CN114085834A

CN114085834A - Cancer cell guiding circuit group and application

Info

Publication number: CN114085834A
Application number: CN202111355863.7A
Authority: CN
Inventors: 余裕; 姜长安
Original assignee: Zhuhai Institute Of Advanced Technology Chinese Academy Of Sciences Co ltd
Current assignee: Zhuhai Institute Of Advanced Technology Chinese Academy Of Sciences Co ltd
Priority date: 2021-11-16
Filing date: 2021-11-16
Publication date: 2022-02-25

Abstract

The invention provides a cancer cell guiding circuit group and application thereof, belonging to the technical field of genetic engineering. The cancer cell targeting circuit group comprises a first targeting gene circuit and a second targeting gene circuit; the first guide gene circuit and the second guide gene circuit both comprise an L7Ae sequence, and a microRNA sequence is inserted into the 3' UTR segment of each guide gene circuit, wherein the microRNA is from the cancer cell. The invention also discloses application of the cancer cell guiding circuit group. The invention adopts the L7Ae sequence, combines a terminal effect element based on CasRx, regulates and controls the translation process of CasRx through a positive/positive and positive/negative bidirectional promoter, and additionally adds miRNA targets to perform transcription regulation and control on the gene expression of L7Ae and CasRx, thereby achieving the effect of shorter total base sequence length and higher cell state specificity information content compared with the existing oncolytic virus gene therapy system.

Description

Cancer cell guiding circuit group and application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a cancer cell guiding circuit group and application thereof.

Background

With the development of molecular biology, especially the continuous progress of genetic engineering technology, various viruses, especially adenovirus vectors, have been used for a long time in gene therapy, gene immunization, etc., and the adenovirus vector plays an important role as a gene vector developed earlier. Because of their safety and high transduction efficiency, adenoviral vectors are the most commonly used vectors for gene therapy of tumors. However, the driving element used in the existing gene circuit is often composed of a single fixed microRNA and an expression mode of a natural promoter, and the expression mode can only distinguish cancer cells from normal healthy cells, and can not distinguish various cancer cell subsets which appear in a total cancer cell population due to heterogeneity among the cancer cells, and the heterogeneity among the cancer cells is just the most critical factor of drug resistance recurrence of the cancer cells, so that accurate identification and judgment of the proportion of the cancer cells in various states which exist at the same time are helpful for researching the heterogeneity among the cancer cells. Therefore, it is desirable to provide a cancer cell guiding circuit group and a method for preparing the same, so as to better identify the state of cancer cells and effectively improve the accuracy of identification.

In addition, the gene therapy system modified based on the oncolytic virus is regulated and controlled at the gene transcription level, the regulation and control process is complex, the occupied vector space is large, and the oncolytic adenovirus with large capacity is required to be used as a carrier of the gene therapy system. Therefore, the current therapeutic gene circuit can only rely on 1 unidirectional natural promoter and 2 miRNAs or a plurality of miRNAs to distinguish liver cancer tumor cells from normal liver cells at most so as to perform the tumor recognition killing effect. Moreover, the natural promoter has the problems of leaky basal expression and the like, a single natural promoter has a long base sequence but carries limited tumor information amount, the range of the tumor cell population which is effectively covered is small, and the tumor cells have the characteristic of high cell subset heterogeneity, so that various tumor subsets are difficult to comprehensively and efficiently capture, the tumor relapse in the future is caused, and the non-expansion period and the total life cycle of the tumor cells of a patient are still short. In addition, the virus vector oncolytic virus adopted in the current gene circuit therapy has the function of self-replicating in tumors, but the larger the tumor volume in a patient is, the more oncolytic virus is carried, more oncolytic virus than a certain degree is, and the whole body immune response caused by cytokine storm is easily caused. Therefore, therapeutic approaches based on oncolytic virus killing of tumors still present a certain safety risk.

Disclosure of Invention

The present invention is directed to a cancer cell guiding circuit set and applications thereof, which at least partially solve the above-mentioned problems.

According to an aspect of the present invention, there is provided a cancer cell targeting circuit group comprising a first targeting gene circuit and a second targeting gene circuit;

the first guide gene circuit at least comprises a 3'UTR segment, an L7Ae sequence, a first forward promoter, a U6 promoter, a regulating RNA sequence, a second forward promoter, a reverse regulating sequence, a CasRx sequence and a 3' UTR segment which are connected in sequence;

the second guide gene circuit at least comprises a 3'UTR segment, an L7Ae sequence, a negative promoter, a U6 promoter, a gRNA sequence, the second positive promoter, a box C/D kink-turn sequence, a CasRx sequence and a 3' UTR segment which are connected in sequence;

and microRNA sequences are inserted into the 3' UTR sections, and the microRNAs come from the cancer cells.

Preferably, the regulatory RNA sequence is a box C/D sequence and the counter-regulatory sequence is an Anti-box C/D sequence.

Preferably, said first guide gene circuit further comprises said regulatory RNA sequence, said pre-tRNA sequence, said gRNA sequence, and said second forward promoter connected in sequence.

Preferably, the first gene targeting circuit has a length in the range of not more than 6 kb.

Preferably, the second gene targeting circuit has a length in the range of not more than 5 kb.

Preferably, the first gene targeting circuit has a length in the range of not more than 4.4 kb.

Preferably, the microRNA is a microRNA specifically and highly expressed in the cancer cells.

Preferably, the first positive promoter, the second positive promoter, and the negative promoter are all from the cancer cell.

According to another aspect of the present invention, there is also provided a use of the cancer cell targeting circuit group as described above in the preparation of a cancer cell targeting vector.

Preferably, the cancer cell targeting vector is a vector in which the cancer cell targeting circuit according to any one of claims 1 to 8 is inserted between the 5'ITR inverted terminal repeat and the 3' ITR inverted terminal repeat of an adeno-associated viral vector.

