CN112920277B - VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof - Google Patents

VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof Download PDF

Info

Publication number
CN112920277B
CN112920277B CN202110112240.0A CN202110112240A CN112920277B CN 112920277 B CN112920277 B CN 112920277B CN 202110112240 A CN202110112240 A CN 202110112240A CN 112920277 B CN112920277 B CN 112920277B
Authority
CN
China
Prior art keywords
cyantraniliprole
chlorantraniliprole
solution
reaction
acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110112240.0A
Other languages
Chinese (zh)
Other versions
CN112920277A (en
Inventor
王楷
徐波杰
许艇
谭兵
薛衔乐
黄泽恺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN202110112240.0A priority Critical patent/CN112920277B/en
Publication of CN112920277A publication Critical patent/CN112920277A/en
Application granted granted Critical
Publication of CN112920277B publication Critical patent/CN112920277B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/77—Ovalbumin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795—Porphyrin- or corrin-ring-containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54306—Solid-phase reaction mechanisms
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof, wherein the nano antibody of cyantraniliprole and chlorantraniliprole comprises the following amino acid sequences or consists of the amino acid sequences: i) 1, SEQ ID NO; or, ii) an amino acid sequence obtained by connecting a tag to the N-terminal and/or C-terminal of i); or, iii) the amino acid sequence of i) or ii) is obtained by substituting, deleting and/or adding one or more amino acids to obtain the amino acid sequence with the same function. The invention also provides a novel cyantraniliprole hapten. The nano antibody provided by the invention can be used for accurately and sensitively detecting the residues of cyantraniliprole and chlorantraniliprole in plants such as water, soil and vegetables. And the pretreatment process of the sample is simple, the consumed time is less, a large amount of samples can be detected simultaneously, and the sample detection cost is far lower than that of the traditional instrument detection method.

