol with On, illustrate Fc-4C polypeptides and Zn²⁺、Cu²⁺、Co²⁺、Ni²⁺Ion has specific bond and adhesion is all stronger.Have with Fc-4C In the metal ion of specific bond, Zn²⁺、Cu²⁺Ion is particularly significant and universal albumen enzyme co-factor, therefore Fc-4C makees There may be lifting to the vigor of destination protein when expression and purification metal is the albumen of coenzyme for fusion tag.

Conclusion

In this work, N, C both ends of Fc-III polypeptides with the addition of two Cys residues and design by us is named as Fc- 4C.By Mass Spectrometric Identification, the Fc-4C polypeptides after simple oxidation contain two pairs of intrachain disulfide bonds, by Cys1-Cys15 and Cys3- Cys12 mediates to be formed.SPR detection molecules interact to obtain, and the affinity of Fc-4C and human IgG is higher than Fc-III 80 times, even Higher than albumin A and Protein G.In addition, Fc-4C can be quickly coupled on agarose gel particle or fluorescein：Fc-4C couplings Agarose gel particle is highly effective matrix for antibody purification, and the Fc-4C of fluorescein coupling can be used as fluorescence secondary antibody For immunofluorescence experiment.In addition, Fc-4C is also developed into the fusion tag of protein recombination expression by we, pass through coupling IgG agarose gel particle can purify destination protein.We have studied Fc-4C works using GFP and CA as model proteins For influence of the label to destination protein structure and activity, Fc-4C does not have to GFP and CA secondary structure, activity and heat endurance Have a significant impact.And we have found that Fc-4C polypeptides can be with Zn²⁺、Ni²⁺、Co²⁺、Cu²⁺Deng the metal ion of First Transition system With reference to.To sum up, Fc-4C polypeptides are all particularly useful instruments to the amalgamation and expression of antibody purification, Protein Detection and recombinant protein.

Experiment material and method

Plasmid construction

There are GFP genes on pEGFP-N1, it is thin by being transfected on Fc-4C label dnas sequence construct to plasmid, after restructuring Born of the same parents.

CA II pET-28a recombinant plasmid (Novagen, Merck Millipore, the moral of structure fusion Fc-4C labels State).It is largely divided into two steps：

(1) pET-28a and pET-21b plasmids are transformed, Fc-4C is building up on original plasmid.In brief, by Fc- 4C is inserted between pET-28a multiple cloning sites EcoR I and Xho I：

F5：TCCGGAATTCTGTGACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTTGTTAGCTCGAGCA CC(SEQ ID NO：3)；

R3：GGTGCTCGAGCTAACAAGTACACCATACGAGTTCTCCAAGATGCCATGCACAGTCACAGAATTCCG GA(SEQ ID NO：4).

Fc-4C is inserted between pET-21b polyclonal position HindIII and Xho I：

F5：AGCTTTGTGACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTTGTTGAC(SEQ ID NO： 5)；

R3：TCGAGTCAACAAGTACACCATACGAGTTCTCCAAGATGCCATGCACAGTCACAA(SEQ ID NO： 6).The codon of expression Fc-4C polypeptides is marked with underscore.

(2) on the basis of the first step, CA II, the CK recombinant plasmid of structure fusion Fc-4C labels.

CA II are inserted between NdeI and EcoRI：

F5：GGGAATTCCATATGTCCCATCACTGGGGGTACGG(SEQ ID NO：7)；

R3：ATCCGAATTCTTTGAAGGAAGCTTTGATTT(SEQ ID NO：8).

CK is inserted between NdeI and HindIII：

F5：GGAATTCCATATGATGCCATTCGGTAACACCCACAACAAG(SEQ ID NO：9)；

R3：CCGCAAGCTTCTTCTGGGCGGGGATCATGTCGTCAA(SEQ ID NO：10).

Protein expression and purifying

With Lipo2000 transfection reagents (Invitrogen) by empty plasmid pEGFP-N1, the GFP with Fc-III labels, The GFP plasmids of Fc-4C labels are transfected into HEK293T cell lines and (bought from ATCC) respectively.Cultivated 24 hours after cell transfecting, Observed under fluorescence microscope (Nikon, Eclipse Ti-E).

