CN111440826A - RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof - Google Patents

RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof Download PDF

Info

Publication number
CN111440826A
CN111440826A CN202010184015.3A CN202010184015A CN111440826A CN 111440826 A CN111440826 A CN 111440826A CN 202010184015 A CN202010184015 A CN 202010184015A CN 111440826 A CN111440826 A CN 111440826A
Authority
CN
China
Prior art keywords
sequence
grna
casrx
rna
methyladenine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202010184015.3A
Other languages
Chinese (zh)
Inventor
纪卫东
应小玲
张海青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Sun Yat Sen University
Original Assignee
First Affiliated Hospital of Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Sun Yat Sen University filed Critical First Affiliated Hospital of Sun Yat Sen University
Priority to CN202010184015.3A priority Critical patent/CN111440826A/en
Publication of CN111440826A publication Critical patent/CN111440826A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to the technical field of RNA editing, in particular to a 6-methyladenine modified CasRx vector system of target RNA, a preparation method and application thereof, wherein the vector system comprises a protein expression vector and oligonucleotides of an inactivated CasRx nuclease fused with an enzymatic activity functional region of 6-methyladenine modified enzyme, and an expression vector comprising a promoter sequence, a gRNA based on a target sequence, a gRNA scaffold sequence and an enzyme cutting site sequence; the carrier system adopted by the invention can carry out targeted modification on the 6-methyladenine for diseases caused by RNA modification abnormality, is accurate and efficient, and can fundamentally treat the diseases caused by RNA modification defects.