The invention adopts the L7Ae sequence, combines a terminal effect element based on CasRx, regulates and controls the translation process of CasRx through a positive/positive and positive/negative bidirectional promoter, and additionally adds miRNA targets to perform transcription regulation and control on the gene expression of L7Ae and CasRx, thereby achieving the effect of shorter total base sequence length and higher cell state specificity information content compared with the existing oncolytic virus gene therapy system.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a schematic diagram of a first gene targeting circuit according to the present invention;

FIG. 2 is a schematic diagram of a second gene targeting circuit according to the present invention.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples. It is to be understood that the specific embodiments described herein are merely illustrative of the relevant invention and not restrictive of the invention. For convenience of description, only portions related to the invention are shown in the drawings.

It should be noted that the embodiments and features of the embodiments may be combined with each other without conflict.

The embodiment of the application provides a cancer cell state-oriented gene circuit group and a method for preparing the cancer cell state-oriented gene circuit, and it is to be noted that the cancer cell state-oriented gene circuit in the gene circuit component can be applied to the identification of cancer cells in various states, such as various states of immune escape, skeleton recombination, invasion and migration and the like generated by an SMMC-7721 or an MHCC997H cancer cell line under a drug-resistant condition, and can also be combined with a targeted drug to prepare the targeted drug capable of accurately killing certain subtype cancer cells, and the specific application of the targeted drug is not limited in the application. Accordingly, the cancer cell state-targeting gene circuit described in the embodiments of the present application, i.e., a gene segment comprising a promoter or a promoter-containing element and having a recognition function, is called a gene circuit because it is responsible for recognizing a specific target gene segment and initiating a subsequent recognition display or treatment process.

The cancer cell line in the present embodiment mainly refers to a group of cancer cells with similar gene expression, such as SMMC-7721 or MHCC997H line, and the cancer cells in the present embodiment may be liver cancer, glioblastoma, biliary tract cancer, lung cancer, pancreatic cancer, melanoma, bone cancer, breast cancer, colorectal cancer, stomach cancer, prostate cancer, leukemia, uterine cancer, ovarian cancer, lymphoma or brain cancer, more preferably liver cancer, glioblastoma or biliary tract cancer, and most preferably liver cancer.

The cancer cell state in the present application mainly refers to various states of tumor cancer stem-stem maintenance differentiation, immune escape, skeleton recombination, invasion and migration, cell division cycle speed and the like, which are expressed by cancer cells under the condition of drug action or continuous culture, and the gene expression of the cancer cells is different from the cancer cell lines, especially, the enhancer in the gene sequence of the cancer cells under different cancer cell states is greatly different. Such cancer cells of different cancer cell states are often the cause of repeated recurrence during cancer therapy, and are also the main target of the present invention, because they have drug resistance and may have other malignant properties such as high metastasis.

In the examples of the present application, the viral vector used for testing and practicing the cancer cell targeting circuit group provided by the present invention may be derived from retrovirus, for example, Human Immunodeficiency Virus (HIV), Mouse Leukemia Virus (MLV), Avian sarcoma/leukemia virus (Avian sarcoma/leukemia virus, ASLV), spleen necrosis virus (snerenecrosis virus, SNV), Rous Sarcoma Virus (RSV), Mouse Mammary Tumor Virus (MMTV), etc.), Adenovirus (Adenovirus), Adeno-associated virus (AAV), or Herpes simplex virus (AAV), etc., but is not limited thereto, and preferably Adeno-associated virus (AAV). The techniques for constructing promoters based on retroviruses for testing lentiviruses are well known to those skilled in the art and will not be described in detail herein.

In the present embodiment, the vector of the present invention includes a signal sequence or leader sequence for membrane targeting or secretion in addition to expression regulatory elements such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer, and can be prepared in various ways according to the purpose. The promoter of the vector may be constitutive or inducible. In addition, the expression vector comprises a selectable marker for selecting host cells containing the vector, and when the expression vector is a replicable expression vector, a replicon may be included. The vector may be self-replicating or integrated into the host DNA.

In the present examples, the terms "linked" and "linking" are used to refer to the functional linkage of a nucleic acid expression control sequence that performs a conventional function to a nucleic acid sequence encoding a gene of interest. For example, when a promoter is inserted into a gene sequence of a retrovirus, the expression of the gene sequence of the retrovirus may be under the influence or control of the promoter. The "ligation" or "ligation" in the embodiments of the present application can be considered to be completed when the ligation property between the gene sequence of the promoter and the gene sequence of the retrovirus does not induce a frame shift mutation and the expression of the ribozyme is not inhibited by the expression regulatory sequence. This "joining" or "linking" process can be accomplished using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes well known in the art.

The term "microRNA" or "miRNA" as used in the present invention has its ordinary meaning in the art. Thus, "microRNA" refers to an RNA molecule from a genetic locus that is processed from a transcript that can form a local RNA precursor miRNA structure. Mature mirnas are typically 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present, for example 18, 19, 26, or 27 nucleotides.

In the present application, the miRNA coding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within a non-fully paired RNA duplex that serves as an intermediate for miRNA processing from longer precursor transcripts. This processing typically occurs through the sequential action of two specific endonucleases, called Drosha and Dicer, respectively. Drosha produces miRNA precursors from the primary transcript that typically fold into a hairpin or stem-loop structure. Cleavage of this miRNA precursor using Dicer method can result in a miRNA duplex with one arm of the hairpin or stem-loop structure containing the mature miRNA and the other arm containing a segment of similar size. The miRNA is then directed to its target mRNA to perform its function, while the miRNA is degraded. In addition, mirnas are typically derived from different genomic segments than the predicted protein coding regions.