Fc-4C fusion CA, Fc-III fusion CA and the only CA with His labels are in e. coli bl21 (DE3) pLySs Express and purify in bacterial strain (Novagen, Merck Millipore, Germany).In simple terms, for Fc-4C tag fusions The CA of CA, Fc-III tag fusion, after cell is cracked 4 DEG C with IgG agarose gel particles be incubated 1 hour, afterwards with acetic acid- Ammonium acetate (pH 3.4) buffer solution elutes.As the albumen of biochemical analysis, we use Ni-FF (Qiagen) purified fusion protein, Albumen elutes under the phosphate (pH8.0) of 250mM imidazoles.All protein samples all use Sephacryl S300 after purification Molecular sieve is further purified.For the CK albumen of Fc-4C tag fusions, equally in e. coli bl21 (DE3) pLySs bacterial strains Express and purify in (Novagen, Merck Millipore, Germany).4 DEG C and IgG agarose gel particles after cell is cracked It is incubated 1 hour, is eluted afterwards with acetic acid-ammonium acetate (pH 3.4) buffer solution.The purity of recombinant protein is detected by SDS-PAGE Above 95%.

LC-MS/MS is analyzed

Protein sample is by SDS-PAGE detection purity and separates, and IAA is used after cutting DTT reduction for destination protein band Alkylation, pancreatin digests 37 DEG C overnight in 50mM ammonium bicarbonate buffers afterwards.Peptide fragment after enzymolysis, which is used, contains 1% trifluoroacetic acid Acetonitrile solution be extracted twice.Extraction product is concentrated by being concentrated in vacuo instrument.

In order to be analyzed beneficial to LC-MS/MS, the product 3000 serial nano-HPLC of DIONEX ultimate after enzymolysis Liquid chromatogram is with 60 minutes gradient elutions of flow velocity per minute 0.25 μ L point.The directly upper Thermo of eluted product LTQ- Orbitrap spectrometer analysis.In mass spectrograph analytical column be it is homemade be filled with C-18 fillers (300A, 5 μm, Varian, Lexington, MA) quartzy capillary column (75 μm of internal diameters, 150mm length；Upchurch, Oak Harbor, WA).Mobile phase A is to contain There is the aqueous solution of 0.1% formic acid, Mobile phase B is the acetonitrile solution containing 0.1% formic acid.What LTQ-Orbitrap mass spectrographs used Data dependency drainage pattern (Data-dependent acquisition mode).One is often done in Orbitrap to sweep entirely First mass spectrometric (400-1800m/z, 30000 resolution ratio) all gathers 20 data dependences in an ion trap with 35% collision energy Second order mses.Mass spectrometric data is with Xcalibur 2.0.7 software analysis and with Proteome Discovery searching algorithms.

Surface plasma resonance (S) affinity determines and analysis

The BIAcore T200 instruments (GE healthcare) and CM5 chips that surface plasma resonance (SPR) uses. Human IgG is dissolved in phosphate buffer (pH 7.4), is directly coupled on CM5 chips by the reaction of EDC/NHS amino.It is empty Bai Tongdao is as negative control.In order to do SPR measure, all peptide fragments all (contain 0.005% surface-active with running buffer Agent P20 PBS) dissolve, recombinant protein is also all dialysed into the buffer solution.Analyte enters miniflow with flow velocity per minute 30 μ L Road is combined with the conjugate on chip and dissociated again.After the circulation for combining dissociation every time, chip is buffered with 10mM glycine-HCI Liquid (pH2.0) regenerates.By the reference background of negative control passage, the curve that can be reacted simultaneously passes through Evaluation 1.0 softwares are fitted and calculated.

Affinity measure and analysis are moved in micro thermophoresis

Albumen and polypeptide sample are dissolved in 50mM PBS (pH7.8) buffer solution.The dynamic experiment of thermophoresis is used to measure human IgG From the affinity between the CA II (Fc-4C labels, Fc-III labels and Z- domains label) with three kinds of different labels.People IgG (being purchased from Suo Laibao companies) is marked with fluorescent dye NT-647, and labeling process is referring to service manual (NanoTemper).By CA II (is dissolved in pH7.8 PBS with PBS (pH7.8) doubling dilutions into 12 continuous concentration gradients, and with 20nM IgG protein solutions Buffer solution, containing 0.05%BSA and 0.01%Tween 20) mixing, specifically, the CA II highests of Fc-4C labels are final concentration of Final concentration of 3.5 μM of the CA II highests of 640nM, Fc-III label, Z- domain label C A II are 233nM.Mixed protein sample It is incubated 15 minutes, 15000g takes supernatant to be transferred in capillary after centrifuging 5 minutes.Capillary is arranged from low to high according to concentration It is transferred to the micro thermophoresis of NanoTemper Monolith NT.115 types and moves progress capillary scanning in analyzer.Final result passes through Cross homogenization and obtain K with curve matching_dValue.