Description

RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof
Technical Field
The invention relates to the technical field of RNA editing, in particular to a 6-methyladenine modified CasRx vector system for targeting RNA, a preparation method and application thereof.
Background
Adenine 6-methylation (i.e., m)6A) Is the most common modification in mRNA and long-chain non-coding RNA, and the research proves that m6A modification occurs in the nucleus, and is composed of methyltransferases METT L3, METT L14, binding subunit WTAP and RBM15 (m)6A‘Writer’，m6A encoder) andmethyltransferase FTO, A L KBH5 (m)6A‘Eraser’，m6A decoder) dynamic catalytic regulation. m is6A can be produced by binding to YTH domain protein (m)6A‘Writer’，m6A code reader) to exert its biological effect.
CDCP1 is an important transmembrane protein, which is composed of 836 amino acids, including an amino terminal signal skin containing 29 amino acid residues and an extracellular segment, a transmembrane segment and an intracellular segment which are respectively composed of 636, 21 and 150 amino acids. The research proves that CDCP1 plays an important role in the development of various tumors as a key node of signal pathways such as Src, EGFR, HER2 and the like. Our previous studies found that m is present in the 3' UTR of the oncogene CDCP16And A is subjected to methylation modification.
In recent years, the RNA-targeted Cas13 enzyme has become a focus of attention, similar to RNA interference, Cas13 enzyme is able to knock down RNA without changing genome while having higher targeting specificity recently, two research groups have found a new Cas13d enzyme with a median size of only 2.8kb which can be easily packaged into vectors with limited capacity, in order to identify Cas13d enzyme, researchers at Salk institute of biology and Arbor biotechnology company have found CRISPR repeat sequences in the vicinity of putative effector enzymes by common bioinformatics screening, Cas13d protein they identified is not as highly similar to previously found sequences of Cas13a-c but contains a HEPN nucleic acid domain specific to Cas13 superfamily, Yan et al from arborrtechnologies have studied rsp Cas13 Cas d from eubacterium and rspa 13d which are derived from escherichia coli and have been found to have a higher efficiency of targeting of intracellular dna targeting RNA expressing Cas13 expressing as a gene expressing as a gene expressing.
Disclosure of Invention
In order to solve the problems, the invention aims to disclose the technical field of RNA editing, in particular to a 6-methyladenine modified CasRx vector system for targeting RNA, a preparation method and application thereof.
In order to achieve the purpose, the invention adopts the technical scheme that:
the invention provides a 6-methyladenine modified CasRx vector system of a target RNA, which is characterized by comprising a protein expression vector and an oligonucleotide of an inactivated CasRx nuclease (dCasRx) fused with an enzymatic activity functional region of a 6-methyladenine modified enzyme, and an expression vector comprising a promoter sequence, a gRNA based on a target sequence, a gRNA scaffold sequence and an enzyme cutting site sequence.
Preferably, the enzyme cutting site sequence is a gRNA scaffold sequence with two BsmBI enzyme cutting sites at the 5' end.
Preferably, the promoter sequence is a human U6 polymerase III promoter sequence.
Preferably, the gRNA based on the target sequence is targeted to at least 1 target sequence.
The invention provides a preparation method of a RNA-targeted 6-methyladenine modified CasRx vector system, which is characterized by comprising the following steps:
1) amplifying a METT L3 enzyme activity region sequence from HUVEC cells, and performing PCR amplification, enzyme digestion, connection and transformation;
2) connecting the METT L3 active region sequence to EF1a-dCasRx-2A-EGFP vector to obtain a protein expression vector of an inactivated CasRx nuclease (dCasRx) fused with an active functional region of the 6-methyladenine modification enzyme;
3) constructing a gRNA scaffold structure comprising a restriction enzyme site sequence and a gRNA scaffold sequence; synthesizing gRNA based on target point sequence;
4) cloning the gRNA support structure and the gRNA based on the target sequence into an expression vector to obtain the expression vector comprising a promoter sequence, the gRNA based on the target sequence, a gRNA support sequence and an enzyme digestion site sequence.
Preferably, the expression vector in step 4) is a CasRx gRNA cloning backbone or L entiguide-puro vector, wherein the L entiguide-puro vector (addendune #52963) is a gRNA expression vector not containing a CasRx gene, and is modified to express a gRNA of a target RNA, and the vector has a human U6 polymerase III promoter.
The invention provides an application of a carrier system in preparing a medicament for treating diseases caused by RNA modification abnormality, wherein the medicament comprises the carrier system.
The invention has the beneficial effects that: the carrier system adopted by the invention can carry out targeted modification on the 6-methyladenine for diseases caused by RNA modification abnormality, is accurate and efficient, and can fundamentally treat the diseases caused by RNA modification defects.
Drawings
FIG. 1 is a vector map of EF1a-dCasRx-2A-METT L3 activity region-EGFP, an embodiment of the present invention.
FIG. 2 is a vector map of lentiGuide-hU6promoter-2 × BsmBI-gRNA scaffold according to a specific embodiment of the present invention.
FIG. 3 is a vector map of the CasRx-CDCP 13' UTR-155-173gRNA of the present invention.
FIG. 4 is a vector map of the CasRx-CDCP 13' UTR-212gRNA of a specific example of the present invention.
FIG. 5 is a vector map of lentiGuide-CDCP 13' UTR-155-173gRNA according to a specific embodiment of the present invention.
FIG. 6 is a vector map of lentiGuide-CDCP 13' UTR-212gRNA according to a specific embodiment of the present invention.
FIG. 7 shows speckle-print detection m according to an embodiment of the present invention6A expression level, the experimental group was transfected with EF1a-dCasRx-2A-METT L3 activity region-EGFP plasmid, compared to the control group6The a expression level was significantly up-regulated.
