CN115820603A

CN115820603A - Modification editing method based on dCasRx-NSUN6 monogene specificity M5C

Info

Publication number: CN115820603A
Application number: CN202211427547.0A
Authority: CN
Inventors: 隋婷婷; 张涛; 李占军; 赵飞宇; 李金泽; 孙小迪; 张曦匀; 范鹏; 王鹤均
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2022-11-15
Filing date: 2022-11-15
Publication date: 2023-03-21

Abstract

The invention provides a targeted RNA 5-methylcytosine modification editing system, which comprises a protein expression vector of inactivated CasRx nuclease fusion 5-methylcytosine modification enzyme and an enzyme activity functional region thereof, and a crRNA expression vector of at least one site of targeted RNA. Further the invention also targets a crRNA expression vector at a site in the CDS region of the mRNA of RPSA. The invention also provides a preparation method and application of the RNA-targeted 5-methylcytosine modified vector system. By adopting the editing system provided by the invention, the RNA 5-methylcytosine modification site can be subjected to targeted modification of 5-methylcytosine, and the editing system is accurate and efficient.

Description

Modification editing method based on dCasRx-NSUN6 monogene specificity M5C

Technical Field

The invention relates to the technical field of RNA editing, in particular to a dCasRx-m5C modified vector system for targeted RNA methylation and a construction method and application thereof.

Background

Cytosine 5-methylation (i.e., m 5C) is a relatively common modification in RNA, and studies have demonstrated that m5C modification occurs primarily in the nucleus, partially in the mitochondria, and is dynamically catalyzed by the NOL1/NOP2/SUN (NSUN) family and DNMT2 (m 5C 'Writer', m5C encoder) as methyltransferases and demethyltransferase Tet2 (m 5C 'Eraser', m5C decoder). m5C can exert its biological effect by combining ALYREF and YBX1 (m 5C 'Reader', m5C Reader).

RPSA is an important transmembrane protein receptor belonging to the non-integrin family, also known as laminin receptor 1, and is composed of 295 amino acids including an intracellular segment, a transmembrane segment and an extracellular segment, which are composed of 85, 16 and 194 amino acids, respectively. Research has demonstrated that RPSA, as a type II transmembrane receptor, is a key node of a variety of signaling pathways, involved in a variety of biological processes, including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis, play an important role in the development of a variety of tumorigenesis, with a correlation between its upregulation in cancer cells and its invasive and metastatic phenotypes. Our previous review of data revealed that m5C methylation modification of the CDS of RPSA was present.

The CRISPR/Cas13 system is an acquired immune system that bacteria and archaea have evolved to protect against foreign virus or plasmid invasion. In the CRISPR/Cas13 system, after the crRNA forms a complex with the Cas13 protein, the Cas13 protein is activated, and can target and cleave the RNA, so that the RNA is subjected to fragmentation damage. Cas13 has two catalytic active centers, loses endonuclease activity after mutation, can only be combined with RNA, cannot cut the RNA, so that endogenous RNA can be identified through a dCasRx technology, and the method can be used for targeted RNA tracing.

Disclosure of Invention

The invention provides a targeted RNA 5-methylcytosine modified editing system, which comprises an inactivated CasRx nuclease system and a crRNA system, wherein the inactivated CasRx nuclease in the inactivated CasRx nuclease system is fused with an active functional area of a 5-methylcytosine modifying enzyme and/or a 5-methylcytosine modifying enzyme.

Preferably, the inactivated CasRx nuclease system comprises an inactivated CasRx nuclease protein expression vector comprising a protein expression vector in which an inactivated CasRx nuclease fuses a 5-methylcytosine modifying enzyme and/or a 5-methylcytosine modifying enzyme active domain, and the crRNA system comprises a crRNA expression vector targeting the RNA site.

Preferably in any of the above, the inactivated CasRx nuclease system and crRNA system is a dCasRx-NSUN6 protein and crRNA complex and/or a dCasRx-NSUN6 enzymatic active domain and crRNA complex. Can accurately position a target RNA sequence and target a corresponding modification site. Preferably, the editing system is capable of regulating m5C modification of RNA inside or outside the cell.