In the present application, the regulatory and counter-regulatory RNA sequences, which may include Box C/D sequences and Anti Box C/D sequences, refer to RNA sequences that contain two short sequence elements, namely Box C (RUGAUGA) at the 5 'end and Box D (CUGA) at the 3' end, and that function in regulation. Most box C/D snorRNA genes have inverted repeats of 4 to 5nt at the 5 'and 3' ends, and can form a stable short stem structure. Can form strict pairing with a target RNA so as to guide the modification of a specific site.

The pre-tRNA sequence in this application refers to the precursor of the tRNA sequence, and the specific acquisition process is well known to those skilled in the art and will not be described herein.

The invention provides a cancer cell guiding circuit group, which comprises a first guiding gene circuit and a second guiding gene circuit;

the second guide gene circuit at least comprises a 3'UTR segment, an L7Ae sequence, a negative promoter, a U6 promoter, a gRNA sequence, a second positive promoter, a box C/D kink-turn sequence, a CasRx sequence and a 3' UTR segment which are connected in sequence;

microRNA sequences are inserted into the 3' UTR sections, and the microRNAs come from cancer cells.

The sequence of an implementation mode of the L7Ae sequence in the application is shown as SEQ ID No.1, and specifically comprises the following steps:

SEQ ID No.1：atgtacgtgagatttgaggttcctgaggacatgcagaacgaagctctgagtctgctggagaaggttagggagagcggtaaggtaaagaaaggtaccaacgagacgacaaaggctgtggagaggggactggcaaagctcgtttacatcgcagaggatgttgacccgcctgagatcgttgctcatctgcccctcctctgcgaggagaagaatgtgccgtacatttacgttaaaagcaagaacgaccttggaagggctgtgggcattgaggtgccatgcgcttcggcagcgataatcaacgagggagagctgagaaaggagcttggaagccttgtggagaagattaaaggccttcagaagtga。

the sequence of one implementation manner of the first forward promoter and the second forward promoter in the embodiment of the present application may be shown as any one of SEQ ID nos. 2 to 4, specifically as follows:

SEQ ID No.2：ggtgctgtccgtggtgctgaagaggtgctgtccgtggtgctgatcgggtgctgtccgtggtgctgagacggtgctgtccgtggtgctgactaggtgctgtccgtggtgctgaact；

SEQ ID No.3：ttatcttgtagattatcttgttcgttatcttgtgacttatcttgtctattatcttgtactttatcttgttgcttatcttgtgtattatcttgt；

SEQ ID No.4：ggtgctgtccgtggtgctgaagaggtgctgtccgtggtgctgatcgggtgctgtccgtggtgctgagacggtgctgtccgtggtgctgactaggtgctgtccgtggtgctgaact。

the sequence of an implementation manner of the negative promoter in the embodiment of the present application can be shown as SEQ ID No.5, specifically as follows:

SEQ ID No.5：tgtttgtttagatgtttgttttcgtgtttgtttgactgtttgtttctatgtttgtttacttgtttgttttgctgtttgtttgtatgtttgttt。

taking the liver cancer cell line MHCC97H as an example, one implementation manner of the extracted microRNA sequence can be shown as any one of SEQ ID nos. 6 to 9, and specifically as follows:

SEQ ID No.6：ccaaactgtgctgggtacaacg；

SEQ ID No.7：actgtcgttaccatgtagtgtt；

SEQ ID No.8：ccaaactgtgctgggtacaacg；

SEQ ID No.9：ccaaactgtgctgggtacaacg。

in a preferred embodiment, the regulatory RNA sequence in the first cancer cell targeting circuit provided in the examples herein is a kink-turn sequence and the counter-regulatory sequence is an Anti-kink-turn sequence. The sequence of a kink-turn sequence in the present application is shown in SEQ ID No.10, specifically as follows:

SEQ ID No.10：gggcgtgatccgaaaggtgaccc。

the sequence of an implementation manner of the Anti-kink-turn sequence in the application is shown as SEQ ID No.11, and specifically comprises the following steps:

SEQ ID No.11：gggtcacctttcggatcacgccc。

in a preferred embodiment, the first guide gene circuit further comprises a regulatory RNA sequence, a pre-tRNA sequence, a gRNA sequence, and a second forward promoter, which are linked in sequence.

In a preferred embodiment, the first gene targeting circuit has a length in the range of not more than 6 kb.

In a preferred embodiment, the second gene targeting circuit has a length in the range of not more than 5 kb. More preferably, the second gene targeting circuit has a length in the range of not more than 4.4 kb.

In a preferred embodiment, the microRNA is a microRNA specifically and highly expressed in cancer cells.

The sequence of one implementation mode of the sequence of the U6 promoter is shown as SEQ ID No.12, and specifically comprises the following steps:

SEQ ID No.12:gatccgacgccgccatctctaggcccgcgccggccccctcgcacagacttgtgggagaagctcggctactcccctgccccggttaatttgcatataatatttcctagtaactatagaggcttaatgtgcgataaaagacagataatctgttctttttaatactagctacattttacatgataggcttggatttctataagagatacaaatactaaattattattttaaaaaacagcacaaaaggaaactcaccctaactgtaaagtaattgtgtgttttgagactataaatatcccttggagaaaagccttgttt。