FIG. 8 shows the ratio of renilla luciferase activity to firefly luciferase activity according to an embodiment of the present invention, wherein the experimental group co-transfected CDCP1-3 ' UTR-check2, EF1a-dCasRx-2A-METT L3 activity region-EGFP plasmid, CasRx-CDCP13 ' UTR-155 gRNA and CasRx-CDCP13 ' UTR-212gRNA all have significant differences with p <0.001, as analyzed by the spss3.0 software.
Detailed Description
The following detailed description of embodiments of the invention refers to the accompanying drawings:
in the first embodiment, RNA-targeting dCasRx-2A-EGFP and METT L3 activity region fusion expression vector EF1a-dCasRx-2A-METT L3 activity region-EGFP is constructed
1. Primer design
Amplification of METT L3-activity region from HUVEC cells, the METT L3-activity region sequence is shown below:
gccaccatgcagagtgtcggaggtgattccagtgcagaccgactcttcccacctcagtggatctgttgtgatatccgctacctggacgtcagtatcttgggcaagtttgcagttgtgatggctgacccaccctgggatattcacatggaactgccctatgggaccctgacagatgatgagatgcgcaggctcaacatacccgtactacaggatgatggctttctcttcctctgggtcacaggcagggccatggagttggggagagaatgtctaaacctctgggggtatgaacgggtagatgaaattatttgggtgaagacaaatcaactgcaacgcatcattcggacaggccgtacaggtcactggttgaaccatgggaaggaacactgcttggttggtgtcaaaggaaatccccaaggcttcaaccagggtctggattgtgatgtgatcgtagctgaggttcgttccaccagtcataaaccagatgaaatctatggcatgattgaaagactatctcctggcactcgcaagattgagttatttggacgaccacacaatgtgcaacccaactggatcacccttggaaaccaactggatgggatccacctactagacccagatgtggttgcacggttcaagcaaaggtacccagatggtatcatctctaaacctaagaattta
PCR primers were designed using a seamless cloning primer design tool (http://123.56.75.195/), and the primer sequences were synthesized by Egyptian, Guangzhou. The primer sequences are shown in the following table 1:
TABLE 1 primer sequences
METTL3-F ttccagattacgctgctagcGCCACCATGCAGAGTGTCGGAG(SEQ ID NO.1)
METTL3-R ccctctccactgccgctagcTAAATTCTTAGGTTTAGAGATG(SEQ ID NO.2)
2. PCR amplification of related Gene sequences
PCR reaction system, total 50 ul:
Figure BDA0002413519550000061
PCR amplification conditions:
Figure BDA0002413519550000062
3. PCR product recovery
1) After the PCR product was electrophoresed, under the ultraviolet condition, a scalpel cut the gel band containing the target fragment into a clean 1.5ml EP tube, and the solution BD was added to the centrifuge tube in a proportion of 100mg of gel to 100ul of solution BD.
2) Water bath at 55 deg.C for 10min until the gel is completely dissolved, and shaking and mixing for 3 times during the water bath.
3) The solution was transferred to a DNA purification column, allowed to stand for 2min, centrifuged at 12000g at room temperature for 1min, and the filtrate was discarded.
4) 500ul of PE solution was added to the column, centrifuged at 12000g for 1min at room temperature, and the filtrate was discarded.
5) The last operation step is repeated.
6) The empty column was centrifuged at 12000g for 1min to completely remove the liquid remaining in the purification column.
7) The column was placed on a new 1.5ml EP tube, 30. mu.l of the eluent was added to the center of the column, and 12000g was centrifuged for 1min to elute the DNA.
4. Carrying out single enzyme digestion on the EF1a-dCasRx-2A-EGFP vector;
1) the single enzyme digestion system is as follows:
the digestion system was prepared in 1 sterile 1.5ml EP tube, respectively, for a total of 50. mu.l:
Figure BDA0002413519550000071
the enzyme was cleaved at 37 ℃ for 2 h.
2) The product of the cleavage of the vector was recovered (same as in step 3 of example 1).
5. Dephosphorylated and digested EF1a-dCasRx-2A-EGFP vector
1) The dephosphorylation system was as follows:
the digestion system was prepared in 1 sterile 1.5ml EP tube, respectively, for a total of 50. mu.l:
Figure BDA0002413519550000072
2) recovery of the product of dephosphorylation of the support (step 3 of the same example 1)
6. Ligation of the fragment of interest to the vector
The METT L3-activity PCR fragment with homology arms at both ends was cloned into EF1a-dCasRx-2A-EGFP vector digested with NheI by the Gibson technique, and the procedures were performed according to the Kit instruction of NEBuilder HiFi DNAsassay Cloning Kit (NEB # E5520S) of NEB.
The following ligation systems were formulated on ice:
Figure BDA0002413519550000081
7. conversion of ligation products
1) The ligation products were added to 50. mu.l of DH5 α competent cells, vortexed gently and mixed, and ice-cooled for 30 min.
2) The EP tube was quickly transferred to the ice bath by hot shock in a water bath at 42 ℃ for 90s, ice bath for 5 min.
3) Adding 500 μ l L B liquid culture medium, mixing, and culturing at 37 deg.C under shaking at 200r/min for 50 min.
4) Centrifuging at 3000rpm for 5min, removing supernatant, leaving 100ul of supernatant, blowing and beating the mixed bacteria precipitate, coating 100ul of bacteria liquid on the surface of L B plate containing Ampicillin (AMP) (100 ug/ml), standing at room temperature until the liquid is absorbed, inverting the plate, and transferring into a biochemical incubator at 37 deg.C for overnight culture.
8. Colony PCR identification of positive clones
5 colonies were picked from the plate and cultured in 800ul of L B liquid medium containing ampicillin at 37 ℃ and 220r/min for 4 hours under shaking as a template for PCR.
The PCR reaction system is as follows:
Figure BDA0002413519550000082
the PCR reaction conditions were as follows:
Figure BDA0002413519550000083
Figure BDA0002413519550000091
the PCR products were separated and identified by electrophoresis on a 1% agarose gel containing Ethidium Bromide (EB) as a substitute.
9. The colony solution with the correct size identified by PCR was sent to Egyptian, Guangzhou for sequencing.
10. And (4) carrying out amplification culture on the bacterial liquid with correct sequencing, and extracting endotoxin-free plasmids.
11. The vector with correct sequencing is named as EF1a-dCasRx-2A-METT L3 activity region-EGFP, and the map of the vector is shown in figure 1.
Example two: gRNA expression vector for constructing target RNA
1. Construction of gRNA eukaryotic expression vector targeting CDCP 13' UTR 155-173,212 site
1) Vector cleavage
The plasmid CasRx gRNA cloning backbone was digested with BbsI endonuclease in the following system:
Figure BDA0002413519550000092
after 2h of cleavage at 37 ℃ recovery and purification (same as in step 3 of example 1)
2) gRNA oligos were synthesized by Guangzhou Rui Boxing Bio, and AAAA was added to the 5 'end of the gRNA antisense strand and AAAC was added to the 5' end of the sense strand; the synthetic gRNA oligos are shown in Table 2:
TABLE 2 synthetic gRNA oligos
Figure BDA0002413519550000093
Figure BDA0002413519550000101