Preferably, in any of the above cases Rx nuclease protein expression vector inactivated comprises PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP vector and/or PCS2-EF1 alpha-dCasRx-NSUN 6 enzyme activity domain-T2A-EGFP vector. EF 1. Alpha. Is the name of the promoter, which functions to promote expression of the sequence.

Preferably in any of the above, the inactivated CasRx nuclease protein expression vector comprises the sequence: (a) An EF1 alpha-SV 40-NLS-dCasRx sequence as shown in SEQ ID NO. 1; (b) The sequence of the NSUN6 enzyme shown as SEQ ID NO.2 and/or the sequence of the NSUN6 enzyme activity functional region shown as SEQ ID NO. 3; (c) an EGFP sequence shown as SEQ ID NO. 4.

Preferably, in any of the above, the editing system is capable of regulating 5-methylcytosine modification of RNA either intracellularly or extracellularly.

Preferably in any of the above, the cells include eukaryotic cells and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells; the mammalian cell includes a Chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat liver cell, a rat liver tumor cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human liver cell, an HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human A5413 cell, a human K562 cell, a human HEK2133T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

Any of the above is preferred, the crRNA sequence is changed based on the change of target sequence, and RNA including mRNA, tRNA, rRNA, ncRNA is modified and controlled for different targets. Preferably, the "based on" means that the expression sequence of the crRNA is completely complementary to the target.

Preferably in any of the above, the crRNA system targets at least one site in the CDS region of mRNA of RPSA.

Preferably, in any of the above, the crRNA system is a crRNA expression vector.

Preferably, in any of the above cases, the sequence of the crRNA expression vector is shown in SEQ ID NO. 15.

The invention also provides a preparation method of the targeted RNA 5-methylcytosine modified editing system, which comprises the following steps:

1) Amplifying an EF1 alpha-dCasRx-T2A-EGFP sequence from vectors pXR002, EF1 alpha-dCasRx-T2A-EGFP and addgene #60954, and connecting the EF1 alpha-dCasRx-T2A-EGFP sequence to a pCS2+ vector through PCR amplification, recombination, connection and transformation to obtain an inactivated protein expression vector of CasRx nuclease; the protein expression vector of the inactivated CasRx nuclease comprises an EF1 alpha-SV 40-NLS-dCasRx sequence shown as SEQ ID NO.1 and an EGFP sequence shown as SEQ ID NO. 4;

2) Amplifying NSUN6 enzyme and/or an active region sequence thereof from HEK 293 cells, and connecting the NSUN6 enzyme and/or the active region sequence thereof to a PCS2-EF1 alpha-dCasRx-T2A-EGFP vector through PCR amplification, recombination, connection and transformation to obtain an inactivated CasRx nuclease fused 5-methylcytosine modification enzyme and/or a protein expression vector of an active functional region of the 5-methylcytosine modification enzyme; the sequence of the NSUN6 enzyme is shown in SEQ ID NO. 2; the sequence of the NSUN6 enzyme activity functional region is shown as SEQ ID NO. 3;

3) Constructing a crRNA scaffold structure comprising a restriction enzyme site sequence and a crRNA scaffold sequence; synthesizing crRNA based on the target sequence; cloning the crRNA scaffold structure and the crRNA based on the target sequence into an expression vector to obtain the expression vector comprising a promoter sequence, the crRNA based on the target sequence, the crRNA scaffold sequence and a restriction enzyme site sequence, wherein the crRNA based on the target sequence is shown as SEQ ID NO. 15; (the cleavage site is a cleavage site for conventional ligation)

The editing system for obtaining the targeted RNA 5-methylcytosine modification comprises a protein expression vector of the inactivated CasRx nuclease fused with 5-methylcytosine modification enzyme and/or 5-methylcytosine modification enzyme activity functional region, and an expression vector of crRNA, a crRNA scaffold sequence and an enzyme cutting site sequence based on a target point sequence, wherein the expression vector comprises a promoter sequence.

Preferably, the expression vector in step 2) is a pCS2+ plasmid vector.

The invention also provides application of the editing system in preparation of a medicine for treating diseases caused by RNA modification abnormality.

The invention also provides a medicament for treating diseases caused by RNA modification abnormality, which comprises the editing system of any one of the above.