the CasRx in the examples of the present application refers to a protein sequence described in document 1, which is a more efficient gene editing tool for targeting RNA, and one implementation manner of the amino acid sequence of the CasRx protein in the present application is shown in SEQ ID No.13, specifically as follows: SEQ ID No.13: MIEKKKSFAKGMGVKSTLVSGSKVYMTTFAEGSDARLEKIVEGDSIRSVNEGEAFSAEMADKNAGYKIGNAKFSHPKGYAVVANNPLYTGPVQQDMLGLKETLEKRYFGESADGNDNICIQVIHNILDIEKILAEYITNAAYAVNNISGLDKDIIGFGKFSTVYTYDEFKDPEHHRAAFNNNDKLINAIKAQYDEFDNFLDNPRLGYFGQAFFSKEGRNYIINYGNECYDILALLSGLRHWVVHNNEEESRISRTWLYNLDKNLDNEYISTLNYLYDRITNELTNSFSKNSAANVNYIAETLGINPAEFAEQYFRFSIMKEQKNLGFNITKLREVMLDRKDMSEIRKNHKVFDSIRTKVYTMMDFVIYRYYIEEDAKVAAANKSLPDNEKSLSEKDIFVINLRGSFNDDQKDALYYDEANRIWRKLENIMHNIKEFRGNKTREYKKKDAPRLPRILPAGRDVSAFSKLMYALTMFLDGKEINDLLTTLINKFDNIQSFLKVMPLIGVNAKFVEEYAFFKDSAKIADELRLIKSFARMGEPIADARRAMYIDAIRILGTNLSYDELKALADTFSLDENGNKLKKGKHGMRNFIINNVISNKRFHYLIRYGDPAHLHEIAKNEAVVKFVLGRIADIQKKQGQNGKNQIDRYYETCIGKDKGKSVSEKVDALTKIITGMNYDQFDKKRSVIEDTGRENAEREKFKKIISLYLTVIYHILKNIVNINARYVIGFHCVERDAQLYKEKGYDINLKKLEEKGFSSVTKLCAGIDETAPDKRKDVEKEMAERAKESIDSLESANPKLYANYIKYSDEKKAEEFTRQINREKAKTALNAYLRNTKWNVIIREDLLRIDNKTCTLFRNKAVHLEVARYVHAYINDIAEVNSYFQLYHYIMQRIIMNERYEKSSGKVSEYFDAVNDEKKYNDRLLKLLCVPFGYCIPRFKNLSIEALFDRNEAAKFDKEKKKVSGNS.

In order to meet specific guiding requirements and improve the guidance of cancer cells, the first positive promoter, the second positive promoter and the negative promoter are synthesized based on natural promoters of the cancer cells. In the embodiment of the present application, a specific implementation manner for constructing the positive synthetic promoter and the negative synthetic promoter based on the positive promoter and the negative promoter may be based on common knowledge in the art that the core sequences of the promoter and the promoter are relatively close, and the positive synthetic promoter and the negative synthetic promoter including the corresponding promoter may be prepared by using technical means commonly used by those skilled in the art, such as overlapping the promoter sequence with the CpG island sequence and performing protein modification. The present application is not particularly limited as to the specific manner of synthesizing a promoter in a positive direction and a promoter in a negative direction, and the means thereof are well known to those skilled in the art.

The embodiment of the present application further provides an application of the cancer cell targeting circuit group in preparation of a cancer cell targeting vector, which specifically includes:

the above cancer cell targeting circuit group was inserted into the adeno-associated viral vector. In the present examples, the term "insertion" is used to refer to the functional linkage of a nucleic acid expression control sequence that performs a conventional function to a nucleic acid sequence encoding a gene of interest (functional linkage). For example, when a genetic circuit is inserted into a retroviral gene sequence, expression of the retroviral gene sequence may be under the influence or control of a promoter. The "insertion" in the examples of the present application can be considered to be completed when the ligation property between the gene sequence of the promoter and the gene sequence of the retrovirus does not induce a frame shift mutation and the expression of the ribozyme is not inhibited by the expression regulatory sequence. This "insertion" process can be accomplished using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation can be performed using enzymes well known in the art.

And inserting the above cancer cell targeting circuit group into the adeno-associated virus vector. The adeno-associated virus is mainly adeno-associated virus, belongs to the genus dependovirus of the family parvoviridae, is a single-stranded DNA-deficient virus with the simplest structure, and needs a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in inverted repeats (ITRs) at both ends. ITRs are crucial for replication and packaging of viruses. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cells. In the presence of the rep gene product, viral DNA readily integrates into human chromosome 19. The specific insertion site is located between the 5'ITR inverted terminal repeat and the 3' ITR inverted terminal repeat of the adeno-associated viral vector, wherein:

the 5' ITR inverted terminal repeat sequence is shown as SEQ ID No. 14:

SEQ ID No.14：cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct。

the 3' ITR inverted terminal repeat sequence is shown as SEQ ID No. 15:

SEQ ID No.15：aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg。

hereinafter, the present invention will be described in detail with reference to examples. However, the embodiments according to the present specification may be modified into various other forms, and the scope of the present specification should not be construed as being limited to the embodiments described below. The examples of this specification are provided to more fully describe the specification to those skilled in the art.

Examples

Material

Cell:

MHCC97H, a human highly metastatic hepatoma cell line, was provided by the Shanghai institute for cell biology, Chinese academy of sciences.

Drugs and reagents:

doxorubicin (Doxorubicin), specification: 10mg, batch number: KFS276, supplier: (ii) Baiolaibo.

Sorafenib (Sorafenib), specification: 10mg, batch number: bay 43-9006, supplier: gonghai Ruihui chemical technology Co., Ltd.

Los Wei-1640 (RPMI-1640) Medium and Fetal Bovine Serum (FBS), purchased from GI BCO, USA.

Doxycycline (Doxycycline hydrochloride), specification: 10mM/mL, batch number: ID0390-10mM × 1ml (in water), supplier: solibao.

Plasmids were synthesized from general organisms (Anhui), the classifier plasmid backbone used the SWB-Blas tidin lentiviral backbone, and the synthetic promoter vector backbone used SWP-Puromycin.

Lipofectamine3000, Specification: 1mL, batch number: l3000015, supplier: ThermalFisher.