3) Phosphorylate and anneal gRNA oligos:
Figure BDA0002413519550000102
4) the PCR instrument performs an annealing program:
37℃30min
maintaining at 95 deg.C for 5min, and reducing the temperature by 5 deg.C per minute to 25 deg.C
5) Diluting the annealed oligo double strand by 200 times, and connecting the oligo double strand with the enzyme-digested carrier CasRx gRNA cloningbackbone;
6) the ligated plasmid was transformed into competent cells, Stbl3, in the same manner as in step 6 of example 1.
7) Single colonies were picked, grown up and sequenced (Guangzhou Rui Boxing Co., Ltd.) and the correct plasmid was named CasRx-CDCP 13' UTR-155-173gRNA (vector map is shown in FIG. 3).
8) In the same manner, the gRNA in the 212 th position of CDCP13 'UTR region was inserted into the digested vector CasRxgRNA cloning backbone, and the correct vector CasRx-CDCP 13' UTR-212gRNA was sequenced, and the vector map thereof is shown in FIG. 4.
2. Construction of gRNA lentivirus expression vector lentiGuide-hU6promoter-2 × BsmBI-gRNAscaffflod
1) The gRNA scaffold sequence with two BsmBI enzyme cutting sites at the 5' end is subjected to gene synthesis in Guangzhou Eikyi organism company, and the sequence (SEQ ID NO.9) is as follows:
Figure BDA0002413519550000112
wherein the bold part represents BsmBI enzyme cutting sites; the underlined part represents the gRNA scaffold sequence; the shading part represents the sequence cPPT/cts.
The method comprises the steps of using a 2xBsmBI-gRNA scaffold-cppt/cts PCR fragment as a template, designing primers, enabling two ends of each primer to be provided with 20bp homologous sequences which are homologous with lentiGuide-puro vectors, simultaneously using KOD-plus-neo enzyme to amplify the 2xBsmBI-gRNA scaffold-cppt/cts fragment, after the PCR fragment is purified, utilizing Gibson technology to be connected to the lentiGuide-puro vectors which are subjected to double digestion by BsmBI and PspXI, connecting, transforming, coating plates, and sequencing, wherein the PCR primer sequences are shown in the table 3, the vector with correct sequencing is named lentiGuide-hU6promoter-2 × BsmBI-gRNAscaffold, and the vector map is shown in the figure 2.
3. Construction of gRNA viral expression vector targeting CDCP 13' UTR 155-173, 212 site
1) Vector cleavage
The plasmid lentiGuide-hU6promoter-2 × BsmBI-gRNA scaffbed is digested by BsmBI endonuclease, and the digestion system is as follows:
Figure BDA0002413519550000111
after 2h of cleavage at 55 ℃ recovery and purification (same as in step 3 of example 1)
2) gRNA oligos were synthesized by Guangzhou Rui Boxing Bio, and AAAA was added to the 5 'end of the gRNA antisense strand and cacc was added to the 5' end of the sense strand; the synthetic gRNA oligos are shown in Table 3:
TABLE 3 synthetic gRNA oligos
Figure BDA0002413519550000121
3) Phosphorylate and anneal gRNA oligos: (same as example 2, step 3)
4) The ligated plasmid was transformed into competent cells, Stbl3, in the same manner as example 2, step 5.
5) Single colonies were picked, grown up and sequenced (Guangzhou Rui Boxing. organisms), and the correct plasmid for sequencing was designated lentiguide-CDCP 13' UTR-155-173gRNA (vector map is shown in FIG. 5).
6) In the same manner, the gRNA at the 212 th position in the CDCP13 'UTR region was inserted into the vector lentiGuide-hU6promoter-2 × BsmBI-gRNA scaffold, and the correctly sequenced vectors were named lentiGuide-CDCP 13' UTR-212gRNA, respectively, and the vector maps thereof are shown in FIG. 6, respectively.
Example three: dot blot assay m6A expression level
1. Transient transfection of cells
(1) 293T cells were cultured and inoculated with appropriate amounts of cells in 3 large dishes 100mm in diameter, respectively, and cultured overnight to reach 80% confluency.
(2) Experimental groups transfected plasmid EF1a-dCasRx-2A-METT L3 activity region-EGFP, 293T cells transfected with the same amount of plasmid EF1a-dCasRx-2A-EGFP and wild 293T cells as controls, Invitrogen L ipofectamineTM3000 Reagent protocol for transfection.
(3) After 48h of culture of the transfected cells, the cells were washed once with PBS.
2. Trizol method for extracting total RNA
(1) 3ml of Trizol was added to blow the cells, transferred into a 2ml centrifuge tube, shaken slowly for 20s, and allowed to stand at room temperature for 5 min.
0.3ml of chloroform was added to each tube, followed by vigorous shaking for 15 seconds and standing at room temperature for 3 min.
(2) Centrifuge at 12000rmp for 15min at 4 ℃ and transfer the upper aqueous phase (ca. 800ul) to a new 2ml centrifuge tube.
(3) Adding isopropanol with the same volume into the obtained water phase solution, shaking at medium speed for 10s, mixing, and standing at room temperature for 30 min.
(4) Centrifuge at 12000rmp for 10min at 4 ℃ and discard the supernatant.
Adding 1.5ml of 75% ethanol, shaking at medium speed for 10s, washing the precipitate, centrifuging at 4 ℃ at 12000rmp for 10min, removing the supernatant, sucking up the residual liquid, and drying in the air for 2-3 min.
(5) Adding 30-100ul RNase-free water (heated to 60 ℃) to blow and dissolve RNA, measuring the concentration, and storing at-80 ℃.
3. mRNA was extracted from the total RNA (MRN 10 from sigma)
(1) Taking 450-500 ug of total RNA into a 1.5ml centrifuge tube, adding RNase-free water to adjust the total volume to 250ul, adding 250ul of 2X Binding Solution, and mixing uniformly by short shaking.
(2) Adding 15ul Oligo (dT) beads, shaking and mixing evenly, and carrying out water bath at 70 ℃ for 3 min.
(3) The sample was removed, allowed to stand at room temperature for 10min, centrifuged at 14000rmp for 2min at 4 ℃ to give the mRNA complex, the supernatant carefully removed and 50ul of the supernatant was retained to avoid removal of the pellet.
(4) Rinsing for the first time: adding 500ul of Wash Solution to resuspend, precipitate, blowing, shaking, transferring the Solution to a GenElute spin filter/collection assembly tube, centrifuging at 4 ℃ and 14000rmp for 2min, and discarding the filtrate.
(5) And (3) rinsing for the second time: adding 500ul of Wash Solution again, centrifuging at 4 deg.C and 14000rmp for 2min, and removing the filtrate.
(6) Spin filter was transferred to a new 1.5ml centrifuge tube, 50ul of 70 ℃ RNase-free water was added, metal bath at 70 ℃ for 5min, and centrifugation was carried out at 14000rmp for 2 min.