Description

VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof
Technical Field
The invention relates to the technical fields of genetic engineering, phage display technology and ELISA detection, in particular to an ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof.
Background
Cyantraniliprole and chlorantraniliprole both belong to ryanodine receptor inhibitors and are o-aminobenzamide insecticides, and the pesticides are widely applied to agriculture due to the advantages of high efficiency, good broad spectrum and the like. However, these pesticides are highly toxic to aquatic invertebrates and bees, and excessive exposure to the pesticides can also cause significant harm to humans. Therefore, the method has important significance for enhancing the detection of the residues of the cyantraniliprole and the chlorantraniliprole, ensuring the food safety, the ecological environment safety and the human health, enhancing the international competitiveness of agricultural and sideline products, maintaining the sustainable development of agriculture and the like by scientifically and reasonably using the cyantraniliprole and the chlorantraniliprole.
The currently reported methods for detecting the residual cyantraniliprole and chlorantraniliprole are mainly instrumental analysis methods, including High Performance Liquid Chromatography (HPLC), gas or liquid mass combined method (GC-MS or LC-MS) and the like. However, the methods require specialized laboratories, special instruments and equipment and professional operators, and are complex in sample pretreatment and high in analysis cost, so that the requirements of rapid field monitoring of a large number of samples are difficult to meet. Since the 90 s in the 20 th century, the immunoassay technology which is developed rapidly is applied to pesticide residue analysis and environmental monitoring, and has the advantages of simplicity, rapidness, low price, high efficiency, strong specificity, high sensitivity and the like.
The stability of the conventional antibody (polyclonal antibody and monoclonal antibody) -based cyantraniliprole and chlorantraniliprole residue enzyme-linked immunosorbent assay method is relatively low, and the problem of detecting pesticide residues by adopting an enzyme-linked immunosorbent assay method based on the anti-cyantraniliprole and chlorantraniliprole nano antibody is urgently needed to be solved in the industry at present.
Disclosure of Invention
The embodiment of the invention provides a nano antibody of cyantraniliprole and chlorantraniliprole, which can be used for accurately and sensitively detecting the residue of cyantraniliprole and chlorantraniliprole in plants such as water, soil, vegetables and the like.
The embodiment of the invention provides a nano antibody of cyantraniliprole and chlorantraniliprole, which comprises or consists of the following amino acid sequences:
i) 1, SEQ ID NO; or
ii) an amino acid sequence obtained by connecting a label at the N end and/or the C end of the i); or
iii) the amino acid sequence of i) or ii) is substituted, deleted and/or added with one or more amino acids to obtain the amino acid sequence with the same function. In the invention, the polypeptide containing the amino acid sequence is used as a nano antibody for resisting cyantraniliprole and chlorantraniliprole, and can accurately and sensitively detect the residue of cyantraniliprole and chlorantraniliprole in plants such as water, soil, vegetables and the like.
The nano antibody for resisting cyantraniliprole and chlorantraniliprole provided by the invention effectively overcomes the defects of high cost, complex pretreatment, poor specificity, low sensitivity, difficulty in on-site detection in experiments and the like of the existing pesticide residue instrument analysis method, has high specificity, high sensitivity, high accuracy, high precision and simple operation method, and can be used for rapidly detecting mass samples and analyzing the ELISA detection kit for the cyantraniliprole or chlorantraniliprole residue. The method is suitable for quickly determining the residue of cyantraniliprole or chlorantraniliprole in samples such as water, soil, vegetables and the like.
The embodiment of the invention also provides a nucleic acid molecule for encoding the anti-cyantraniliprole and chlorantraniliprole nanobody.
The embodiment of the invention also provides a biological material containing the nucleic acid molecule for encoding the anti-cyantraniliprole and chlorantraniliprole nano antibody, wherein the biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a phage vector, a virus vector or an engineering bacterium.
The embodiment of the invention also provides a cyantraniliprole and chlorantraniliprole detection reagent or a kit, wherein the effective components of the reagent are the nano antibodies of the cyantraniliprole and the chlorantraniliprole.
The embodiment of the invention also provides a cyantraniliprole hapten (CNAP-4C) which is: (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamido) pentanoic acid, having the formula:
Figure BDA0002919347190000031
according to the invention, by adopting the cyantraniliprole hapten (CNAP-4C), the space distance between the parent body of the target compound and the carrier protein can be increased, so that the target compound is better displayed on the surface of the carrier protein, and the specific antibody can be better combined with the cyantraniliprole hapten, so that the sensitivity of detecting the residue of the cyantraniliprole or chlorantraniliprole is improved.
The embodiment of the invention also provides a cyantraniliprole artificial antigen which is obtained by coupling the cyantraniliprole hapten and carrier protein; the carrier protein is selected from one or more of bovine serum albumin, ovalbumin, keyhole limpet hemocyanin, thyroid protein and human serum albumin; preferably bovine serum albumin or keyhole limpet hemocyanin; more preferably, the carrier protein is coupled to the carboxyl group of the cyantraniliprole hapten by an activated ester method.
The embodiment of the invention also provides a VHH-ELISA kit for analyzing the residue of cyantraniliprole and chlorantraniliprole, which comprises a kit body, a detachable ELISA plate arranged in the kit body and a reagent arranged in the kit body;
each hole of the ELISA plate is coated with the cyantraniliprole artificial antigen;