Lentivirus packaging kit, specification: 100mL, batch number: GM-040801-: is filled with organisms.

The instrument comprises the following steps:

CX41 inverted phase contrast microscope and BX51 fluorescence microscope, both available from Olympus, Japan; DTX880 ELISA, available from Beckman, USA; 751GD ultraviolet spectrophotometer, available from Hangzhou Hull instruments, Inc.; CytoFLEX flow cytometer available from beckmann coulter international trade (shanghai) ltd.

The implementation method comprises the following steps:

example 1

Treating a cell population treated by the chemotherapeutic drug Doxorubicin and the targeted drug Sorafenib by 25ng/mL chemotherapeutic drug Doxorubicin and 2 mu M targeted drug, treating MHCC97H of a liver cancer cell line for 21 days, mixing the cells by using a vector loaded with a first guide gene circuit and a second guide gene circuit (the first guide gene circuit is loaded with two first positive promoters as shown in SEQ ID No.2 and SEQ ID No.3 and two miRNAs as shown in SEQ ID No.6 and SEQ ID No. 7; the second guide gene circuit is loaded with a second positive promoter and a negative promoter as shown in SEQ ID No.3 and SEQ ID No.4 and two miRNAs as shown in SEQ ID No.6 and SEQ ID No. 7), treating the cell population treated by the chemotherapeutic drug Doxorubicin and the targeted drug Sorafenib, and detecting the treatment group and the negative control group of the Elkinmer high-content cell analyzer by Hoechst33342/PI staining after 9 days, and detecting the treatment rate and apoptosis of the treatment group, And (3) carrying out total RNA extraction, RNA reverse transcription cDNA and quantitative PCR detection on the cells of the negative control group to obtain the relative expression indexes of the BIRC5 and BCL2 genes in the cells of the treatment group and the negative control group:

transfection, quantitative gene expression analysis, apoptotic cell staining procedure:

1. transfecting when the cell confluence is 70%;

2. diluting Lipofectamine3000 with Opti-MEM medium, and mixing well;

3. diluting plasmid DNA by using an Opti-MEM culture medium to prepare a plasmid DNA premix, adding a P3000 reagent, and fully mixing;

4. diluted DNA (1:1 ratio) was added to each tube of diluted Lipofectamine3000 reagent.

5. Incubation for 15 minutes at room temperature;

6. adding plasmid DNA-Lipofectamine3000 complex to the cells;

7. incubating the cells at 37 ℃ for 9 days, observing the apoptosis staining effect of the cells of the Hoechst33342/PI treatment group and the control group by a PerkinElmer high-content cell phenotype analyzer, collecting the cell RNA of the treatment group and the negative control group, and using Takara PrimeScript^TMReverse transcription kit, reverse transcribing the extracted mRNA into cDNA

PremixExTaq^TMII (TliR NaseHPlus) kit, and calculating and analyzing the expression abundance of the BIRC5 and BCL2 genes on an ABI quantitative PCR instrument.

Staining of Hoechst33342/PI apoptotic cells:

1. approximately 10-100 million cells per sample were collected in a 1.5mL centrifuge tube and the supernatant discarded by centrifugation. The cell pellet was resuspended in 0.8-1mL of cell staining buffer.

2. Add 5. mu.l Hoechst33342 staining solution.

3. 5 microliters of PI staining solution was added.

4. Mixing, and incubating in ice bath or at 4 deg.C for 20-30 min.

5. Red and blue fluorescence were detected by flow cytometry.

6. If detected using a fluorescence microscope, cells are spun down before detection, washed once with PBS, and mounted for red and blue fluorescence. Detecting adherent cells by using a fluorescence microscope, wherein the cells are not collected, and a cell staining buffer solution and a Hoechst33342 staining solution are directly and sequentially added according to the proportion

And PI staining solution is used for staining for 20-30 minutes at ice bath or 4 ℃. After staining, PBS was washed once and analyzed by observation under a PerkinElmer high content microscope. The specific experimental data are shown in table 1:

TABLE 1

Example 2

Treating a liver cancer cell line MHCC97H with 25ng/mL chemotherapeutic drug Doxorubicin and targeted drug Sorafenib, mixing 21 days later by using a vector loaded with a first guide gene circuit and a second guide gene circuit (the first guide gene circuit is loaded with two first positive promoters as shown in SEQ ID No.1 and SEQ ID No.2 and two miRNAs as shown in SEQ ID No.8 and SEQ ID No. 9; the second guide gene circuit is loaded with a second positive promoter and a negative promoter as shown in SEQ ID No.3 and SEQ ID No.4 and two miRNAs as shown in SEQ ID No.8 and SEQ ID No. 9), treating the cell population treated with the chemotherapeutic drug Doxorubicin and the targeted drug Sorafenib, detecting the apoptosis rate of a treatment group and a negative control group by using a Hoechst33342/PI staining combined high-mer cell analyzer after 9 days, and detecting the apoptosis rate of the treatment group and treating the group by using a Hokinst 33342/PI staining combined high-content analyzer, And (3) carrying out total RNA extraction, RNA reverse transcription cDNA and quantitative PCR detection on the cells of the negative control group to obtain the relative expression indexes of the BIRC5 and BCL2 genes in the cells of the treatment group and the negative control group:

1. transfecting when the cell confluence is 70%;

2. diluting Lipofectamine3000 with Opti-MEM medium, and mixing well;

4. diluted DNA (1:1 volume ratio) was added to each tube of diluted Lipofectamine3000 reagent.