Based on the prior art, in order to find a new idea for treating diseases caused by RNA m5C modification abnormality, the invention firstly connects an m5C modification enzyme or an enzymatic activity functional domain thereof to the C end of dCasRx, and specifically targets the crRNA to the RNA by designing the crRNA, so as to perform m5C modification on a specific site (as shown in figure 4); the invention provides a new way for preventing and treating human diseases caused by RNA m5C modification abnormality by a strategy of specifically targeting a substrate by an engineering RNA modification enzyme to change RNA m5C modification.

As a first aspect of the invention, the invention provides an RNA-targeted 5-methylcytosine modification vector system comprising a protein expression vector fusing an inactivated CasRx nuclease to a 5-methylcytosine modification enzyme or an enzymatically active functional region thereof, a crRNA expression vector targeting at least one site in the CDS region of the mRNA of RPSA.

It should be noted that in the present invention, casRx, also called Cas13, is a nuclease; CDS refers to the coding fragment of a messenger RNA (mRNA) molecule; crRNA refers to guide RNA of nuclease CasRx (CRISPR guide RNA). Among them, the crRNA expression vector can target one site, two sites, or three sites, or even more sites in the CDS region of the mRNA of RPSA, which can be selected as desired.

Preferably, the nucleotide sequence corresponding to the 5-methylcytosine modifying enzyme or the enzymatically active functional region thereof is linked to the C-terminus of the nucleotide sequence corresponding to the nuclease activity inactivated CasRx, whereby the expressed fusion protein (i.e., the inactivated CasRx nuclease fusion 5-methylcytosine modifying enzyme or the protein corresponding to the enzymatically active functional region thereof) can perform 5-methylcytosine modification on a specific RNA under the guidance of crRNA.

Preferably, the 5-methylcytosine modifying enzyme is a NSUN6 enzyme; the enzyme activity functional region of the 5-methylcytosine modification enzyme is a sequence of an NSUN6 enzyme activity region.

Preferably, the ribonucleic acid included in the inactivated CasRx nuclease system is circular DNA, and comprises a eukaryotic expression vector, a nuclear localization sequence inserted into the eukaryotic expression vector (the nuclear localization sequence is an SV40-NLS sequence and is a 250 th-270 th base sequence in SEQ ID NO. 1) and NSUN6 enzyme or an active region sequence thereof. Thus, the expressed NSUN6 enzyme can methyl-catalyze the first cytosine in the special motif, CCACCA, i.e., cytosine 5-methyl (i.e., m 5C) modification in the present invention. Preferably, the inactivated CasRx nuclease system comprises circular DNA which is a protein expression vector of the inactivated CasRx nuclease fused with 5-methylcytosine modification enzyme and an enzymatic activity functional region thereof.

Preferably, the eukaryotic expression vector is inserted with an EGFP sequence. The EGFP sequence served as a tag for successful expression in cells.

As a second aspect of the present invention, the present invention provides a method for preparing a mRNA targeting 5-methylcytosine modified vector system, comprising the steps of:

(1) Amplifying an EF1 alpha-dCasRx-T2A-EGFP sequence from a vector pXR002: EF1 alpha-dCasRx-T2A-EGFP, and connecting the EF1 alpha-dCasRx-T2A-EGFP sequence to a pCS2+ vector through PCR amplification, recombination, connection and transformation to obtain an inactivated protein expression vector of the CasRx nuclease; the protein expression vector of the inactivated CasRx nuclease comprises: the EF1 alpha-SV 40-NLS-dCasRx sequence is shown in SEQ ID NO. 1; the EGFP sequence is shown as SEQ ID NO. 4;

(2) NSUN6 enzyme and an active region sequence thereof are amplified from HEK 293 cells, and the NSUN6 enzyme and/or the active region sequence thereof are/is connected to a PCS2-EF1 alpha-dCasRx-T2A-EGFP vector through PCR amplification, recombination, connection and transformation to obtain an inactivated CasRx nuclease fused 5-methylcytosine modification enzyme protein expression vector and/or an inactivated CasRx nuclease fused 5-methylcytosine modification enzyme activity functional region protein expression vector; the sequence of the NSUN6 enzyme is shown as SEQ ID NO. 2; the sequence of the NSUN6 enzyme activity region is shown as SEQ ID NO. 3;