The enriching and purifying of immunofluorescence and IgG

Immunofluorescence experiment, human hepatoma cell line HepG2's cell (being bought from ATCC) is with 37 DEG C, 10% serum and 5% 2 Cultivated on the cover slip under conditions of oxidation concentration of carbon.Fixed carefully with 4% formaldehyde X-100 containing 0.2%Triton solution afterwards Born of the same parents.Washed three times with PBS, closed 2 hours with 5% bovine serum albumin(BSA) (BSA).PCNA monoclonal rabbits are used after closing Anti- (1: 100 dilution, Abcam, Cambridge, UK) and 'beta '-tubulin monoclonal mouse anti-(1: 100 dilution, Easybio, north Capital, China) 4 DEG C be incubated overnight and washed three times with PBS.FITC-Fc-4C polypeptides are incubated by 1: 500 dissolving and as secondary antibody Half an hour, contaminate core 20min with final concentration of 1 μ g/ml Hochest 33342 afterwards.Used after ready-made immunofluorescence mounting (Carl Zeiss, Germany) the confocal microscopy Hoechest 33342 and FITC of Zeiss LSM 710 fluorogram Picture.

For IgG enrichment experiments, Fc-4C polypeptides are coupled to (NHS-activated on the agarose particle of NHS- activation Sepharose TM 4Fast Flow, GE Healthcare).After coupling, Fc-4C fillers 50mM Tris-HCl, The buffer solutions of 0.05%Tween 20 (pH 7.8) balance.Human serum is donated by Capital University of Medical Sciences's ZhaoYang Hospital, the rabbit after being immunized Serum is enough certainly.15000g high speed centrifugations 15min after 25 8 times of volumes of μ l serum-dilutions is removed into precipitation.By serum supernatant and 100 μ l Fc-4C is coupled filler or albumin A coupling filler (Protein A Sepharose 4Fast Flow, GE Healthcare) is mixed 4 DEG C of reverse incubation 30min after even.Afterwards with 50mM Tris-HCl (pH6.0) rinsings three times, washed with HAc-NHAc (pH3.4) It is de-.Sample after elution detects purification efficiency with 12%SDS-PAGE glue, and under the conditions of different temperatures and different combination pH It has detected purification efficiency.

Determination of activity with

CA activity can be measured by esterase active measure【15】.1mM paranitrophenylacetic acid ester (p-NPA) conduct Substrate is incubated at room temperature jointly with CA, and the absorption of detection light and reaction efficiency is calculated under 348nm wavelength with spectrophotometer.

Albumen spectroscopic assay

Circular dichroism is used for measuring CA secondary structures and the change under the conditions of thermal denaturation.All protein samples are all saturating Analysis is into 50mM PBS (pH7.8).At 25 DEG C, using the cuvette of 1mm optical paths in Pistar π -180 (Applied Photophysics Ltd) determine on instrument.Scanning wavelength is from 180nm to 260nm.And also at 30 DEG C, 45 DEG C, 55 DEG C and Influence of the heat endurance to secondary structure is probed into spectrogram change under 70 DEG C of different temperatures.

Fluorescence spectrum is that scanning is excited under the exciting light of 295nm wavelength by Hitachi F-4500 types sepectrophotofluorometer Obtain.In order to determine Fc-4C and Zn²⁺、Cu²⁺、Co²⁺、Ni²⁺、Mn²⁺、Fe²⁺、Fe³⁺、Ca²⁺、Al³⁺And Mg²⁺Etc. different kinds of ions Binding site, we determine fluorescence titration spectrum of the Fc-4C with corresponding Ar ion mixing liquid, excite optical condition to be same as above.Specific knot The computational methods of site number and binding constants are closed referring to bibliography【24】.

Bibliography

1.Sidhu SS, Fairbrother WJ, Deshayes K. (2003) Exploring protein-protein interactions with phage display.Chembiochem.4：14-25.