5. Incubation for 15 minutes at room temperature;

6. adding plasmid DNA-Lipofectamine3000 complex to the cells;

cells were incubated at 7.37 ℃ for 9 days, the apoptosis staining effect of the treated and control Hoechst33342/PI cells was observed by PerkinElmer high-content cell phenotype Analyzer, and cellular RNAs of the treated and negative controls were collected and used in Takara PrimeScript^TMReverse transcription kit, reverse transcribing the extracted mRNA into cDNA

Staining of Hoechst33342/PI apoptotic cells:

2. Add 5. mu.l Hoechst staining solution.

3. 5 microliters of PI staining solution was added.

4. Mixing, and incubating in ice bath or at 4 deg.C for 20-30 min.

5. Red and blue fluorescence were detected by flow cytometry.

6. If detected using a fluorescence microscope, cells are spun down before detection, washed once with PBS, and mounted for red and blue fluorescence. To pair

Detecting adherent cells by using a fluorescence microscope, and directly adding a cell staining buffer solution and a Hoechst33342 staining solution according to the proportion in turn without collecting the cells

And PI staining solution is used for staining for 20-30 minutes at ice bath or 4 ℃. After staining, PBS was washed once and analyzed by observation under a PerkinElmer high content microscope. Specific data are shown in table 2:

TABLE 2

According to the data, in a gene therapy system, a bidirectional synthesis promoter, a cell state phenotype specificity recognition element such as miRNA and the like and a CasRx gene editing system are subjected to fragment integration, the length of the minimum total integration insertion fragment of a first guide gene circuit is less than 6kb and can be smoothly arranged on an adenovirus vector, the length of the minimum total integration insertion fragment of a second guide gene circuit is less than 4.4kb and can be smoothly arranged on the adenovirus, and an adeno-associated virus AAV (adeno-associated virus AAV) which is a vector suitable for gene therapy application is formed to form high information amount cell state phenotype specificity input which can contain the bidirectional synthesis promoter and multiple miRNAs, so that the gene therapy system is suitable for carrying out high specificity oncogene inhibition on multiple cancer cell subsets, and further achieves the effect of mildly promoting the cancer cell subsets to be thoroughly killed.

According to the invention, a plurality of different preselected promoters are obtained by carrying out drug-resistant culture on cancer cells, the preselected promoters are used for constructing the promoter test lentivirus, and different cell phenotype state estimators are combined, so that a dual stable transgenic cancer cell line is obtained by infecting the cancer cells respectively by using the cell phenotype state estimator and the promoter test lentivirus, and a preselected promoter can be used for highly identifying various subtype cancer cell lines based on the drug-resistant culture result of the dual stable transgenic cancer cell line, so that the preselected promoter can be used as a driving element in a gene circuit constructed subsequently.

Reference documents:

1.Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors(Konermann S,Lotfy P,Brideau N J,et al.Transcriptome engineering with RNA-targeting type VI-D CRI SPR effectors[J].Cell,2018,173(3):665-676.e14.

the above description is only a preferred embodiment of the application and is illustrative of the principles of the technology employed. It will be appreciated by those skilled in the art that the scope of the invention herein disclosed is not limited to the particular combination of features described above, but also encompasses other arrangements formed by any combination of the above features or their equivalents without departing from the inventive concept. For example, the above features may be replaced with (but not limited to) features having similar functions disclosed in the present application.