(3) Constructing a crRNA scaffold structure comprising a restriction enzyme site sequence and a crRNA scaffold sequence; synthesizing crRNA based on the target sequence; cloning the crRNA scaffold structure and the crRNA based on the target sequence into an expression vector to obtain the expression vector comprising a promoter sequence, the crRNA based on the target sequence, the crRNA scaffold sequence and a restriction enzyme site sequence, wherein the crRNA based on the target sequence is shown as SEQ ID NO. 15;

as a third aspect of the invention, the invention provides the use of any one of the editing systems and the vector in the preparation of a medicament for treating diseases caused by RNA modification abnormalities. The invention provides a preparation method and application of an accurate and efficient medicament for diseases caused by abnormal methylation modification of 5-methylcytosine.

As a fourth aspect of the present invention, the present invention provides a drug for treating a disease caused by abnormal RNA modification, the drug comprising the editing system described above and a vector provided. Among them, the patient suffering from a disease caused by abnormal RNA modification may be a human, or an animal, a plant, or the like, and is preferably a human.

The invention has the beneficial effects that: the editing system can be used for carrying out targeted modification on 5-methylcytosine on diseases caused by RNA modification abnormality, is accurate and efficient, and can be used for fundamentally treating the diseases caused by RNA modification defects.

The CasRx nuclease is a CasRx nuclease, and the dCasRx is an inactivated CasRx nuclease, namely an inactivated CasRx nuclease.

The nucleotide sequences contained in the sequence table of the invention are all conventional nucleotide sequences, and do not comprise branched chain structures and nucleotide analogs.

Drawings

FIG. 1 is a map of the PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP vector in preferred embodiment 1 of the present invention.

FIG. 2 is a map of PCS2-EF1 alpha-dCasRx-NSUN 6 active region-T2A-EGFP vector in preferred embodiment 1 of the present invention.

FIG. 3 is a map of a crRNA vector in preferred embodiment 2 of the present invention.

FIG. 4 is a technical scheme of m5C modification of specific sites according to the present invention.

FIG. 5 is the results of m5C modified RPSA mRNA enriched after BSP experiments in preferred embodiment 3 of the present invention.

FIG. 6 shows the mRNA expression level of RPSA after co-transfection of the plasmid PCS2-EF 1. Alpha. -dCasRx-NSUN6-T2A-EGFP and the plasmid RPSA crRNA backbone in preferred embodiment 3 of the present invention.

FIG. 7 is a graph showing the mRNA expression level of RPSA after co-transfection of the enzymatic functional region-T2A-EGFP of the plasmid PPCS2-EF 1. Alpha. -dCasRx-NSUN6 and the plasmid RPSA crRNA backbone in preferred embodiment 3 of the present invention.

Detailed Description

The present invention will be more clearly and completely described in the following embodiments, but the described embodiments are only a part of the embodiments of the present invention, and not all of them. The examples are provided to aid understanding of the present invention and should not be construed to limit the scope of the present invention.

Example 1

Constructing dCasRx-2 XNLS (NLS is SV40-NLS disclosed by the invention), NSUN6/NSUN6 enzyme activity area of the target RNA and EGFP fusion expression vector PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP.

1. Primer design

The EF1 alpha-dCasRx-T2A-EGFP sequence is amplified from a vector pXR002: EF1 alpha-dCasRx-T2A-EGFP (adddge # 60954), wherein the EF1 alpha-SV 40 NLS-dCasRx sequence is shown in SEQ ID NO. 1.

The NSUN6 enzyme and the active region sequence thereof are amplified in HEK 293 cells, the sequence of the NSUN6 enzyme is shown as SEQ ID NO.2, and the sequence of the active region of the NSUN6 enzyme is shown as SEQ ID NO. 3.