(7) And (3) eluting again: adding 50ul RNase-free water obtained in the previous step, performing metal bath at 70 ℃ for 5 minutes, and centrifuging for 2min at 14000 rmp; and measuring the concentration and recording the quantification.
By using
Figure BDA0002413519550000141
The mRNA purification kit extracts mRNA from the total RNA and performs the experiment according to the operation instructions.
4. Dot blot
1) mRNA concentrations were diluted to 125ng/ul,250ng/ul,500ng/ul with enzyme-free water.
2) Serially diluted mRNA was denatured at 95 ℃ for 3min to destroy secondary structure of mRNA, and immediately placed on ice for 2 min.
3) 2ul of mRNA was directly dropped onto the Hybond-N + membrane, dried at room temperature for several minutes and then cross-linked for 3min with an ultraviolet cross-linking apparatus.
4) The membranes were washed in clean wash dishes with 10ml of wash buffer for 5min and incubated with 10ml of 5% BSA blocking solution for 1h at room temperature.
5) By an anti-m6Antibody A (1:250 dilution; 2g/ml) was incubated overnight at 4 ℃ in 10ml of antibody dilution and the membrane was washed 3 times for 5min each with 10ml of wash buffer. Goat anti-rabbit IgG-HRP (1:10,000 dilution, 20ng/ml) was incubated for 1h at 10ml room temperature. Washing the membrane for 4 times, each time for 10min, and detecting with chemiluminescence apparatus.
6) Setting an internal reference control, directly dripping 2ul of the diluted mRNA on a Hybond-N + membrane, airing at room temperature for a plurality of minutes, then crosslinking for 3min by an ultraviolet crosslinking instrument, placing in methylene blue dye for dyeing, and taking a picture as an equivalent internal reference control.
Example 4: detection of Dual luciferase reporter Gene Using the vector System of example 1
The detection method comprises the following steps:
(1) a CDCP1-3 'UTR fragment containing 155/173/212 three methylation modification sites was inserted into the luciferase reporter gene plasmid check2, which was named CDCP 1-3' UTR-check 2.
(2) Screening positive clones and sequencing. Cloning and purifying the plasmid for later use.
(3) EF1a-dCasRx-2A-METT L3 activity region-EGFP and CasRx-CDCP13 'UTR-155-173 gRNA plasmids are amplified, and CasRx-CDCP 13' UTR-212gRNA plasmids are purified for standby, and meanwhile, corresponding plasmid CasRx-Lambda 2-gRNA controls are prepared and purified for standby.
(4) 293T cells were cultured and seeded with 1.5 × 105Cells were plated in 24-well plates, 3 replicates per group, and cultured overnight to reach 80% confluency.
(5) Co-transfecting 293T cells with reporter gene plasmids CDCP1-3 ' UTR-check2 and EF1a-dCasRx-2A-METT L3 activityregion-EGFP plasmids and CasRx-CDCP13 ' UTR-155-173gRNA plasmids according to the ratio of 1: 2: 10, wherein the plasmids CDCP1-3 ' UTR-check 2100 and other groups are co-transfected according to the ratio, and the method is carried out according to the formula of L ipofectamin of Invitrogen company TM3000 Reagent protocol for transfection.
(6) After 48h of culture of the transfected cells, the cells were washed once with PBS.
(7) The dual-luciferase activity was detected according to the dual-luciferase reporter gene detection kit of promega, 100. mu.l of 1 × P L B lysate was added to each well of a 24-well plate, and the mixture was shaken in a shaker for 15 min.
(8) And (3) adding 20 mu l of cell lysate into a detection plate in each well of the 24-well plate, then adding 80 mu l of firefly luciferase substrate, detecting on a detector, reading the activity value of the firefly luciferase, adding 80 mu l of Renilla luciferase substrate, and reading the activity value of the Renilla luciferase.
(9) Calculating the ratio of renilla luciferase activity to firefly luciferase activity, performing experimental analysis, and comparing the ratio of renilla luciferase activity to firefly luciferase activity of the experimental group and the control group.
Results analysis, as shown in FIG. 8, in 293T cells with METT L3 methylase activity, CDCP1-155-173gRNA or CDCP1-212gRNA has higher luciferase activity and has significant difference compared with other control groups, which indicates that CDCP1-155-173gRNA and CDCP1-212gRNA can effectively guide the fusion protein dCasRx-METT L3 to bind with CDCP 13' UTR region 155, 173, 212 sites in 293T cells, thereby realizing methylation modification of the sites.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the technical scope of the present invention, and those skilled in the art may make modifications and variations within the spirit of the present invention, and all modifications, equivalents and modifications of the above embodiments according to the technical spirit of the present invention are within the scope of the present invention.
Sequence listing
<110> secondary first hospital of Zhongshan university
<120> RNA-targeted 6-methyladenine modified CasRx vector system, preparation method and application
<160>17
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213>Artificial Sequence
<400>1
ttccagatta cgctgctagc 20
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
ccctctccac tgccgctagc 20
<210>3
<211>4
<212>DNA
<213>Artificial Sequence
<400>3
aaac 4
<210>4
<211>3
<212>DNA
<213>Artificial Sequence
<400>4
aaa 3
<210>5
<211>4
<212>DNA
<213>Artificial Sequence
<400>5
aaac 4
<210>6
<211>4
<212>DNA
<213>Artificial Sequence
<400>6
aaaa 4
<210>7
<211>4
<212>DNA
<213>Artificial Sequence
<400>7
aaac 4
<210>8
<211>4
<212>DNA
<213>Artificial Sequence
<400>8
aaaa 4
<210>9
<211>329
<212>DNA
<213>Artificial Sequence
<400>9
acaccgaacc cctaccaact ggtcggggtt tgtttttttg aattctgatg cggtattttc 60
tccttacgca tctgtgcggt atttcacacc gcatacgtca aagcaaccat agttttttta 120
agcttggcgt aactagatct tgagacaaat ggcagtattc atccacaatt ttaaaagaaa 180
aggggggatt ggggggtaca gtgcagggga aagaatagta gacataatag caacagacat 240
acaaactaaa gaattacaaa aacaaattac aaaaattcaa aattttcggg tttattacag 300
ggacagcaga gatccacttt ggcgccggc 329
<210>10
<211>4
<212>DNA
<213>Artificial Sequence
<400>10
cacc 4
<210>11
<211>4
<212>DNA
<213>Artificial Sequence
<400>11
aaaa 4
<210>12
<211>4
<212>DNA
<213>Artificial Sequence
<400>12
cacc 4
<210>13
<211>4
<212>DNA
<213>Artificial Sequence
<400>13
aaaa 4
<210>14
<211>4
<212>DNA
<213>Artificial Sequence
<400>14
cacc 4
<210>15
<211>4
<212>DNA
<213>Artificial Sequence
<400>15
aaaa 4
<210>16
<211>42
<212>DNA
<213>Artificial Sequence
<400>16
tatcttgtgg aaaggacgaa acaccgaacc cctaccaact gg 42
<210>17
<211>42
<212>DNA
<213>Artificial Sequence
<400>17
atctttgcac ccgggccccc gccggcgcca aagtggatct ct 42