Sequence listing

<110> Zhuhaizhongke advanced technology research institute Co., Ltd

<120> cancer cell guiding circuit group and application

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 360

<212> DNA

<213> Archaeoglobus veneficus

<400> 1

atgtacgtga gatttgaggt tcctgaggac atgcagaacg aagctctgag tctgctggag 60

aaggttaggg agagcggtaa ggtaaagaaa ggtaccaacg agacgacaaa ggctgtggag 120

aggggactgg caaagctcgt ttacatcgca gaggatgttg acccgcctga gatcgttgct 180

catctgcccc tcctctgcga ggagaagaat gtgccgtaca tttacgttaa aagcaagaac 240

gaccttggaa gggctgtggg cattgaggtg ccatgcgctt cggcagcgat aatcaacgag 300

ggagagctga gaaaggagct tggaagcctt gtggagaaga ttaaaggcct tcagaagtga 360

<210> 2

<211> 115

<212> DNA

<213> Homo sapiens

<400> 2

ggtgctgtcc gtggtgctga agaggtgctg tccgtggtgc tgatcgggtg ctgtccgtgg 60

tgctgagacg gtgctgtccg tggtgctgac taggtgctgt ccgtggtgct gaact 115

<210> 3

<211> 93

<212> DNA

<213> Homo sapiens

<400> 3

ttatcttgta gattatcttg ttcgttatct tgtgacttat cttgtctatt atcttgtact 60

ttatcttgtt gcttatcttg tgtattatct tgt 93

<210> 4

<211> 115

<212> DNA

<213> Homo sapiens

<400> 4

ggtgctgtcc gtggtgctga agaggtgctg tccgtggtgc tgatcgggtg ctgtccgtgg 60

tgctgagacg gtgctgtccg tggtgctgac taggtgctgt ccgtggtgct gaact 115

<210> 5

<211> 93

<212> DNA

<213> Homo sapiens

<400> 5

tgtttgttta gatgtttgtt ttcgtgtttg tttgactgtt tgtttctatg tttgtttact 60

tgtttgtttt gctgtttgtt tgtatgtttg ttt 93

<210> 6

<211> 22

<212> DNA

<213> Homo sapiens

<400> 6

ccaaactgtg ctgggtacaa cg 22

<210> 7

<211> 22

<212> DNA

<213> Homo sapiens

<400> 7

actgtcgtta ccatgtagtg tt 22

<210> 8

<211> 22

<212> DNA

<213> Homo sapiens

<400> 8

ccaaactgtg ctgggtacaa cg 22

<210> 9

<211> 22

<212> DNA

<213> Homo sapiens

<400> 9

ccaaactgtg ctgggtacaa cg 22

<210> 10

<211> 23

<212> DNA

<213> Homo sapiens

<400> 10

gggcgtgatc cgaaaggtga ccc 23

<210> 11

<211> 23

<212> DNA

<213> Homo sapiens

<400> 11

gggtcacctt tcggatcacg ccc 23

<210> 12

<211> 315

<212> DNA

<213> Homo sapiens

<400> 12

gatccgacgc cgccatctct aggcccgcgc cggccccctc gcacagactt gtgggagaag 60

ctcggctact cccctgcccc ggttaatttg catataatat ttcctagtaa ctatagaggc 120

ttaatgtgcg ataaaagaca gataatctgt tctttttaat actagctaca ttttacatga 180

taggcttgga tttctataag agatacaaat actaaattat tattttaaaa aacagcacaa 240

aaggaaactc accctaactg taaagtaatt gtgtgttttg agactataaa tatcccttgg 300

agaaaagcct tgttt 315

<210> 13

<211> 967

<212> PRT

<213> Escherichia coli

<400> 13

Met Ile Glu Lys Lys Lys Ser Phe Ala Lys Gly Met Gly Val Lys Ser

1 5 10 15

Thr Leu Val Ser Gly Ser Lys Val Tyr Met Thr Thr Phe Ala Glu Gly

20 25 30

Ser Asp Ala Arg Leu Glu Lys Ile Val Glu Gly Asp Ser Ile Arg Ser

35 40 45

Val Asn Glu Gly Glu Ala Phe Ser Ala Glu Met Ala Asp Lys Asn Ala

50 55 60

Gly Tyr Lys Ile Gly Asn Ala Lys Phe Ser His Pro Lys Gly Tyr Ala

65 70 75 80

Val Val Ala Asn Asn Pro Leu Tyr Thr Gly Pro Val Gln Gln Asp Met

85 90 95

Leu Gly Leu Lys Glu Thr Leu Glu Lys Arg Tyr Phe Gly Glu Ser Ala

100 105 110

Asp Gly Asn Asp Asn Ile Cys Ile Gln Val Ile His Asn Ile Leu Asp

115 120 125

Ile Glu Lys Ile Leu Ala Glu Tyr Ile Thr Asn Ala Ala Tyr Ala Val

130 135 140

Asn Asn Ile Ser Gly Leu Asp Lys Asp Ile Ile Gly Phe Gly Lys Phe

145 150 155 160

Ser Thr Val Tyr Thr Tyr Asp Glu Phe Lys Asp Pro Glu His His Arg

165 170 175

Ala Ala Phe Asn Asn Asn Asp Lys Leu Ile Asn Ala Ile Lys Ala Gln

180 185 190

Tyr Asp Glu Phe Asp Asn Phe Leu Asp Asn Pro Arg Leu Gly Tyr Phe

195 200 205

Gly Gln Ala Phe Phe Ser Lys Glu Gly Arg Asn Tyr Ile Ile Asn Tyr

210 215 220

Gly Asn Glu Cys Tyr Asp Ile Leu Ala Leu Leu Ser Gly Leu Arg His

225 230 235 240

Trp Val Val His Asn Asn Glu Glu Glu Ser Arg Ile Ser Arg Thr Trp

245 250 255

Leu Tyr Asn Leu Asp Lys Asn Leu Asp Asn Glu Tyr Ile Ser Thr Leu

260 265 270

Asn Tyr Leu Tyr Asp Arg Ile Thr Asn Glu Leu Thr Asn Ser Phe Ser

275 280 285

Lys Asn Ser Ala Ala Asn Val Asn Tyr Ile Ala Glu Thr Leu Gly Ile

290 295 300

Asn Pro Ala Glu Phe Ala Glu Gln Tyr Phe Arg Phe Ser Ile Met Lys

305 310 315 320

Glu Gln Lys Asn Leu Gly Phe Asn Ile Thr Lys Leu Arg Glu Val Met

325 330 335

Leu Asp Arg Lys Asp Met Ser Glu Ile Arg Lys Asn His Lys Val Phe

340 345 350

Asp Ser Ile Arg Thr Lys Val Tyr Thr Met Met Asp Phe Val Ile Tyr

355 360 365

Arg Tyr Tyr Ile Glu Glu Asp Ala Lys Val Ala Ala Ala Asn Lys Ser

370 375 380

Leu Pro Asp Asn Glu Lys Ser Leu Ser Glu Lys Asp Ile Phe Val Ile

385 390 395 400

Asn Leu Arg Gly Ser Phe Asn Asp Asp Gln Lys Asp Ala Leu Tyr Tyr

405 410 415

Asp Glu Ala Asn Arg Ile Trp Arg Lys Leu Glu Asn Ile Met His Asn

420 425 430

Ile Lys Glu Phe Arg Gly Asn Lys Thr Arg Glu Tyr Lys Lys Lys Asp

435 440 445

Ala Pro Arg Leu Pro Arg Ile Leu Pro Ala Gly Arg Asp Val Ser Ala

450 455 460

Phe Ser Lys Leu Met Tyr Ala Leu Thr Met Phe Leu Asp Gly Lys Glu

465 470 475 480

Ile Asn Asp Leu Leu Thr Thr Leu Ile Asn Lys Phe Asp Asn Ile Gln