The seamless cloning primer design tool is utilized to design the PCR primer with three sections of sequences, and the primer sequence is synthesized by Shanghai bio-engineering company. The primer sequence table is shown in the following table 1:

TABLE 1 primer sequence Listing

2. PCR amplification of related Gene sequences

PCR reaction system, total 50ul:

PCR amplification conditions:

3. PCR product recovery

(1) After the PCR product was electrophoresed, a gel strip containing the target fragment was cut with a scalpel under ultraviolet conditions into a clean 1.5ml EP tube, and an equal volume of solution PN (Tiangen Biochemical technology (Beijing) Co., ltd.) was added to the centrifuge tube in a proportion of 100mg of gel to 100ul of solution PN.

(2) The centrifuge tube containing the gel pieces was placed in a 50 ℃ water bath with the tube turned up and down gently to ensure the gel pieces were fully dissolved.

(3) Column equilibration step: adding 500 μ l of balance liquid BL into adsorption column (placing adsorption column into collection tube), centrifuging at 12,000rpm for 1min, pouring off waste liquid in collection tube, and replacing adsorption column into collection tube.

(4) Adding the solution obtained in the second step into an adsorption column (placing the adsorption column into a collecting pipe), standing at room temperature for 2min, centrifuging at 12,000rpm for 30-60sec, pouring off the waste liquid in the collecting pipe, and placing the adsorption column CA2 into the collecting pipe.

(5) Adding 600 μ l of rinsing solution PW into the adsorption column, centrifuging at 12,000rpm for 30-60sec, pouring off waste liquid in the collection tube, and placing the adsorption column into the collection tube.

(6) Operation 5 is repeated.

(7) The adsorption column was returned to the collection tube and centrifuged at 12,000rpm for 2min to remove the rinse as much as possible. The adsorption column CA2 was left at room temperature for several minutes and thoroughly dried to prevent the residual rinse from affecting the next experiment.

(8) Placing the adsorption column in a clean centrifuge tube, suspending and dropwise adding appropriate amount of elution buffer EB into the middle position of the adsorption membrane, and standing at room temperature for 2min. The DNA solution was collected by centrifugation at 12,000rpm for 2min.

4. Recombinant recovery of the fragment of interest

Two PCR fragments carrying homology arms at both ends were cloned into pCS2+ vector using Clonexpress technology, and the procedures were performed in accordance with Clonexpress Ultra One Step Cloning Kit (Vazyme C115-01) Kit instructions from Hovenia.

5. Conversion of ligation products

(1) The ligation product was added to 50. Mu.l DH 5. Alpha. Competent cells, gently pipetted and mixed, and ice-cooled for 30min.

(2) The heat shock in the water bath at 42 ℃ for 90s quickly transferred the EP tube to the ice bath for 5min.

(3) Adding 200 μ l LB liquid culture medium, mixing, and performing shaking culture at 37 deg.C and 200r/min for 30min.

(4) The whole amount of the bacterial suspension in a 1.5ml EP tube was applied to the surface of an LB plate containing ampicillin (Amp) (100. Mu.g/ml). The plate was inverted and placed in a 37 ℃ biochemical incubator overnight for culture.

6. Sequencing and identifying positive clones:

respectively picking 5 colonies from the upper surface of the plate, placing the colonies in 10ml of LB liquid culture medium containing ampicillin, carrying out shaking culture at 37 ℃ for 8h at 220r/min, pouring 1ml of bacterial liquid in a 1.5ml centrifuge tube in a super clean bench, and sending the bacterial liquid to Shanghai bio-engineering company for sequencing.

7. And (4) carrying out amplification culture on the bacterial liquid with correct sequencing, and extracting endotoxin-free plasmids.

8. The vector with correct sequencing is named as PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP, and PCS2-EF1 alpha-dCasRx-NSUN 6 active region-T2A-EGFP vector, and the map is shown in figures 1 and 2.

Example 2

Construction of RPSA RNA-targeting crRNA expression vector

1. Design of crRNA sequences

The map of the crRNA vector is shown in figure 3, and for RPSA m5C locus, https:// cas 13design.nygene.org/crRNA with higher targeting efficiency is designed, and the sequence of the crRNA is shown in SEQ ID NO. 15;

TABLE 2 crRNA sequences

2. Adding a designed crRNA sequence to a restriction enzyme adaptor, synthesizing by Shanghai Biotech company, and obtaining an oligonucleotide chain shown in SEQ ID NO. 16-17;

TABLE 3 oligonucleotide chain

RPSA-0-crRNA-F	AAACgaggatataacactgacatcagc SEQ ID NO.16
		RPSA-0-crRNA-R	AAAAgctgatgtcagtgttatatcctc SEQ ID NO.17

3. Linearization of crRNA backbone vectors

Plasmid pXR003: casRx gRNA cloning backbone ((addge # 109053)) was digested with BbsI endonuclease overnight at 37 ℃ as follows:

after cleavage at 37 ℃ the gel was run, verified and recovered for purification (same as in step 3 of example 1).