the reagent comprises the cyantraniliprole and chlorantraniliprole nano antibody, cyantraniliprole and chlorantraniliprole standard solution, enzyme-labeled secondary antibody, buffer solution PBS, washing solution PBST, color development solution and reaction termination solution. In the detection process of the VHH-ELISA kit for analyzing the residual cyantraniliprole and chlorantraniliprole, the coating antigen adsorbed on the pore wall of the ELISA plate and the cyantraniliprole or chlorantraniliprole to be detected compete with each other to react with the antibody, and the result is observed through a color reaction. Detecting cyantraniliprole or chlorantraniliprole with known concentration and drawing a standard curve, and calculating the concentration of the cyantraniliprole or chlorantraniliprole to be detected.
According to the VHH-ELISA kit for analyzing the residual cyantraniliprole and chlorantraniliprole, provided by the embodiment of the invention, the preparation method of the antigen coated antigen (CNAP-4C-BSA) for coating the enzyme label plate comprises the following steps:
1) dissolving 5.66mg of cyantraniliprole hapten CNAP-4C, 1.725mg of N-hydroxysuccinimide and 2.678mg of N, N' -dicyclohexylcarbodiimide in 200 mu L of anhydrous dimethylformamide, and stirring at room temperature for reacting overnight to obtain a first reaction solution; centrifuging the first reaction solution, removing the precipitate, and collecting a first supernatant;
2) dissolving 20mg of bovine serum albumin in 2mL of 0.05M carbonate buffer solution with pH of 9.6, dropwise adding the first supernatant obtained in the step 1) under the stirring condition, and then continuously stirring and reacting for 4 hours at room temperature to obtain a second reaction solution;
3) putting the second reaction solution obtained in the step 2) into a dialysis bag and dialyzing with PBS; changing the liquid once every 6h, and changing the liquid 5-6 times in total; and centrifuging after dialysis, discarding the precipitate, and collecting a second supernatant as an antigen coating solution.
According to the VHH-ELISA kit for analyzing the residual cyantraniliprole and chlorantraniliprole provided by the embodiment of the invention, the ELISA plate is a 96-hole ELISA plate, and the coating concentration of the cyantraniliprole artificial antigen is 45-55 ng/mL, preferably 50 ng/mL; and/or the concentration of the nano antibody is 90-100 ng/mL, preferably 95 ng/mL; and/or the enzyme-labeled secondary antibody is an anti-HA label antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL; and/or the color development liquid is color development liquid A liquid and/or color development liquid B liquid, wherein the color development liquid A liquid is prepared from 1g of carbamide peroxide, 10.3g of citric acid and Na 2 HPO 4 ·12H 2 O35.8 g, Tween-20100 mu L and distilled water 1000mL, and the pH value is 5; the color developing solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4; and/or the reaction termination solution is 2M sulfuric acid solution.
The embodiment of the invention also provides any one of the following applications of the nano antibody for resisting cyantraniliprole and chlorantraniliprole:
1) the method is used for detecting the residue of cyantraniliprole and chlorantraniliprole;
2) the method is used for preparing cyantraniliprole and chlorantraniliprole detection reagents or ELISA detection reagents.
In the invention, during analysis and detection, a cyantraniliprole or chlorantraniliprole sample to be detected and the nano antibody are sequentially added into each hole of an enzyme label plate coated with the cyantraniliprole coated antigen, a solid-phase coated antigen and the cyantraniliprole or chlorantraniliprole to be detected compete with each other to react with the nano antibody, and because the contents of the solid-phase antigen and the added nano antibody in each hole are consistent, when the concentration of the cyantraniliprole or chlorantraniliprole to be detected is high, the amount of the antibody bound on the solid-phase antigen is small, the amount of the binding between the added enzyme-labeled secondary antibody and the fixed antibody is small, and finally, a substrate solution and a developing solution are added, the developing reaction is light, the OD value detected by an enzyme label instrument is low, and the inhibition rate is high; on the contrary, when the concentration of cyantraniliprole or chlorantraniliprole to be detected is low, the detected OD value is high, and the inhibition rate is low. And (3) calculating the concentration of the cyantraniliprole or the chlorantraniliprole to be detected according to a standard curve drawn by using a standard solution of the cyantraniliprole or the chlorantraniliprole with known concentration for detection.
The invention has the beneficial effects that: the method can accurately and sensitively detect the cyantraniliprole and chlorantraniliprole residues in plants such as water, soil, vegetables and the like, has simple pretreatment process of the sample, consumes less time, can simultaneously detect a large amount of samples, and has sample detection cost far lower than that of the traditional instrument detection method. The method has important practical significance for solving the field monitoring technology of the cyantraniliprole or chlorantraniliprole residue of a large batch of samples.
Drawings
In order to more clearly illustrate the technical solutions of the present invention or the prior art, the drawings needed for the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings according to the drawings without creative efforts.
FIG. 1 is a standard inhibition curve of cyantraniliprole and chlorantraniliprole based on nanobody in example 6 of the present invention;
(the regression equation of the curves is y ═ 0.018+0.9694/[1+ (x/1.5435) ^1.0657 respectively] (R 2 0.99) and y 0.0325+0.9829/[1+ (x/1.8562) ^1.2019](R 2 0.99), the concentration in inhibition was IC 50 1.56ng/mL and 2.01ng/mL, and the lowest detection limit is IC 20 0.40ng/mL and 0.64 ng/mL).
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is obvious that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The instruments and the like are conventional products which are purchased by normal distributors and are not indicated by manufacturers. The process is conventional unless otherwise specified, and the starting materials are commercially available from the open literature.
Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.