485 490 495

Ser Phe Leu Lys Val Met Pro Leu Ile Gly Val Asn Ala Lys Phe Val

500 505 510

Glu Glu Tyr Ala Phe Phe Lys Asp Ser Ala Lys Ile Ala Asp Glu Leu

515 520 525

Arg Leu Ile Lys Ser Phe Ala Arg Met Gly Glu Pro Ile Ala Asp Ala

530 535 540

Arg Arg Ala Met Tyr Ile Asp Ala Ile Arg Ile Leu Gly Thr Asn Leu

545 550 555 560

Ser Tyr Asp Glu Leu Lys Ala Leu Ala Asp Thr Phe Ser Leu Asp Glu

565 570 575

Asn Gly Asn Lys Leu Lys Lys Gly Lys His Gly Met Arg Asn Phe Ile

580 585 590

Ile Asn Asn Val Ile Ser Asn Lys Arg Phe His Tyr Leu Ile Arg Tyr

595 600 605

Gly Asp Pro Ala His Leu His Glu Ile Ala Lys Asn Glu Ala Val Val

610 615 620

Lys Phe Val Leu Gly Arg Ile Ala Asp Ile Gln Lys Lys Gln Gly Gln

625 630 635 640

Asn Gly Lys Asn Gln Ile Asp Arg Tyr Tyr Glu Thr Cys Ile Gly Lys

645 650 655

Asp Lys Gly Lys Ser Val Ser Glu Lys Val Asp Ala Leu Thr Lys Ile

660 665 670

Ile Thr Gly Met Asn Tyr Asp Gln Phe Asp Lys Lys Arg Ser Val Ile

675 680 685

Glu Asp Thr Gly Arg Glu Asn Ala Glu Arg Glu Lys Phe Lys Lys Ile

690 695 700

Ile Ser Leu Tyr Leu Thr Val Ile Tyr His Ile Leu Lys Asn Ile Val

705 710 715 720

Asn Ile Asn Ala Arg Tyr Val Ile Gly Phe His Cys Val Glu Arg Asp

725 730 735

Ala Gln Leu Tyr Lys Glu Lys Gly Tyr Asp Ile Asn Leu Lys Lys Leu

740 745 750

Glu Glu Lys Gly Phe Ser Ser Val Thr Lys Leu Cys Ala Gly Ile Asp

755 760 765

Glu Thr Ala Pro Asp Lys Arg Lys Asp Val Glu Lys Glu Met Ala Glu

770 775 780

Arg Ala Lys Glu Ser Ile Asp Ser Leu Glu Ser Ala Asn Pro Lys Leu

785 790 795 800

Tyr Ala Asn Tyr Ile Lys Tyr Ser Asp Glu Lys Lys Ala Glu Glu Phe

805 810 815

Thr Arg Gln Ile Asn Arg Glu Lys Ala Lys Thr Ala Leu Asn Ala Tyr

820 825 830

Leu Arg Asn Thr Lys Trp Asn Val Ile Ile Arg Glu Asp Leu Leu Arg

835 840 845

Ile Asp Asn Lys Thr Cys Thr Leu Phe Arg Asn Lys Ala Val His Leu

850 855 860

Glu Val Ala Arg Tyr Val His Ala Tyr Ile Asn Asp Ile Ala Glu Val

865 870 875 880

Asn Ser Tyr Phe Gln Leu Tyr His Tyr Ile Met Gln Arg Ile Ile Met

885 890 895

Asn Glu Arg Tyr Glu Lys Ser Ser Gly Lys Val Ser Glu Tyr Phe Asp

900 905 910

Ala Val Asn Asp Glu Lys Lys Tyr Asn Asp Arg Leu Leu Lys Leu Leu

915 920 925

Cys Val Pro Phe Gly Tyr Cys Ile Pro Arg Phe Lys Asn Leu Ser Ile

930 935 940

Glu Ala Leu Phe Asp Arg Asn Glu Ala Ala Lys Phe Asp Lys Glu Lys

945 950 955 960

Lys Lys Val Ser Gly Asn Ser

965

<210> 14

<211> 141

<212> DNA

<213> Parvo-like virus

<400> 14

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc t 141

<210> 15

<211> 141

<212> DNA

<213> Parvo-like virus

<400> 15

aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60

ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120

gagcgcgcag ctgcctgcag g 141

Claims

1. A cancer cell targeting circuit group comprising a first targeting gene circuit and a second targeting gene circuit used in parallel;

the second guide gene circuit at least comprises a 3'UTR segment, an L7Ae sequence, a negative promoter, a U6 promoter, a gRNA sequence, a second positive promoter, a regulating RNA sequence, a CasRx sequence and a 3' UTR segment which are connected in sequence;

and microRNA sequences are inserted into the 3' UTR sections, and the microRNAs come from cancer cells.

2. The set of cancer cell targeting circuits according to claim 1, wherein said regulatory RNA sequence is a kink-turn sequence and said counter-regulatory sequence is an Anti-kink-turn sequence.

3. The cancer cell targeting circuit of claim 1 further comprising a regulatory RNA sequence, a pre-tRNA sequence and a gRNA sequence connected in sequence between said second forward promoter and said counter-regulatory sequence of said first targeting gene circuit.

4. The cancer cell targeting circuit of claim 3 wherein the first gene targeting circuit has a length of 6kb or less.

5. The cancer cell targeting circuit of claim 1 wherein the second gene targeting circuit has a length of 5kb or less.

6. The cancer cell targeting circuit of claim 5 wherein said second gene targeting circuit has a length of 4.4kb or less.

7. The cancer cell targeting circuit of claim 1 wherein said microRNA is specifically highly expressed in said cancer cell.

8. The cancer cell targeting circuit group of claim 1, wherein said L7Ae sequence is set forth in SEQ ID No.1, said first forward promoter, said second forward promoter sequence is set forth in any one of SEQ ID No.2 to SEQ ID No.4, and said negative promoter sequence is set forth in SEQ ID No. 5.

9. Use of the cancer cell targeting circuit panel according to any one of claims 1 to 8 for the preparation of a cancer cell targeting vector.

10. The use according to claim 9, wherein the cancer cell targeting vector comprises the cancer cell targeting circuit according to any one of claims 1 to 8 inserted between the 5'ITR inverted terminal repeat and the 3' ITR inverted terminal repeat of the adeno-associated viral vector.