4. Annealing

And (2) annealing the synthesized oligonucleotide chains, placing the oligonucleotides in a PCR instrument at 95 ℃ for 5min, wherein the annealing system is as follows:

after the annealing was completed, it was taken out of the PCR and left at room temperature for 30min.

5. Connection of

The annealed oligonucleotide chain was ligated to the digested vector pXR003 CasRx gRNA cloning backbone overnight in a ligation apparatus at 16 ℃ in the following manner:

6. conversion of ligation products

The ligated plasmid was transformed into competent cell DH 5. Alpha. In the same manner as in example 1, step 5.

7. Sequencing and identifying positive clones:

3 colonies are picked from the plate respectively in 10ml LB liquid culture medium containing ampicillin, at 37 ℃,220r/min, after shaking culture for 8h, 1ml of bacterial liquid is poured in a 1.5ml centrifuge tube in a super clean bench, and then sent to Shanghai bio-engineering company for sequencing.

8. And (4) carrying out amplification culture on the bacterial liquid with correct sequencing, and extracting endotoxin-free plasmids.

9. The vector with correct sequencing is named RPSA crRNA backbone (namely the crRNA expression vector of the invention, namely the expression vector of crRNA, crRNA scaffold sequence and enzyme cutting site sequence which comprises a promoter sequence and is based on a target point sequence).

Example 3 RNA-targeting 5-methylcytosine-modified vector System

One embodiment of the mRNA targeting 5-methylcytosine modified vector system of the invention comprises PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP, and the vector map is shown in FIG. 1; the PCS2-EF1 alpha-dCasRx-NSUN 6 enzyme activity center-T2A-EGFP, and the vector map is shown in figure 2; the map of the vector of the RPSA crRNA backbone is shown in FIG. 3.

RNA BSP sequencing and QPCR

1. Transient transfection of cells

(1) 293T cells were cultured, and appropriate amounts of the cells were dispensed into 6-well plates and cultured overnight to achieve a cell density of about 80%.

(2) The experiments were divided into three groups named group A, B, C. Group A co-transfects plasmid PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP and plasmid RPSA crRNA backbone according to 2; group B co-transfects plasmid PCS2-EF1 alpha-dCasRx-NSUN 6 active center-T2A-EGFP and plasmid RPSA crRNA backbone according to 2; group C plasmids PCS2-EF1 alpha-dCasRx-EGFP and plasmid RPSA crRNA backbone were co-transfected according to 2.

(3) Transfection was carried out according to the instructions of the Hieff TransTM Liposomal Transfection Reagent protocol of the company Yeasen.

(4) After the transfected cells were cultured for 48h, the cells were washed with PBS.

2. Trizol method for extracting total RNA

Cells were pipetted into 1ml Trizol, transferred into a 1.5ml centrifuge tube and RNA extracted according to the protocol provided for the product.

Bisulphite treatment of RNA

The RNA was treated with the EZ RNA Methylation kit from ZYMO RESEACH according to the product instructions to obtain BSP-treated RNA.

Synthesis of cDNA

Carrying out reverse transcription on RNA before and after treatment, and carrying out reverse transcription by using a reverse transcription kit according to the steps provided by a product, wherein the reaction system comprises the following steps:

the reaction conditions were 42 ℃ for 15min and 95 ℃ for 3min.