According to some preferred embodiments of the present invention, the nanobody may be prepared as follows: synthesizing cyantraniliprole hapten CNAP-3C by using a chemical reaction: (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-formamido) -5-cyano-3-methylbenzamide) butyric acid, hapten and keyhole limpet hemocyanin are coupled to be used as immunogen, an immune experimental animal camel is immunized, total RNA of peripheral blood lymphocytes is extracted, and a nano antibody heavy chain (VHH) gene segment is cloned through reverse transcription and nested PCR, through enzyme digestion connection, the gene fragment is cloned to a phagemid carrier, high-efficiency electric transformation is carried out to escherichia coli, a phage nano antibody library is constructed through auxiliary phage rescue, a cyantraniliprole nano antibody is screened out, the cyantraniliprole nano antibody is expressed and purified to obtain the cyantraniliprole nano antibody with high sensitivity, and the cyantraniliprole nano antibody has higher cross reaction with chlorantraniliprole. The prepared nano antibody has small molecule, strong solubility, high temperature resistance, easy purification and easy expression.
According to some preferred embodiments of the present invention, the cyantraniliprole hapten CNAP-4C can be prepared as follows: 2-amino-3-methylbenzoic acid (200g, 1.32mol) was dissolved in 700mL of dimethylformamide with mechanical stirring, and the solution was then heated to 68 ℃. N-iodosuccinimide (NIS, 300g, 1.33mol) was slowly added to the flask, followed by stirring at 75 ℃ for 3 hours. The reaction mixture was poured slowly into 1L of ice water and stirred for 3 hours. After filtration and drying, 2-amino-5-iodo-3-methylbenzoic acid was obtained as a gray solid.
2-amino-5-iodo-3-methylbenzoic acid (138.5g, 0.5mol) and cuprous cyanide (58.2g, 0.65mol) were added to 1L dimethylformamide, and the mixture was heated and held in an oil bath for 6 hours. After completion of the reaction, most of the solvent was removed by distillation under the reduced pressure, and then the residue was treated with 1L of water and 50mL of ethylenediamine. The mixture was filtered and the filtrate was acidified to pH 5 with 2M hydrochloric acid and stirred overnight. 2-amino-5-cyano-3-methylbenzoic acid was obtained as a gray solid by filtration and drying.
2-amino-5-cyano-3-methylbenzoic acid (38g, 0.22mol) was dissolved in 400mL of 1, 4-dioxane and heated to 102 ℃ with an oil bath. A solution of triphosgene (22.7g, 0.075mol) in 50mL of dioxane was slowly added to the flask, and the mixture was held at 102 ℃ for 4 hours after addition. After completion of the reaction, the mixture was cooled to room temperature. After filtration and drying, 8-methyl-2, 4-dioxo-2, 4-dihydro-1H-benzo [ d ] [1, 3] -oxazine-6-carbonitrile is obtained as a white solid.
A mixture of 3-bromo-1- (3-chloropyridin-2-pyridyl) -1H-pyrazole-5-carbonyl chloride (0.64g, 0.02mol) and 8-methyl-2, 4-dioxo-2, 4-dihydro-1H-benzo [ d ] [1, 3] -oxazine-6-carbonitrile (2.05g, 0.1mol) was dissolved in 20mL of anhydrous pyridine and then slowly heated to 115 ℃ with an oil bath and held for 40 minutes. The reaction mixture was cooled to room temperature, then acidified to pH 5 with 2M hydrochloric acid and the precipitate was collected by filtration. The resulting precipitate was recrystallized from mixed ethyl acetate and petroleum ether (1: 3, vol.s.) to give 2- (3-bromo-1- (3-chloropyridin-2-yl) -1H-pyrazol-5-pyridinyl) -8-methyl-4-oxo-4H-benzo [ d ] [1, 3] oxazine-6-carbonitrile as a white solid.
To 7mL of dimethylformamide were added 2- (3-bromo-1- (3-chloropyridin-2-yl) -1H-pyrazol-5-pyridinyl) -8-methyl-4-oxo-4H-benzo [ d ] [1, 3] oxazine-6-carbonitrile (132mg, 0.3mmol), 4-aminopentanoic acid (38.6mg, 0.33mmol), and sodium hydroxide (24.6mg, 0.61 mmol). The mixture was stirred at room temperature for 12 hours. The reaction mixture was poured into 15mL of water, acidified to pH 3 with 2M hydrochloric acid, and then extracted with ethyl acetate (5mL × 3). The combined organic layers were washed with water (5mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated. The residue was recrystallized from ethyl acetate and petroleum ether to give (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamido) butyric acid (cyantraniliprole hapten CNAP-4C) in the form of a white solid.
The cyantraniliprole coating antigen is a conjugate compound (CNAP-4C-BSA) of hapten CNAP-4C and bovine serum albumin, and the preparation method of the coating antigen is as follows: (1) 5.66mg of hapten CNAP-4C, 1.725mg of N-hydroxysuccinimide and 2.678mg of N, N' -dicyclohexylcarbodiimide were dissolved in 200. mu.L of anhydrous dimethylformamide and stirred at room temperature overnight for reaction. The reaction solution was centrifuged (5000rpm, 10min), the precipitate was discarded, and the supernatant containing the active ester was collected. (2) Bovine serum albumin (20 mg) was dissolved in 2mL of 0.05M, pH 9.6 carbonate buffer, and the supernatant was added dropwise with stirring, slowly over about 20 min. The reaction was then stirred for a further 4h at room temperature. (3) After the reaction, the reaction solution was filled into a dialysis bag and dialyzed with PBS (0.01mol/L, pH 7.4); the liquid is changed once every 6h, and the liquid is changed for 5-6 times. And centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen coating solution.
The ELISA plate is a 96-hole ELISA plate, and the coating concentration of the coating antigen is 50 ng/mL.
The concentration of the nano antibody is 95 ng/mL.
The enzyme-labeled secondary antibody is an anti-HA label antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL. Purchased from Abcam corporation under the trade designation ab 1265.
The color developing solution A consists of carbamide peroxide 1g, citric acid 10.3g and Na 2 HPO 4 ·12H 2 35.8g of O, 20100 mu L of Tween-and 1000mL of distilled water, and the pH value is 5.
The color developing solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4.
The reaction termination solution is 2M sulfuric acid solution.
Table 1 structural formula of each compound, Cross reaction (%)
Figure BDA0002919347190000091
Figure BDA0002919347190000101
Example 1 preparation of Cyantraniliprole-coated antigen
The antigen is expressed by a hapten CNAP-4C: (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamido) pentanoic acid and bovine serum albumin preparation of conjugate complexes as coating antigen (CNAP-4C-BSA). The preparation method comprises the following steps:
(1) 5.66mg of (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamide) pentanoic acid, 1.725mg of N-hydroxysuccinimide and 2.678mg of N, N' -dicyclohexylcarbodiimide were dissolved in 200. mu.L of anhydrous dimethylformamide and stirred at room temperature overnight for reaction; centrifuging the reaction solution, removing the precipitate, and collecting the supernatant;
(2) dissolving 20mg of bovine serum albumin in 2mL of carbonate buffer solution with the pH value of 9.6 and 0.05M, dropwise adding the supernatant under stirring, and continuously stirring and reacting for 4 hours at room temperature after the addition is finished;