Claims (7)

1. The 6-methyladenine modified CasRx vector system of the target RNA is characterized in that the vector system comprises a protein expression vector of an inactivated CasRx nuclease fused with an enzymatic activity functional region of the 6-methyladenine modified enzyme, an oligonucleotide and an expression vector comprising a promoter sequence, a gRNA based on a target sequence, a gRNA scaffold sequence and an enzyme cutting site sequence.
2. The RNA-targeting 6-methyladenine modified CasRx vector system of claim 1, wherein the cleavage site sequence is a gRNA scaffold sequence with two BsmBI cleavage sites at the 5' end.
3. The RNA-targeting 6-methyladenine modified CasRx vector system of claim 1 wherein the promoter sequence is the human U6 polymerase III promoter sequence.
4. The RNA-targeting 6-methyladenine modified CasRx vector system of claim 1, wherein the gRNA is targeted to at least 1 target sequence based on the target sequence.
5. The preparation method of the RNA-targeted 6-methyladenine modified CasRx vector system is characterized by comprising the following steps:
1) amplifying a METT L3 enzyme activity region sequence from HUVEC cells, and performing PCR amplification, enzyme digestion, connection and transformation;
2) connecting the METT L3 active region sequence to EF1a-dCasRx-2A-EGFP vector to obtain an inactivated protein expression vector of the active functional region of the CasRx nuclease fused 6-methyladenine modifying enzyme;
3) constructing a gRNA scaffold structure comprising a restriction enzyme site sequence and a gRNA scaffold sequence; synthesizing gRNA based on target point sequence;
4) cloning the gRNA support structure and the gRNA based on the target sequence into an expression vector to obtain the expression vector comprising a promoter sequence, the gRNA based on the target sequence, a gRNA support sequence and an enzyme digestion site sequence.
6. The method for preparing RNA-targeting 6-methyladenine modified CasRx vector system according to claim 5, wherein the expression vector in step 4) is a CasRx gRNA cloning backbone or L entiguide-puro vector.
7. Use of the vector system according to any one of claims 1 to 4 for the preparation of a medicament for the treatment of a disease caused by abnormal RNA modification.
CN202010184015.3A 2020-03-16 2020-03-16 RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof Pending CN111440826A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010184015.3A CN111440826A (en) 2020-03-16 2020-03-16 RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010184015.3A CN111440826A (en) 2020-03-16 2020-03-16 RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof

Publications (1)

Publication Number Publication Date
CN111440826A true CN111440826A (en) 2020-07-24

Family

ID=71627574

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010184015.3A Pending CN111440826A (en) 2020-03-16 2020-03-16 RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN111440826A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941102A (en) * 2021-01-26 2021-06-11 南方医科大学 Construction method and application of mouse animal model in early epilepsy
CN114085834A (en) * 2021-11-16 2022-02-25 珠海中科先进技术研究院有限公司 Cancer cell guiding circuit group and application
CN114214327A (en) * 2021-12-16 2022-03-22 安可来(重庆)生物医药科技有限公司 sgRNA for targeted degradation of PCSK9mRNA, gene editing vector and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108103090A (en) * 2017-12-12 2018-06-01 中山大学附属第医院 RNA Cas9-m6A modified vector system for targeting RNA methylation, and construction method and application thereof
US20190002889A1 (en) * 2017-06-30 2019-01-03 Arbor Biotechnologies, Inc. Novel crispr rna targeting enzymes and systems and uses thereof
CN110656123A (en) * 2019-10-12 2020-01-07 中国农业大学 Method for screening sgRNA high-efficiency action target based on CRISPR-Cas13d system and application
WO2020006787A1 (en) * 2018-07-05 2020-01-09 浙江大学 Cell line with mettl3 gene knocked out and construction method therefor, and interference vector