5.RT-PCR

The designed PCR primer is used for RT-PCR, the RT-PCR primer is shown as SEQ ID NO:20-SEQ ID NO:21, and the reaction system is as follows:

the reaction procedure was as follows:

TABLE 3RT-PCR primer sequences

RPSA-BSP-F	AAATTTTAAGAGGATTTGGGAGAAGTTTTTG SEQ ID NO.20
		RPSA-BSP-R	CAACCCTAAAATCAATAACCACAAAAAACCATA SEQ ID NO.21

6. Agarose gel electrophoresis

The PCR product was electrophoresed through 2% agarose gel at 120V 35min, and the bands were excised and placed in a 1.5ml centrifuge tube for PCR product recovery, as described in step 3 of example 1.

7. Ligation of fragments of interest

Connecting the recovered target fragment to a T vector, using a pGM-T cloning kit of Beijing Tiangen biochemical technology, operating according to the specific steps on the kit specification, connecting overnight at 16 ℃, and connecting in a system as follows:

8. conversion of ligation products

The ligated plasmid was transformed into competent cell DH 5. Alpha. And co-screened by adding x-Gal and IPTG as in example 1, step 5.

9. Sequencing and identifying positive clones:

respectively picking 20 white colonies from the upper surface of the plate, placing the white colonies in 10ml of LB liquid culture medium containing ampicillin, carrying out shaking culture at 37 ℃ for 8h at 220r/min, pouring 1ml of bacterial liquid in a 1.5ml centrifuge tube in a super clean bench, and sending the bacterial liquid to Shanghai bio-corporation for sequencing.

10、RT-QPCR

The cDNA formed by reverse transcription of the RNA without BSP treatment was subjected to RT-QPCR, the QPCR primers SEQ ID NO:22-SEQ ID NO:25 are shown in Table 4, and the reaction system was as follows:

the Q-RTPCR run program was as follows:

TABLE 4 RT-QPCR primer sequences

RPSA-E23-89-F	GCAGCTCGTGCAATTGTT SEQ ID NO.22
		RPSA-E23-89-R	GTGGCAGCAGCAAACTTC SEQ ID NO.23
RPSA-E34-101-F	CGTGCAATTGTTGCCATTGA SEQ ID NO.24
		RPSA-E34-101-R	GCAGCAAACTTCAGCACAG SEQ ID NO.25

11. And (3) analyzing an experimental result:

as shown in FIG. 5, the experimental group co-transfected with the plasmid PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP and the plasmid RPSA crRNA backbone and the experimental group co-transfected with the plasmid PCS2-EF1 alpha-dCasRx-NSUN 6 enzyme activity center-T2A-EGFP and the plasmid RPSA crRNA backbone enriched m5C modified RPSA mRNA after BSP experiment is significantly higher than the control group (p < 0.05), and the experimental result shows that the vector system constructed by the method can effectively perform m5C modification on the specific sites of RPSA (wherein WT is an untransfected wild-type cell control group, dCasRx-NSUN6 is co-transfected with the plasmid 2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP and the experimental group of plasmid dCsa crRNA bace 2-NSASRx 2-NSUN 6-T2A-EGFP and the plasmid RPSA crRNA bace-rRNA bace is co-NSASRx 2-NSF-NSABA and the plasmid. Meanwhile, as shown in FIG. 6, the RT-QPCR results showed that the mRNA expression level of RPSA in the experimental group co-transfected with the plasmid PCS2-EF1 alpha-dCasRx-NSUN 6-T2A-EGFP and the plasmid RPSA crRNA backbone was significantly increased (p < 0.05) compared with the control group (wherein WT is the untransfected wild-type cell control group, RPSA-crRNA is the co-transfection experimental group, E23-89 is the result detected by using the primer RPSA-E23-89, and E34-101 is the result detected by using the primer RPSA-E34-101). As shown in FIG. 7, the RT-QPCR results showed that the mRNA expression level of RPSA in the experimental group co-transfected with PPCS2-EF1 alpha-dCasRx-NSUN 6 enzyme activity center-T2A-EGFP and RPSA crRNA backbone was significantly increased (p < 0.05) compared to the control group (where WT was the control group of untransfected wild-type cells, RPSA-crRNA was the experimental group co-transfected, E23-89 was the result of detection using the primer RPSA-E23-89, and E34-101 was the result of detection using the primer RPSA-E34-101).