2.Dwyer MA, Lu W, Dwyer JJ, KossiakoffAA. (2000) Biosyntheitc phage display：a novel protein engineering tool combining chemical and genetic diversity.Chem Biol.4：263-274.

3.Hruby VJ, Cai M. (2013) Design ofpeptide and peptidomimetic ligands with novel pharmacological activity profiles.Annu Rev Pharmacol Toxicol.53： 557-580.

4.Nilsson J, Stahl S, Lundeberg J, Uhlen M, Nygren P (1997) Affinity Fusion Strategies for Detection, Purification, and Immobilization of Recombinant Proteins.Protein Expres Purif.11：1-16.

5.Terpe K(2003)Overview of tag protein fusions：from molecular and biochemical fundamentals to commercial systems.Appl Microbiol Biotechnol.60： 523-533.

6.Malhotra A(2009)Tagging for protein expression.Methods Enzymol 463： 239-258.

7.Uhlen M, Forsberg, Moks T, Hartmanis M, Nilsson B (1992) Fusion proteins in biotechnology.Curr Opin Biotechnol 3：363-369.

8.Hengen P(1995)Purification of His-Tag fusion proteins fromEscherichiacoli.TrendsBiochemSci 20：285-286.

9.Hopp TP, Pricket KS, Price VL, Libby RT, March CJ, Ceretti DP, Urdal DL, Conlon PJ(1998)A short polypeptide marker sequence useful for recombinant protein identification and purification.Bio/Technology 6：1204-1210.

10.Marblestone G, Edavettal C, Lim Y, Lim P, Zuo X, Butt R (2006) Comparison of SUMO fusion technology with traditional gene fusion systems：enhanced expression and solubility with SUMO.Protein Sci 15：182-189.

11.Bechett GJ, Hayes JD (1993) Glutathione S-transferases：biomedical applications.Adv Clin Chem 30：281-380.

12.Guan C, Li P, Riggs PD, Inouye H (1987) Vectors that facilitate the expression and purification of foreign peptides in Escherichia coli by fusion to maltose-binding protein.Gene 67：21-30.

13.Pryor KD, LeitingB (1997) High-level expression of soluble protein in Escherichia coli using His6-tag and maltose-binding-protein double-affinity system.Prot Expr Purif 10：309-319.

14.DeLano WL, Ultsch MH, de Vos AM, Wells JA (2000) Convergent Solution to Binding at a Protein-Protein Interface.Science 287：1279-1283.

15.Dias RL, Fasan R, Moehle K, Renard A, Obrecht D, et al. (2006) Protein Ligand Design：From Phage Display to Synthetic Protein Epitope Mimetics in Human Antibody Fc-Binding Peptidomimetics.J Am ChemSoc 128：2726-2732.

16.Feng S, Tian E, Zhang L, Wang Q, Deng H (2012) Development of the Fc-III tagged protein expression system for protein purification and detection.PLoS One 7：e44208.

17.Feng S, Gong Y, Gulishana A, Deng H (2013) Effects of the Fc-III tag on activity and stability of green fluorescent protein and human muscle creatine kinase.Protein Science 22：1008-1015.

18.Williams Rc Jr, Shah C, Sackett D (1999) Separation of tubulin isoforms by isoelectric focusing in immobilized pH gradient gels.Anal Biochem 275：265-267.

19.Cazzalini O., Sommatis S., Tillhon M., Dutto I., Bachi A., Rapp A., Nardo T., Scovassi A.I., Necchi D., Cardoso M.C., Stivala L.A., Prosperi E. (2014) CBP and p300 acetylate PCNA to link its degradation with nucleotide excision repair synthesis.Nucleic Acids Res.42：8433-8448.

20.Leonardi E, Girlando S, Serio G, Mauri FA, Perrone G, Barbareschi M et al.(1992)PCNA and Ki67 expression in breast carcinoma：correlations with clinical and biological variables.J.Clin.Pathol.45：416-419.

21.Pocker Y, Stone T (1967) The Catalytic Versatility of Erythrocyte Carbonic Anhydrase.III.Kinetic Studies of the Enzyme-Catalyzed Hydrolysis of p-Nitrophenyl Acetate.Biochemistry 6：668-678.