(3) after the reaction is finished, putting the reaction solution into a dialysis bag and dialyzing with PBS; changing the liquid once every 6h, and changing the liquid 5-6 times in total; and centrifuging after dialysis, discarding the precipitate, and collecting supernatant as antigen-coated antigen.
Example 2 construction of Cyantraniliprole and Chlorantraniliprole Nanobody libraries
The hapten and keyhole limpet hemocyanin of example 1 were coupled by an active ester method, which was as follows:
equimolar amounts of hapten CNAP-3C: (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamide) butyric acid, NHS and DCC were dissolved in DMF and stirred at room temperature overnight for reaction. The reaction solution is centrifuged and the precipitate is discarded, and the supernatant is the active ester. And adding the supernatant into the keyhole limpet hemocyanin solution under the stirring state, and continuously stirring and reacting for 4 hours at room temperature. The reaction solution was filled in a dialysis bag and dialyzed with PBS. Centrifuging, collecting supernatant, and freeze drying to obtain conjugate of hapten CNAP-3C and keyhole limpet hemocyanin (CNAP-3C-KLH).
Dissolving 1mg of conjugate in 1mL of physiological saline, mixing with 1mL of complete Freund's adjuvant, emulsifying completely, injecting into camel, enhancing immunity once every two weeks, mixing with the incomplete Freund's adjuvant, performing subcutaneous multipoint immunization on neck and back for 5 times. Starting from the third immunization, serum titers were measured from jugular vein blood sampling one week after each immunization.
Separating white blood cells from peripheral blood after the 5 th immunization, extracting total RNA, cloning a VHH gene fragment through reverse transcription PCR and nested PCR, modifying a cohesive end by using restriction enzyme SfiI, connecting the VHH gene fragment to phagemid pComb3x through T4 ligase, and performing high-efficiency electric transformation to escherichia coli ER2738 to construct a phage nanobody library of cyantraniliprole and chlorantraniliprole. The primary reservoir volume is determined to be 10 8 cfu, adding helper phage (multiplicity of infection is 20:1) M13KO7 for rescue to obtain phage nanobody library with a library capacity of 10 14 pfu/mL, the diversity of the library was good.
Reverse transcription PCR:
the reverse transcription kit adopts PrimeScript TM RT-PCR Kit, purchased from TaKaRa, under the trade designation: AK 2701.
The reverse transcription system is as follows:
Figure BDA0002919347190000121
the reaction was carried out at 65 ℃ for 5 min. The first strand cDNA was synthesized by taking it out and placing it on ice, and loading it as follows.
Figure BDA0002919347190000122
30℃10min；42℃1h；72℃5min。
Nested PCR:
first round PCR:
the reaction system is as follows:
Figure BDA0002919347190000123
the reaction procedure was as follows:
Figure BDA0002919347190000124
second round PCR:
the reaction system is as follows:
Figure BDA0002919347190000131
the reaction procedure was as follows:
Figure BDA0002919347190000132
the nested PCR primer sequences are as follows (5 '-3'):
GSP-RT：CGCCATCAATRTACCAGTTGA
LP-leader：GTGGTCCTGGCTGCTCTW
F：CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC
r: CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG wherein R represents a base A/G, W represents a base A/T, and K represents a base G/T.
Example 3 screening of Cyantraniliprole Nanobodies
Coating the coated antigen of the example 1 on the 1 st hole of a 96-hole enzyme label plate, wherein the coating concentration is 50ng/mL, and the temperature is 4 ℃ overnight; the next day, pouring out the coating solution, washing with PBST for 3 times, blocking the 1 st and 2 nd holes of the ELISA plate with BSA, and incubating for 1h at 37 ℃; pouring out the blocking solution, and washing with PBST for 3 times; adding the phage antibody library of example 3 into the 1 st well, and reacting for 2 h; pouring out the liquid, patting dry on clean absorbent paper, and washing with PBST for 5 times; adding 100 mu L of cyantraniliprole standard substance into the 1 st hole, and reacting for 1 h; sucking out the liquid in the 1 st hole, adding the liquid into the 2 nd hole, reacting for 1h, and removing the phage bound with the BSA; the eluate was collected, 5. mu.L was used for titer determination, and the remainder was used for amplification.
Adding the phage eluate into fresh Escherichia coli ER2738 bacterial liquid, standing at 37 deg.C for 15 min; adding carbenicillin and SB culture medium, culturing at 37 deg.C and 220rpm for 2 hr; adding helper phage M13KO7 (MOI 20:1) and kanamycin, and culturing overnight; the next day, the supernatant was centrifuged and purified by adding PEG-NaCl solution.
And (3) carrying out next round of screening on the amplification product to ensure that the addition amount of each round of screening is the same, decreasing the antigen coating concentration and the competitive elution concentration of the cyantraniliprole standard product by 2 times, calculating the titer of each round, and selecting a monoclonal for amplification and ELISA identification. Positive monoclone is obtained through 4 rounds of panning.
Example 4 expression of Cyantraniliprole Nanobodies
Extracting positive monoclonal plasmid, transforming to escherichia coli TOP 10F' competent cell, recovering, and coating on solid culture medium for overnight culture. The next day, selecting a single clone, culturing in a SB-carboxybenzyl culture medium, and adding IPTG to induce overnight expression; the next day, cells are cracked by an ultrasonic crusher, the cells are filtered by a filter membrane and then purified by a nickel column, namely, the affinity chromatography of a histidine tag and nickel chloride in the nickel column is utilized to separate and purify the nano antibody to obtain the high-purity anti-cyantraniliprole nano antibody, and the amino acid sequence of the obtained nano antibody is shown as SEQ ID NO. 1 through amino acid sequencing analysis.
Example 5 Cross-reactivity of Nanobodies to Chlorantraniliprole