Claims

1. An editing system targeted to RNA 5-methylcytosine modification comprising an inactivated CasRx nuclease system and a crRNA system, wherein the inactivated CasRx nuclease in the inactivated CasRx nuclease system is fused to a 5-methylcytosine modifying enzyme and/or a 5-methylcytosine modifying enzyme active domain.

2. The editing system of claim 1, wherein the inactivated CasRx nuclease system comprises an inactivated CasRx nuclease protein expression vector comprising an inactivated CasRx nuclease fusion 5-methylcytosine modifying enzyme and/or a protein expression vector of a functional region of 5-methylcytosine modifying enzyme activity, and wherein the crRNA system comprises a crRNA expression vector that targets an RNA site.

3. The editing system of claim 1, wherein the inactivated CasRx nuclease system and crRNA system is a dCasRx-NSUN6 protein and crRNA complex and/or a dCasRx-NSUN6 enzymatic active domain and crRNA complex.

4. The editing system of claim 2, wherein the inactivated CasRx nuclease protein expression vector comprises a PCS2-EF1 α -dCasRx-NSUN6-T2A-EGFP vector and/or a PCS2-EF1 α -dCasRx-NSUN6 enzymatic activity domain-T2A-EGFP vector comprising the following sequence: (a) An EF1 alpha-SV 40-NLS-dCasRx sequence as shown in SEQ ID NO. 1; (b) The sequence of NSUN6 shown in SEQ ID NO.2 and/or the sequence of the enzymatic activity functional region of NSUN6 shown in SEQ ID NO. 3; (c) an EGFP sequence shown as SEQ ID NO. 4.

5. The editing system of claims 1-4, wherein the editing system is capable of 5-methylcytosine modification modulation of RNA in or out of a cell, including eukaryotic and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells; the mammalian cell includes a Chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat liver cell, a rat liver tumor cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human liver cell, an HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human A5413 cell, a human K562 cell, a human HEK2133T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

6. The editing system of any one of claims 1 to 4, wherein the crRNA sequence is changed based on the change of target sequence, and the RNA comprising mRNA, tRNA, rRNA, ncRNA is modified and controlled for different targets.

7. The editing system of claim 6, wherein the crRNA system targets at least one site in the CDS region of the mRNA of RPSA.

8. The editing system of claim 7, wherein the sequence of the crRNA expression vector is shown in SEQ ID No. 15.

9. A method of making the targeted RNA 5-methylcytosine modified editing system of any one of claims 1-8, comprising the steps of:

1) Amplifying an EF1 alpha-dCasRx-T2A-EGFP sequence from a vector pXR002: EF1 alpha-dCasRx-T2A-EGFP (adddge # 60954), and connecting the EF1 alpha-dCasRx-T2A-EGFP sequence to a pCS2+ vector through PCR amplification, recombination, connection and transformation to obtain an inactivated protein expression vector of CasRx nuclease; the inactivated CasRx nuclease protein expression vector comprises an EF1 alpha-SV 40-NLS-dCasRx sequence shown in SEQ ID No.1 and an EGFP sequence shown in SEQ ID No. 4;

2) Amplifying NSUN6 enzyme and/or an active region sequence thereof from HEK 293 cells, and connecting the NSUN6 enzyme and/or the active region sequence thereof to a PCS2-EF1 alpha-dCasRx-T2A-EGFP vector through PCR amplification, recombination, connection and transformation to obtain an inactivated CasRx nuclease fused 5-methylcytosine modification enzyme and/or a protein expression vector of an active functional region of the 5-methylcytosine modification enzyme; the sequence of the NSUN6 enzyme is shown as SEQ ID NO. 2; the sequence of the NSUN6 enzyme activity region is shown as SEQ ID NO. 3;

3) Constructing a crRNA scaffold structure comprising a restriction enzyme site sequence and a crRNA scaffold sequence; synthesizing crRNA based on a target sequence; cloning the crRNA scaffold structure and the crRNA based on the target sequence into an expression vector to obtain the expression vector comprising a promoter sequence, the crRNA based on the target sequence, the crRNA scaffold sequence and a restriction enzyme site sequence, wherein the crRNA based on the target sequence is shown as SEQ ID NO. 15;

10. Use of the editing system of any one of claims 1 to 9 for the manufacture of a medicament for the treatment of a disease caused by aberrant RNA modification.