22.S.Lindskog(1997)Structure and Mechanism of Carbonic anhydrase.Pharmacol.Ther.74：1-20.

23.Habibzadegan A, Tu C, Silverman DN, McKenna R. (2013) Structural and catalytic characterization of a thermally stable and acid-stable variant of human carbonic anhydrase II containing an engineered disulfide bond.Acta Crystallogr D Biol Crystallogr.69：1414-1422.

24.Raymond CK, David E, Jensen H.von H., Peter H.von H (1976) DNA " melting " 7 proteins.J.Biol.Chem.251：7240-7250.

Dissociation constant of table 1.Fc-4C, Fc-III, Z domain to the IgG of different plant species

Table 2.Fc-4C and Zn²⁺、Cu²⁺、Co²⁺、Ni²⁺The binding constants K of ion_appWith dissociation constant K_d

Claims (25)

1. polypeptide, its amino acid sequence is CDCAWHLGELVWCTC (SEQ ID NO：1).

2. the polypeptide of claim 1, it is coupled with label.

3. the polypeptide of claim 2, wherein the label is horseradish peroxidase, alkaline phosphatase or fluorescein.

4. application of the polypeptide of any one of claim 1-3 in IgG purification or its Fc fragment.

5. application of the polypeptide of any one of claim 1-3 in immune detection.

6. the application of claim 5, wherein the immune detection is Western blotting or immunofluorescence.

7. application of the polypeptide of claim 1 as fusion tag.

8. the polypeptide of the application of claim 7, wherein claim 1 is connected as fusion tag with destination protein, will pass through The purification system of Fc fragments based on IgG or IgG purifies to the destination protein.

9. the polypeptide of the application of claim 7, wherein claim 1 is connected as fusion tag with destination protein, the purpose Albumen is using transition metal ions as coenzyme.

10. the application of claim 9, wherein the transition metal ions is the metal ion of First Transition system.

11. the application of claim 9, wherein the transition metal ions is selected from by Zn²⁺、Ni²⁺、Co²⁺、Cu²⁺The group of composition.

12. the application of claim 9, wherein the destination protein using transition metal ions as coenzyme is carbonic anhydrase.

13. fusion protein, the polypeptide comprising claim 1 and the protein being coupled.

14. solid-phase matrix, the wherein polypeptide of any one of claim 1-3 or the fusion protein of claim 13 are fixed on institute State in solid-phase matrix.

15. the solid-phase matrix of claim 14, wherein the solid-phase matrix is agarose particle or magnetic bead.

16. encode the nucleic acid molecules of the polypeptide of claim 1.

17. the nucleic acid molecules of claim 16, its nucleotides sequence is classified as：

TGTGACTGTGCATGGCATCTTGGAGAACTCGTATGGTGTACTTGT(SEQ ID NO：2).

18. expression vector, it includes the nucleic acid molecules of claim 6 or 7.

19. the method for the IgG or its Fc fragment in detection sample, including：

The sample is contacted with the polypeptide of any one of claim 1-3 or the fusion protein of claim 13；And

Determine the polypeptide of any one of claim 1-3 or the fusion protein of claim 13 and the IgG in the sample or its The combination of Fc fragments is horizontal.

20. IgG or the method for its Fc fragment are purified, are enriched with or removed from sample, including：

The polypeptide of sample containing IgG or its Fc fragment and any one of claim 1-3 or claim 13 are merged into egg White contact；And

The IgG combined with the fusion protein of the polypeptide of any one of claim 1-3 or claim 13 is isolated from sample Or its Fc fragment.

21. the fusion egg of the method for claim 19 or 20, the wherein polypeptide of any one of claim 1-3 or claim 13 It is fixed in vain in solid-phase matrix.

22. the method for claim 21, wherein the solid-phase matrix is agarose particle or magnetic bead.

23. purifying or the method for enrichment destination protein, including：

Restructuring produces fusion protein, and the fusion protein includes destination protein and the polypeptide of claim 1；

Sample containing the fusion protein is contacted with IgG or its Fc fragment；And

The fusion protein combined with IgG or its Fc fragment is isolated from sample.

24. the method for claim 23, further comprises：The destination protein is discharged from the fusion protein.

25. for detection or the kit of IgG purification or its Fc fragment, the polypeptide of any one comprising claim 1-3, right It is required that 13 fusion protein or the solid-phase matrix of claim 14.