Selecting cyantraniliprole structural analogues to determine and evaluate the specificity of the VHH-ELISA method, coating a coating antigen CNAP-4℃ -BSA on a 96-well ELISA plate, wherein the coating concentration of each well is 50ng/mL, and reacting overnight at 4 ℃; the next day, the liquid in the wells was spun off, washed 3 times with PBST containing 0.05% tween, and the microplate was inverted and patted dry on absorbent paper; adding a sealing solution, incubating at 37 ℃ for 30 minutes, throwing the liquid in the hole, washing for 3 times by using 0.05% PBST, and inverting the ELISA plate on water-absorbent paper to dry; respectively preparing 0ng/mL, 1ng/mL, 4ng/mL, 12ng/mL, 37ng/mL, 111ng/mL, 333ng/mL and 1000ng/mL cyantraniliprole structural analogue standard solutions, adding 50 mu L of standard samples into each hole, repeating for 2-4 times, adding 50 mu L of diluted antibody, and incubating for 30 minutes at 37 ℃; throwing the liquid in the hole, washing with PBST for 3 times, and inversely arranging the ELISA plate on water-absorbent paper for patting dry; adding enzyme-labeled secondary antibody, and incubating for 30 minutes at 37 ℃; the liquid in the wells was spun off, washed 3 times with PBST and patted dry; and (3) uniformly mixing the solution A and the solution B in equal volume, adding 100 mu L of solution A into each hole, performing light-shielding color development for 10-15 minutes, adding a stop solution to terminate the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme-labeling instrument. Separately calculating IC of each analog to be measured 50 Value, using the formula, cross-reactivity ═ IC 50 (cyantraniliprole)/IC 50 (analogues)]The cross-reactivity can be calculated at 100%. The experimental result shows that the cross reaction of VHH C1 and chlorantraniliprole can reach 77.6%, which indicates that the nano antibody has certain broad spectrum and the concentrations of the cyantraniliprole and the chlorantraniliprole in inhibition are IC respectively 50 1.56ng/mL and 2.01ng/mL, and the lowest detection limit is IC 20 0.40ng/mL and 0.64 ng/mL. Can be used for trace amounts of cyantraniliprole and chlorantraniliprole in actual samplesAnd (6) detecting.
Example 6 VHH-ELISA detection kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof
The kit comprises a kit body, a 96-hole enzyme label plate which is detachably arranged in the kit body and a reagent arranged in the kit body, wherein each hole of the enzyme label plate is coated with the coating antigen (CNAP-4C-BSA) of embodiment 1, and the reagent comprises cyantraniliprole and chlorantraniliprole nano antibody, cyantraniliprole and chlorantraniliprole standard solution, enzyme-labeled secondary antibody, buffer solution PBS, washing solution PBST, substrate solution (solution A), color development solution (solution B), reaction termination solution and the like of embodiment 5.
The concentration of the nano antibody is 95 ng/mL.
The enzyme-labeled secondary antibody is an anti-HA-labeled antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL. Purchased from Abcam, Inc. under the trade designation ab 1265.
The solution A comprises carbamide peroxide 1g, citric acid 10.3g and Na 2 HPO 4 ·12H 2 35.8g of O, 20100 mu L of Tween-and 1000mL of distilled water, and the pH value is 5.
The solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4.
The reaction termination solution was 2M sulfuric acid solution.
Coating the coated antigen (CNAP-4℃ -BSA) on a 96-well enzyme label plate, wherein the coating concentration of each well is 50ng/mL, and reacting at 4 ℃ overnight; the next day, the liquid in the wells was spun off, washed 3 times with PBST containing 0.05% tween, and the microplate was inverted and patted dry on absorbent paper; adding a sealing solution, incubating at 37 ℃ for 30 minutes, throwing the liquid in the hole, washing for 3 times by using 0.05% PBST, and inverting the ELISA plate on water-absorbent paper to dry; preparing 0ng/mL, 1ng/mL, 4ng/mL, 12ng/mL, 37ng/mL, 111ng/mL, 333ng/mL, 1000ng/mL standard solution of cyantraniliprole or chlorantraniliprole, adding 50 μ L of standard sample or processed sample into each well, repeating the standard sample and the sample for 2-4 times, adding 50 μ L of diluted antibody, and incubating for 30 minutes at 37 ℃; throwing the liquid in the hole, washing with PBST for 3 times, and inversely arranging the ELISA plate on water-absorbent paper for patting dry; adding enzyme-labeled secondary antibody, and incubating for 30 minutes at 37 ℃; the liquid in the wells was spun off, washed 3 times with PBST and patted dry; and (3) uniformly mixing the solution A and the solution B in equal volume, adding 100 mu L of solution A into each hole, performing light-shielding color development for 10-15 minutes, adding a stop solution to terminate the reaction, and measuring the OD value of each hole at the wavelength of 450nm on an enzyme-labeling instrument.
The OD value of the standard well containing the maximum concentration subtracted from the OD value of the standard well containing 0ng/mL is determined as B 0 The OD values of the other holes corrected by the same method are set as B; with B/B 0 The values are ordinate and the corresponding standard concentrations are abscissa, and standard inhibition curves of cyantraniliprole and chlorantraniliprole are drawn (fig. 1). The concentration of the corresponding sample can be obtained according to the regression equation of the curve, and the concentration IC in the inhibition of cyantraniliprole and chlorantraniliprole can also be obtained 50 (B/B 0 50%) and minimum detection limit IC 20 (B/B 0 ＝80％)。
In the actual sample detection process, the coating antigen (coating concentration is 50ng/mL) adsorbed on the pore wall of the ELISA plate and cyantraniliprole or chlorantraniliprole to be detected compete with each other to react with the antibody, and the competitive result is obtained through a color reaction. Detecting cyantraniliprole or chlorantraniliprole with known concentration and drawing a standard curve, and calculating the concentration of the cyantraniliprole or chlorantraniliprole to be detected. The method has the advantages that the method can accurately and sensitively detect the cyantraniliprole and chlorantraniliprole residues in water, soil and vegetables, the pretreatment process of the sample is simple, the consumed time is less, a large number of samples can be detected simultaneously, and the sample detection cost is far lower than that of the traditional instrument detection method.
Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Sequence listing
<110> university of agriculture in China
<120> VHH-ELISA kit for analyzing residue of cyantraniliprole and chlorantraniliprole and application thereof
<130> KHP211110721.6
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 132
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Gln Leu Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Ser Arg Ile Asn
20 25 30
Tyr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val
35 40 45
Ala Gly Ile Tyr Thr Lys Thr Gly Gly Thr Phe Val Pro Asp Ser Met
50 55 60
Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Ser Cys
85 90 95
Ala Ala Asp Phe Arg Leu Leu Asn Arg Tyr Asp Pro Thr His Thr Pro
100 105 110
Asn Tyr Trp Gly Gln Gly Thr Gln Val Ser Val Ser Ser Gly Thr Asn
115 120 125
Glu Val Cys Lys
130