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190002889A1 (en) * 2017-06-30 2019-01-03 Arbor Biotechnologies, Inc. Novel crispr rna targeting enzymes and systems and uses thereof
CN108103090A (en) * 2017-12-12 2018-06-01 中山大学附属第医院 RNA Cas9-m6A modified vector system for targeting RNA methylation, and construction method and application thereof
WO2020006787A1 (en) * 2018-07-05 2020-01-09 浙江大学 Cell line with mettl3 gene knocked out and construction method therefor, and interference vector
CN110656123A (en) * 2019-10-12 2020-01-07 中国农业大学 Method for screening sgRNA high-efficiency action target based on CRISPR-Cas13d system and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FAN YANG 等: ""Dynamic m6A mRNA methylation reveals the role of METTL3-m6A- CDCP1 signaling axis in chemical carcinogenesis"", 《ONCOGENE》 *
SILVANA KONERMANN 等: ""Transcriptome engineering with RNA-targeting Type VI-D CRISPR effectors"", 《CELL》 *
刘彦均 等: ""新 RNA 编辑技术 CRISPR-Cas13"", 《生物技术进展》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112941102A (en) * 2021-01-26 2021-06-11 南方医科大学 Construction method and application of mouse animal model in early epilepsy
CN114085834A (en) * 2021-11-16 2022-02-25 珠海中科先进技术研究院有限公司 Cancer cell guiding circuit group and application
CN114214327A (en) * 2021-12-16 2022-03-22 安可来(重庆)生物医药科技有限公司 sgRNA for targeted degradation of PCSK9mRNA, gene editing vector and application thereof
CN114214327B (en) * 2021-12-16 2023-05-02 安可来(重庆)生物医药科技有限公司 sgRNA for targeted degradation of PCSK9mRNA, gene editing vector and application thereof

Similar Documents

Publication Publication Date Title
CN108103090B (en) RNA Cas9-m6A modified vector system for targeting RNA methylation, and construction method and application thereof
US11560567B2 (en) Genetic elements driving circular RNA translation and methods of use
CN111440826A (en) RNA-targeted 6-methyladenine modified CasRx vector system, and preparation method and application thereof
CN105518138B (en) Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene
CN105985978B (en) Construction and application of novel RNA cyclization expression vector
CN113278635B (en) Sequence combination for promoting cyclic RNA (ribonucleic acid) to form ring and application thereof
CN109266650B (en) Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter
CN106282119B (en) Transformation and application of fixed-point integrated Chinese hamster ovary cell strain
CN106318976A (en) Human circRNA overexpression vector framework, overexpression vector and preparation methods thereof
CN108070609B (en) Method for expressing recombinant protein by using trichoderma reesei as host
CN112680443B (en) Promoter pCalm1 and application thereof
CN109355290A (en) A kind of plant circular rna expression frame and its application
CN102181448B (en) Cloning of sheep FGF5 gene and construction of lentiviral expression vector
CN112574992A (en) Circular RNA over-expression cyclization vector DNA sequence and construction method and application thereof
CN114990093B (en) Protein sequence MINI RFX-CAS13D with small amino acid sequence
CN114774399A (en) Resolution positioning analysis method for modifying single base by using artificially modified deaminase-assisted 5-hydroxymethylcytosine in DNA (deoxyribonucleic acid)
CN112359092A (en) Construction method of genome short fragment library
CN112011628A (en) LncRNA marker related to Hu sheep muscle cell proliferation as well as detection primer and application thereof
CN107034232B (en) Application of ATG16L1 gene in enhancing replication capacity of Newcastle disease virus
CN115820603B (en) DCasRx-NSUN6 single-gene-specific M5C modification editing method
CN110724712A (en) Construction method and application of miRNA sponge expression vector
CN114686516B (en) Rice potato leaf curl virus 2 infectious clone and construction method and application thereof
RU2660715C2 (en) Method of hominal mitochondrial genome copying in yarrowia lipolytica yeast cells
CN112779293A (en) Method for screening host cells of LacZ gene marker goat pox virus
CN116240199A (en) Mutant ribonuclease R and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20200724

RJ01 Rejection of invention patent application after publication