Claims (10)

1. Nanobody against cyantraniliprole and chlorantraniliprole, characterized in that the Nanobody comprises or consists of an amino acid sequence as follows:
i) 1, SEQ ID NO; or
ii) an amino acid sequence obtained by connecting a tag to the N-terminal and/or C-terminal of i).
2. A nucleic acid molecule encoding the nanobody against cyantraniliprole and chlorantraniliprole of claim 1.
3. Biological material containing nucleic acid molecules encoding said nanobodies against cyantraniliprole and chlorantraniliprole of claim 2, said biological material being recombinant DNA, expression cassettes, transposons, plasmid vectors, phage vectors, viral vectors or engineered bacteria.
4. The detection reagent or kit for cyantraniliprole and chlorantraniliprole is characterized in that the effective components are the nano antibodies of the cyantraniliprole and the chlorantraniliprole according to claim 1.
5. The preparation method of the cyantraniliprole hapten is characterized by carrying out condensation reaction on amino acid and 2- (3-bromo-1- (3-chloropyridin-2-yl) -1H-pyrazol-5-pyridyl) -8-methyl-4-oxo-4H-benzo [ d ] [1, 3] oxazine-6-carbonitrile, wherein the amino acid takes 4-aminopentanoic acid as an example, and specifically comprises the following steps:
1) 2-amino-3-methylbenzoic acid (200g, 1.32mol) was dissolved in 700mL of dimethylformamide with mechanical stirring, and the solution was then heated to 68 ℃; n-iodosuccinimide (NIS, 300g, 1.33mol) was slowly added to the flask, followed by stirring at 75 ℃ for 3 hours; slowly pouring the reaction mixture into 1L of ice water, and stirring for 3 hours; filtering and drying to obtain gray solid 2-amino-5-iodo-3-methylbenzoic acid;
2) 2-amino-5-iodo-3-methylbenzoic acid (138.5g, 0.5mol) and cuprous cyanide (58.2g, 0.65mol) were added to 1L dimethylformamide, and the mixture was heated and held in an oil bath for 6 hours; after completion of the reaction, most of the solvent was removed by distillation under reduced pressure, and then the residue was treated with 1L of water and 50mL of ethylenediamine; the mixture was filtered, the filtrate was acidified to pH 5 with 2M hydrochloric acid and stirred overnight to obtain 2-amino-5-cyano-3-methylbenzoic acid as a grey solid by filtration and drying;
3) 2-amino-5-cyano-3-methylbenzoic acid (38g, 0.22mol) was dissolved in 400mL of 1, 4-dioxane and heated to 102 ℃ with an oil bath; a solution of triphosgene (22.7g, 0.075mol) in 50mL of dioxane was slowly added to the flask, and the mixture was held at 102 ℃ for 4 hours after addition; after the reaction was complete, the mixture was cooled to room temperature; filtering and drying to obtain white solid 8-methyl-2, 4-dioxo-2, 4-dihydro-1H-benzo [ d ] [1, 3] -oxazine-6-carbonitrile;
4) a mixture of 3-bromo-1- (3-chloropyridin-2-pyridyl) -1H-pyrazole-5-carbonyl chloride (0.64g, 0.02mol) and 8-methyl-2, 4-dioxo-2, 4-dihydro-1H-benzo [ d ] [1, 3] -oxazine-6-carbonitrile (2.05g, 0.1mol) was dissolved in 20mL of anhydrous pyridine and then slowly heated to 115 ℃ with an oil bath and held for 40 minutes; the reaction mixture was cooled to room temperature and then acidified to pH 5 with 2M hydrochloric acid and the precipitate was collected by filtration and recrystallized from a mixture of ethyl acetate and petroleum ether (1: 3, volume ratio) to give 2- (3-bromo-1- (3-chloropyridin-2-yl) -1H-pyrazol-5-pyridinyl) -8-methyl-4-oxo-4H-benzo [ d ] [1, 3] oxazine-6-carbonitrile as a white solid;
5) to 7mL of dimethylformamide was added 2- (3-bromo-1- (3-chloropyridin-2-yl) -1H-pyrazol-5-pyridinyl) -8-methyl-4-oxo-4H-benzo [ d ] [1, 3] oxazine-6-carbonitrile (132mg, 0.3mmol), 4-aminopentanoic acid (38.6mg, 0.33mmol), and sodium hydroxide (24.6mg, 0.61 mmol); the mixture was stirred at room temperature for 12 hours; the reaction mixture was poured into 15mL of water, acidified to pH 3 with 2M hydrochloric acid and then extracted with ethyl acetate (5mL × 3); the combined organic layers were washed with water (5mL × 3), dried over anhydrous sodium sulfate, filtered and concentrated; the residue was recrystallized from ethyl acetate and petroleum ether to give (2- (3-bromo-1- (3-chloropyridine-2-pyridyl) -1H-pyrazole-5-carboxamido) -5-cyano-3-methylbenzamido) pentanoic acid (cyantraniliprole hapten CNAP-4C) as a white solid;
the structural formula of the cyantraniliprole hapten is shown as the following formula, and n is an integer from 4 to 6:
Figure FDA0003460114490000031
6. a preparation method of cyantraniliprole artificial antigen, which is characterized in that the cyantraniliprole artificial antigen is obtained by coupling the cyantraniliprole hapten prepared by the method in claim 5 with carrier protein; the carrier protein is selected from one or more of bovine serum albumin, ovalbumin, keyhole limpet hemocyanin, thyroid protein and human serum albumin.
7. The ELISA kit for analyzing the residue of cyantraniliprole and chlorantraniliprole is characterized by comprising a kit body, a detachable ELISA plate arranged in the kit body and a reagent arranged in the kit body;
each hole of the ELISA plate is coated with the cyantraniliprole artificial antigen of claim 6;
the reagent comprises the cyantraniliprole and chlorantraniliprole nanobody, the cyantraniliprole and chlorantraniliprole standard solution, the enzyme-labeled secondary antibody, a buffer solution PBS, a washing solution PBST, a color development solution and a reaction termination solution which are described in claim 1.
8. The ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues according to claim 7, wherein the preparation method of the antigen coating solution for coating the ELISA plate comprises the following steps:
1) dissolving 5.66mg of cyantraniliprole hapten, 1.725mg of N-hydroxysuccinimide and 2.678mg of N, N' -dicyclohexylcarbodiimide in 200 mu L of anhydrous dimethylformamide, and stirring at room temperature for reacting overnight to obtain a first reaction solution; centrifuging the first reaction solution, removing the precipitate, and collecting a first supernatant;
2) dissolving 20mg of bovine serum albumin in 2mL of 0.05M carbonate buffer solution with pH of 9.6, dropwise adding the first supernatant obtained in the step 1) under the stirring condition, and then continuously stirring and reacting for 4 hours at room temperature to obtain a second reaction solution;
3) putting the second reaction solution obtained in the step 2) into a dialysis bag and dialyzing with PBS; changing the liquid once every 6h, and changing the liquid 5-6 times in total; and centrifuging after dialysis, discarding the precipitate, and collecting a second supernatant as an antigen coating solution.
9. The ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues according to claim 7 or 8, wherein the ELISA plate is a 96-well ELISA plate, and the coating concentration of the cyantraniliprole artificial antigen is 50 ng/mL; and/or the concentration of the nanobody is 95 ng/mL; and/or the enzyme-labeled secondary antibody is an anti-HA label antibody labeled by horseradish peroxidase, and the concentration is 0.1 mu g/mL; and/or the color development liquid is color development liquid A liquid and/or color development liquid B liquid, wherein the color development liquid A liquid is prepared from 1g of carbamide peroxide, 10.3g of citric acid and Na 2 HPO 4 ·12H 2 O35.8 g, Tween-20100 mu L and distilled water 1000mL, and the pH value is 5; the color developing solution B is prepared from 700mg of tetramethylbenzidine, 40mL of DMSO, 10.3g of citric acid and 1000mL of distilled water, and the pH value is 2.4; and/or the reaction termination solution is 2M sulfuric acid solution.
10. The use of the nanobody against cyantraniliprole and chlorantraniliprole of claim 1 in any of the following applications:
1) the method is used for detecting the residue of cyantraniliprole and chlorantraniliprole;
2) the method is used for preparing cyantraniliprole and chlorantraniliprole detection reagents or ELISA detection reagents.
CN202110112240.0A 2021-01-27 2021-01-27 VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof Active CN112920277B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110112240.0A CN112920277B (en) 2021-01-27 2021-01-27 VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110112240.0A CN112920277B (en) 2021-01-27 2021-01-27 VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof

Publications (2)

Publication Number Publication Date
CN112920277A CN112920277A (en) 2021-06-08
CN112920277B true CN112920277B (en) 2022-08-09

Family

ID=76167094

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110112240.0A Active CN112920277B (en) 2021-01-27 2021-01-27 VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof

Country Status (1)

Country Link
CN (1) CN112920277B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113736743B (en) * 2021-09-15 2022-04-12 江南大学 Hybridoma cell strain secreting monoclonal antibody against bisamide compounds and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107557358A (en) * 2017-07-31 2018-01-09 中国农业大学 ELISA kit and its application based on nano antibody detection ethiprole residual
CN107607720A (en) * 2017-07-31 2018-01-19 中国农业大学 The ELISA kit of one-step method detection Triazophos residue and its application

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102627628B (en) * 2012-03-08 2013-12-11 中国农业大学 Chlorantraniliprole antigen, its preparation method and application
CN107817341B (en) * 2017-07-31 2019-06-04 中国农业大学 ELISA kit and its application based on nano antibody detection Triazophos residue
WO2020130138A1 (en) * 2018-12-21 2020-06-25 国立大学法人広島大学 Anti-pres1 antibody and use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107557358A (en) * 2017-07-31 2018-01-09 中国农业大学 ELISA kit and its application based on nano antibody detection ethiprole residual
CN107607720A (en) * 2017-07-31 2018-01-19 中国农业大学 The ELISA kit of one-step method detection Triazophos residue and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
高效液相色谱法同时测定辣椒中氯虫苯甲酰胺和溴氰虫酰胺的残留;宋文芳;《现代食品》;20200415(第07期);第179-181页 *

Also Published As

Publication number Publication date
CN112920277A (en) 2021-06-08

Similar Documents

Publication Publication Date Title
DK3124973T3 (en) AFLATOXIN-NANOBODY IMMUNO ABSORBENT AND IMMUNO-EFFICIENCY COLUMN AND PREPARATION AND METHOD OF USING IT
US9435776B2 (en) Immunosorbent and immunoaffinity column for aflatoxin M1 nanobody and preparation method thereof
CN106680484B (en) The remaining ELISA detection kit of analyzing carbaryl and its application
US9128089B1 (en) Aflatoxin M1 nanobody 2014AFM-G2
JP5677943B2 (en) Polypeptide
EP3124498A1 (en) Aflatoxin b1 nanobody 2014afb-g15
CN109884008B (en) Time-resolved fluorescence immunochromatographic kit for aflatoxin B1 nano antibody and preparation method and application thereof
CN110950961B (en) Bromadiolone nano antibody and application thereof
CN112920277B (en) VHH-ELISA kit for analyzing cyantraniliprole and chlorantraniliprole residues and application thereof
CN110684080B (en) scFv-ELISA kit suitable for thiamethoxam residue analysis
CN113461782B (en) Malachite green antigen mimic epitope, preparation method and application thereof
CN107557358B (en) VHH-ELISA kit suitable for fipronil residue analysis
CN110407943B (en) Nano antibody of carbofuran pesticide and preparation method and application thereof
CN107817341B (en) ELISA kit and its application based on nano antibody detection Triazophos residue
CN107417790B (en) VHH-E L ISA kit suitable for triazophos residue analysis
CN110317241B (en) Polypeptide molecule resisting Cry1Da protein and application thereof
CN107607720B (en) The ELISA kit and its application of one-step method detection Triazophos residue
CN111499737B (en) Nano antibody for specifically detecting phycotoxin substances and enzyme-linked immunoassay method
CN115825424A (en) ELISA kit for detecting triclosan residue based on nano antibody and application thereof
CN114671947A (en) High-affinity nano antibody for different subtype surface S proteins of hepatitis B virus and application thereof
CN110317242B (en) Polypeptide molecule capable of specifically binding Cry1Da protein and application thereof
CN107607703B (en) Based on the remaining ELISA kit of nano antibody detection Fipronil and its application
CN107515298B (en) ELISA kit and its application based on nano antibody detection carbaryl residue
WO2005000883A1 (en) Polypeptides having binding affinity for insulin
CN113651890B (en) anti-SAL single-chain antibody, and screening method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant