CN115820580A

CN115820580A - Expression and purification method of active recombinant hTET2 protein

Info

Publication number: CN115820580A
Application number: CN202211051431.1A
Authority: CN
Inventors: 周雪莉; 赵中梳; 熊章万; 鲁俊超; 柴智; 张福城
Original assignee: Wuhan Abclonal Inc
Current assignee: Wuhan Abclonal Inc
Priority date: 2022-08-31
Filing date: 2022-08-31
Publication date: 2023-03-21

Abstract

The invention provides an expression and purification method of an active recombinant hTET2 protein, which is characterized in that a gene encoding an active sequence of the hTET2 protein is selected, and a gene encoding a polypeptide sequence DYKDDDDK is added at the N end of the gene. Transferring the target gene into HEK293 cells to heterologously express recombinant hTET2 protein, breaking the cells by ultrasonic, and performing affinity purification by a DYKDDDDK antibody coupling chromatographic column to obtain the active hTET2 protein with the conversion rate of more than 98 percent verified by an EM-Seq method.

Description

Expression and purification method of active recombinant hTET2 protein

Technical Field

The invention relates to the technical field of protein purification engineering, in particular to an expression and purification method of high-activity recombinant hTET2 protein.

Background

Genomic methylation cannot be detected by conventional PCR. Currently, the mainstream methylation sequencing method is a sequencing method derived after processing DNA by Bisulfite (BS). Bisulfite sequencing (BS-Seq) can deaminate unmethylated cytosine (C) to uracil (U), while methylated cytosine is not deaminated and remains (5 mC). In the subsequent sequencing process, U is detected as T,5mC is detected as C, and the sequencing result is compared with the sequencing result which is not treated by sulfite, so that the methylated locus can be obtained. However, the BS-Seq also has the following disadvantages: (1) Bisulfite is extremely destructive, degrading 99% of the substrate that is contacted, and therefore not suitable for rare samples. (2) The method of BS-Seq cannot distinguish 5-methylcytosine (5 mC) and its oxidation product 5-hydroxymethylcytosine (5-hmC).

The TET (Ten-Eleven-transfer) protein is a dioxygenase which depends on alpha-ketoglutarate and Fe2+ to exert catalytic activity in organisms, and TET family proteins are widely distributed in living trees and comprise anomala heteroloba Naegleria gruber. In humans and mice, TET proteins can catalyze the sequential oxidation of 5-methylcytosine (5 mC) to 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC), 5-carboxymethylcytosine (5-caC), and the bases of 5fC and 5caC can be cleaved by Thymine DNA Glycosylase (TDG). TET protein is an important enzyme in DNA demethylation. The characteristic of the TET protein enables the TET protein to have a very large application prospect in the methylation sequencing aspect of tumor early screening genome.

The current research shows that: the human TET2 protein (abbreviated as "hTET 2") is 2002 amino acid residues in full length, and comprises a DSBH domain, a cysteine-rich (Cys-rich) domain and three Zinc fingers. The DSBH domain can bind alpha-ketoglutarate (alpha-Ketoglutaric acid) and Fe ²⁺ Oxidizing 5 mC; cysteine-rich (Cys-rich) domains may help stabilize DSBH and 5mC structure; three Zinc fingers link the DSBH and Cys-rich domains.

However, abnormal gene expression caused by demethylation of the hTET2 protein obtained in the prior stage can poison cells, so that the expression and purification of the high-conversion-rate active hTET2 protein become a great problem.

Disclosure of Invention

Therefore, a method for expressing and purifying the recombinant hTET2 protein is needed, the hTET2 protein with high conversion rate and activity can be obtained, and the method is suitable for sequencing application of 5mC demethylation reaction.

The invention adopts the following technical scheme:

the invention provides an active recombinant hTET2 protein, the sequence of which is shown in SEQ ID NO. 1.

The invention also provides a gene for coding the active recombinant hTET2 protein, and the sequence of the gene is shown as SEQ ID NO. 2.

The invention also provides an expression and purification method of the active recombinant hTET2 protein, which comprises the following steps: synthesizing the gene of the recombinant hTET2 protein, and inserting the gene into a vector pcDNA3.1 to obtain a recombinant plasmid pcDNA3.1-hTET2; transferring the recombinant plasmid pcDNA3.1-hTET2 into HEK293F cells, and culturing until the cell viability is lower than 70 percent to obtain cell culture; carrying out ultrasonic lysis on cells, and centrifuging to obtain supernatant; carrying out affinity chromatography on the supernatant, dialyzing and desalting to obtain a crude purified product of the recombinant hTET2 protein; further carrying out ion exchange chromatography on the crude protein purification product to obtain a recombinant hTET2 protein essence purification product; dialyzing the purified product of the recombinant hTET2 protamine, ultrafiltering, concentrating and packaging to obtain the recombinant hTET2 protamine.

In some of these embodiments, the process parameters for ultrasonic lysis are: the power is 250W, the time is 5min, the time is 3s/3s, and the adopted bacteria-breaking liquid is as follows: 50mM Tris-HCl pH7.5, 300mM NaCl,0.1 × cOmplete TM Protease Inhibitor cocktail,0.1mM AEBSF,1% Triton X-100.

In some of these embodiments, the process parameters for affinity chromatography are: the washing solution used for washing the hybrid protein is Tris-HCl buffer solution containing 300mM NaCl and having pH of 7.5, and the eluent for eluting the target protein is HEPES buffer solution containing 300mM NaCl,0.1mg/mL synthetic polypeptide DYKDDDDK,0.1 x cOmplete TM Protease Inhibitor Cocktail,0.1mM AEBSF and having pH of 8.0; desalting buffer used for dialysis desalting was HEPES buffer containing 50mM NaCl and having pH of 8.0.

In some of these embodiments, the process steps of ion exchange chromatography are: flushing the hybrid protein by using HEPES buffer solution containing 50mM NaCl,10% glycerol and pH being 8.0; and then eluting sequentially by using an Elution Buffer A, an Elution Buffer B and an Elution Buffer C, wherein the Elution Buffer A is an HEPES Buffer solution containing 150mM NaCl and 10% glycerol and having a pH value of 8.0, the Elution Buffer B is an HEPES Buffer solution containing 300mM NaCl and 10% glycerol and having a pH value of 8.0, and the Elution Buffer C is an HEPES Buffer solution containing 500mM NaCl and 10% glycerol and having a pH value of 8.0, and collecting a sample containing the target protein.

In some embodiments, the step of dialyzing the refined recombinant hTET2 protein product is performed using a desalting buffer which is Tris HCl buffer containing 200mM NaCl,50% Glycerol, 1mM TCEP, and pH 7.5.

In some of these examples, the ultrafiltration concentration was performed using a 30kDa ultrafiltration tube, centrifugation, and concentration to a protein concentration of 4mg/mL.

The invention also provides the application of the active recombinant hTET2 protein or the recombinant hTET2 protein prepared by the expression and purification method in methylation sequencing.

Compared with the prior art, the invention has the beneficial effects that:

the recombinant hTET2 protein is formed by screening an active sequence of the hTET2 protein and a specific sequence, an encoding gene is synthesized, heterologous expression and protein intracellular expression are carried out through HEK293 cells, the cells are crushed through ultrasound, and then affinity purification is carried out through a DYKDDDDK antibody coupling chromatographic column, so that the active hTET2 protein with the transformation rate of more than 98 percent verified by an EM-Seq method is obtained.

Drawings

FIG. 1 is a map of recombinant expression plasmid pcDNA3.1-hTET2 in example 1.

FIG. 2 is a WB detection chart in example 2.

FIG. 3 is an SDS-PAGE image of affinity chromatography in example 2.

FIG. 4 is an SDS-PAGE image of ion exchange chromatography in example 2.

FIG. 5 is an SDS-PAGE pattern of affinity chromatography in comparative example 1.

FIG. 6 is an SDS-PAGE pattern of ion exchange chromatography in comparative example 1.

Detailed Description

The present invention is further described in detail below with reference to specific examples so that those skilled in the art can more clearly understand the present invention.

The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by a person skilled in the art based on the specific embodiments of the present invention without any inventive step are within the scope of the present invention.

In the examples of the present invention, all the raw material components are commercially available products well known to those skilled in the art unless otherwise specified; in the examples of the present invention, unless otherwise specified, all technical means used are conventional means well known to those skilled in the art.

The invention screens the Gene of the active sequence (Asp 1129-Ser 1480) & (GGGGSGGGGSGGS) & (Asp 1844-Gly 1936) of the hTET2 protein (Gene ID: 54790) and adds a Gene of the coding polypeptide sequence DYKDDDDK at the N terminal for affinity purification after the expression of the recombinant hTET2 protein.

The sequence of the active recombinant hTET2 protein is as follows:

DFPSCRCVEQIIEKDEGPFYTHLGAGPNVAAIREIMEERFGQKGKAIRIERVIYTGKEGKSSQGCPIAKWVVRRSSSEEKLLCLVRERAGHTCEAAVIVILILVWEGIPLSLADKLYSELTETLRKYGTLTNRRCALNEERTCACQGLDPETCGASFSFGCSWSMYYNGCKFARSKIPRKFKLLGDDPKEEEKLESHLQNLSTLMAPTYKKLAPDAYNNQIEYEHRAPECRLGLKEGRPFSGVTACLDFCAHAHRDLHNMQNGSTLVCTLTREDNREFGGKPEDEQLHVLPLYKVSDVDEFGSVEAQEEKKRSGAIQVLSSFRRKVRMLAEPVKTCRQRKLEAKKAAAEKLSGGGGSGGGGSGGGGSDEVWSDSEQSFLDPDIGGVAVAPTHGSILIECAKRELHATTPLKNPNRNHPTRISLVFYQHKSMNEPKHGLALWEAKMAEKAREKEEECEKYG(SEQ ID NO.1)。

the gene sequence encoding active recombinant hTET2 protein is:

GATTTCCCATCTTGCAGATGTGTAGAGCAAATTATTGAAAAAGATGAAGGTCCTTTTTATACCCATCTAGGAGCAGGTCCTAATGTGGCAGCTATTAGAGAAATCATGGAAGAAAGGTTTGGACAGAAGGGTAAAGCTATTAGGATTGAAAGAGTCATCTATACTGGTAAAGAAGGCAAAAGTTCTCAGGGATGTCCTATTGCTAAGTGGGTGGTTCGCAGAAGCAGCAGTGAAGAGAAGCTACTGTGTTTGGTGCGGGAGCGAGCTGGCCACACCTGTGAGGCTGCAGTGATTGTGATTCTCATCCTGGTGTGGGAAGGAATCCCGCTGTCTCTGGCTGACAAACTCTACTCGGAGCTTACCGAGACGCTGAGGAAATACGGCACGCTCACCAATCGCCGGTGTGCCTTGAATGAAGAGAGAACTTGCGCCTGTCAGGGGCTGGATCCAGAAACCTGTGGTGCCTCCTTCTCTTTTGGTTGTTCATGGAGCATGTACTACAATGGATGTAAGTTTGCCAGAAGCAAGATCCCAAGGAAGTTTAAGCTGCTTGGGGATGACCCAAAAGAGGAAGAGAAACTGGAGTCTCATTTGCAAAACCTGTCCACTCTTATGGCACCAACATATAAGAAACTTGCACCTGATGCATATAATAATCAGATTGAATATGAACACAGAGCACCAGAGTGCCGTCTGGGTCTGAAGGAAGGCCGTCCATTCTCAGGGGTCACTGCATGTTTGGACTTCTGTGCTCATGCCCACAGAGACTTGCACAACATGCAGAATGGCAGCACATTGGTATGCACTCTCACTAGAGAAGACAATCGAGAATTTGGAGGAAAACCTGAGGATGAGCAGCTTCACGTTCTGCCTTTATACAAAGTCTCTGACGTGGATGAGTTTGGGAGTGTGGAAGCTCAGGAGGAGAAAAAACGGAGTGGTGCCATTCAGGTACTGAGTTCTTTTCGGCGAAAAGTCAGGATGTTAGCAGAGCCAGTCAAGACTTGCCGACAAAGGAAACTAGAAGCCAAGAAAGCTGCAGCTGAAAAGCTTTCCGGTGGAGGCGGAAGTGGAGGCGGGGGCTCAGGGGGAGGTGGTTCTGATGAGGTCTGGTCAGACAGCGAGCAGAGCTTTCTGGATCCTGACATTGGGGGAGTGGCCGTGGCTCCAACTCATGGGTCAATTCTCATTGAGTGTGCAAAGCGTGAGCTGCATGCCACAACCCCTTTAAAGAATCCCAATAGGAATCACCCCACCAGGATCTCCCTCGTCTTTTACCAGCATAAGAGCATGAATGAGCCAAAACATGGCTTGGCTCTTTGGGAAGCCAAAATGGCTGAAAAAGCCCGTGAGAAAGAGGAAGAGTGTGAAAAGTATGGC(SEQ ID NO.2)。

heterologously expressing a recombinant hTET2 protein in HEK293 cells by a target gene, expressing the protein in cells, breaking the cells by ultrasonic waves, and performing affinity purification by a DYKDDDDK antibody coupling chromatographic column to obtain the active hTET2 protein with the conversion rate of more than 98 percent verified by EM-Seq.

The following examples illustrate:

example 1

This example provides a method for constructing a recombinant plasmid, comprising the following steps:

s1, gene synthesis and clone construction:

the gene sequence of the coding recombinant hTET2 protein is synthesized by general biology (Anhui) corporation (called Anhui general for short in the follow-up) and inserted into a vector pcDNA3.1 (Invitrogen) to form a recombinant expression plasmid pcDNA3.1-hTET2, the processes are all completed by Anhui general, and the recombinant plasmid and a detection report are returned. The plasmid map is shown in FIG. 1.

S2, extracting the plasmids:

the recombinant plasmid pcDNA3.1-hTET2 obtained in step S1 was transformed into a competent cell of DH5 alpha (cat # CD001, E.warrior Bettack) to obtain a single colony.

Selecting a single colony to be cultured in an LB culture medium for overnight, and extracting by using an endotoxin-free plasmid small-extraction medium-amount kit (the product number is DP118-02, beijing Tiangen biochemistry) to obtain the endotoxin-free pcDNA3.1-hTET2 recombinant plasmid. The method comprises the following specific steps:

(1) And (3) transformation: pre-cooled 50 μ L DH5 alpha competent cell is taken, 1 μ L endotoxin-free pcDNA3.1-hTET2 recombinant plasmid is added, ice bath treatment is carried out for 30min, and then hot water bath at 42 ℃ is carried out for 90s (strictly controlled time) and ice bath treatment is carried out for 5min; adding 500 μ L of non-resistant LB culture medium into the transformation system on a super clean bench, and recovering in a 220rmp shaking table at 37 deg.C for 45min; and (3) centrifuging at 6000rmp for 1min, collecting thalli, reserving 200 mu L of bacterial liquid, sucking and uniformly mixing the bacterial liquid by using a pipette, adding the bacterial liquid into an ampicillin resistant plate, pouring 4-6 glass beads, slightly shaking the plate to uniformly coat the bacterial liquid, pouring off the glass beads, and inversely placing the plate in an incubator at 37 ℃ for overnight culture.

(2) Extracting endotoxin-free plasmid: single colonies were picked from the above plates and cultured overnight in 10mL of LB medium containing ampicillin resistance. Centrifuging at 12000rpm for 10min in the next morning, and extracting the recombinant plasmid according to the specification of the endotoxin-free plasmid miniprep medium-volume kit to obtain endotoxin-free recombinant pcDNA3.1-hTET2 plasmid with the final concentration of 1740 ng/uL.

Example 2

This embodiment provides a method for expressing and purifying an active recombinant hTET2 protein, comprising the following steps:

s1, transient transfection:

the endotoxin-free recombinant pcDNA3.1-hTET2 plasmid prepared in example 1 was transferred into HEK293F cells by the following procedure:

(1) Before transfection, HEK293 cells were subcultured and expanded until cell densities of about 3-4X 10 were reached ⁶ The survival rate of each living cell/mL is more than or equal to 95 percent.

(2) The day before transfection (day-1), the cells in step (1) were seeded at the recommended cell density and the cells were allowed to grow overnight. According to the ratio of 1.5-1.8X 10 ⁶ Cell density per mL.

(3) On the day of transfection (day 0), data including cell density and viability were obtained. The cells should reach the suggested density. The cell viability for transfection should be greater than or equal to 95%. If the cell density is too high, please use fresh medium and dilute the cells to the recommended cell density. Prior to transfection, cell density was adjusted to 3.0X 10 ⁶ one/mL, volume adjusted to 25.5mL. Note that: discarding the remaining cells; conventional subculture with high density cells was not repeated.

(4) Plasmid 30ug of DNA was diluted with 1.5ml of Opti-MEM medium. Mix by rotating and/or inverting the tube.

(5) The PEIMAX tube was gently inverted 4 to 5 times to mix well. And 75. Mu.L of PEIMAX (1 mg/mL, pH 7.1) was diluted with 1.5mL of Opti-MEM medium. Mixing is performed by rotating and/or inverting the tube.

(6) The diluted PEIMAX is added to the diluted recombinant plasmid DNA, and the tube is rotated and/or inverted or gently pipetted 2 to 3 times for mixing. The complex was incubated at room temperature for about 20 minutes.

(7) The complex was slowly added to the cell shake flask of step (3), and the flask was gently shaken during the addition.

(8) The shake flask was returned to the 37 ℃ incubator for cultivation as follows: 125rpm,8% CO ₂ 37 ℃ and 95% humidity.

(9) On

day

1, 3% (v/v) 293-Profeed (feed), 3g/L Glucose and 1mM VPA (sodium valproate) were added to the flask 16-22 hours after transfection, and the flask was gently shaken during the addition. The flask was returned to the 37 ℃ incubator.

(10) On day 3, glucose concentration was maintained above 4g/L during transient expression. Cells were harvested when the cell viability was below 70%.

1.5mL of the first feed is added after 16-20 h of transfection; cell viability was determined for 3 consecutive days as follows:

number of days	0d (day of transfection)	1d	2d	3d
					Rate of cell viability	99.24％	98.44％	90.44％	68.91％

The transfected cells were harvested.

S2, WB detection:

(1) 5. Mu.L of the supernatant was subjected to SDS PAGE. Electrophoresis adopts a constant voltage mode: 5% concentrated gel 80V, when marker begins to separate for about 25min, adjust to 120V, bromphenol blue to the bottom of the gel to terminate electrophoresis.

(2) Film transfer:

the assembly sequence is as follows: the black side (negative electrode) of the rotating film clamp, the spongy cushion, the 3 layers of filter paper, the glue, the film, the 3 layers of filter paper, the spongy cushion and the red side (positive electrode) of the rotating film clamp. Film transfer time: 200mA, 90-180 min.

(3) And (3) sealing: labeling and washing off the membrane transfer solution after the membrane transfer is finished (TBST, 5min,2 times); putting the cleaned membrane into a container containing 3% skimmed milk (prepared by TBST), and sealing at room temperature for 60-90 min;

(4) 6His-tag primary antibody incubation: after the sealing is completed, the sealing liquid is poured off. Primary antibody solution diluted with 3% skim milk (TBST formulation) 1 at 7000 was added, gently shaken on a shaker, and incubated at room temperature for 2h or overnight at 4 ℃ (incubation at room temperature for 15-30 min after incubation at 4 ℃). After the primary antibody incubation is finished, pouring out the primary antibody solution; the membrane was rinsed 4 times 5min each with TBST.

(5) And (3) secondary antibody incubation: before the primary antibody incubation was completed, the enzyme-labeled secondary antibody 1:5000 dilution to the amount required for the experiment (TBST dilution). And (3) putting the cleaned membrane into a container containing a secondary antibody solution, slowly shaking on a shaking table, and incubating at room temperature for 60-80 min. After the secondary antibody incubation is finished, pouring out the secondary antibody solution; the membrane was rinsed 4 times 5min each with TBST.

(6) Exposure: the membrane was removed from the TBST with forceps, drained appropriately, and placed on a gel tray. Mixing with equal volume of ECL Solution I and Solution II, adding onto the membrane, and covering completely. The substrate reacts with the membrane for about 30 seconds and is placed in a chemiluminescent imaging system. The exposure times were set at 3s, 10s, 30s, 60s, and 120s.

(7) And (4) analyzing results:

WB results are shown in FIG. 1. As can be seen from fig. 1, recombinant human htert 2 protein is mainly expressed in the soluble supernatant.

In the embodiment, HEK293F is taken as a host cell, and the recombinant plasmid pcDNA3.1-hTET2 is introduced into the host cell in a transient transfection mode to obtain a cell for expressing recombinant hTET2 protein. The method has the effects of short transfection period and rapid acquisition of target protein, and can be applied to exploration in the research and development stage and large-scale high-throughput protein screening.

S3, protein purification:

(1) Cell lysis

Ultrasonic cracking: 250W power, 5min time, 3s/3s (3 s ultrasound, 3s stop), twice.

Bacteria liquid breaking: 50mM Tris-HCl pH7.5, 300mM Nac,0.1 × cOmplete TM Protease Inhibitor cocktail,0.1mM AEBSF,1% Triton X-100.

After the bacteria are broken, the mixture is centrifuged at 12000rpm and 4 ℃ for 15min, and the supernatant is taken.

Generally, every two tubes of cells are resuspended by 30ml of lysis solution and subjected to ultrasonic treatment, the supernatant obtained by the first centrifugation can be poured into one more centrifuge tube during centrifugation, and the supernatant is poured into a new centrifuge tube after the second centrifugation.

(2) Affinity chromatography

Matrix: SIGMA Anti-DYKDDDDK affinity purification gel.

And (3) incubation: placing on a rotary incubator, rotating and incubating at 20rpm and 4 ℃ for 4h.

A. Column flow through:

after the incubation, the tube was trimmed and centrifuged at 600rpm for 10min at 4 ℃. And pouring the centrifuged supernatant into a new centrifuge tube to obtain the flow-through. While leaving about 5mL of supernatant for suspending the matrix, the matrix was transferred to a purification cartridge and the flow-through (FT) was collected after the flow-through was completed.

B. Washing impurities and eluting

a. 10mL Washing Buffer was added to the purification column tube to wash off the contaminating proteins in the matrix. Gravity flow, the effluent was collected with a sterilized 5mL EP tube that needed to be inserted on ice to maintain a low temperature. After the elution is finished, the column is detected by G250 (100. Mu.L of G250 is put into a 96-well plate, 10. Mu.L of the eluent which is dripping out is added), if the G250 turns blue, 5mL of Washing Buffer is added to wash the column continuously until the G250 does not turn blue, and the Washing Buffer pre-elution is finished.

b. Add 1mL of Elution Buffer column and wash down the matrix-bound protein. Gravity flow, collecting the effluent with 1.5mL EP tube without endotoxin, placing the tube on ice box to keep low temperature, detecting with G250 after flowing out (taking 100. Mu.L G250 in 96-well plate, adding 10. Mu.L of dripping eluent), if G250 turns blue, continuing to elute until G250 does not turn blue, ending Elution Buffer Elution.

c. The collected flow-through was sampled with an eluent, typically a 6 × loading buffer, i.e., 20 μ L protein +5 μ L6 × loading buffer, and subjected to SDS-PAGE. The results are shown in FIG. 3: the purity of hTET2 obtained after elution by affinity chromatography is pure.

Wherein, the buffer solution used in the affinity chromatography process is as follows:

Balance buffer：50mM Tris-HCl，300mM NaCl，pH 7.5。

Washing buffer：50mM Tris-HCl，300mM NaCl，pH 7.5。

elution Buffer:20mM HEPES pH8.0, 300mM NaCl,0.1mg/mL of the synthetic polypeptide DYKDDDDK, 0.1. Mu.cOmplete (TM) Protease Inhibitor Cocktail,0.1mM AEBSF.

C. Collecting the flow-through liquid in the step a, repeating the step (2) twice. Combining the proteins obtained by the three affinities, and performing ion exchange.

(3) Ion exchange chromatography (Q column)

A. Desalting:

and (4) taking a proper dialysis bag, washing the bag clean, and adding the protein collected in the previous step into the dialysis bag. The dialysis bag was placed in a prepared desalting buffer (20mM HEPES,50mM NaCl, pH 8.0), and 50mL of the sample was dialyzed at 4 ℃ for 2 hours, typically using 2L of the buffer.

B. And (3) balancing filling and incubation:

the matrix is equilibrated with a Binding Buffer, typically 6 to 10 column volumes. The well balanced matrix and the desalted protein solution are mixed in a centrifuge tube, the centrifuge tube is placed on a rotary incubator, and the culture is incubated at 20rpm and 4 ℃ for 40min.

C. Adding Binding Buffer with 10-15 times of column volume into a purification column tube, washing off impure protein with slightly weak Binding capacity on the matrix, controlling the flow rate to be 2mL/min, detecting with G250 after the flow is finished (taking 100 microliter G250 in a 96-well plate, adding 10 microliter of eluent which is dripping), if G250 turns blue, continuing to elute until G250 does not turn blue, collecting the effluent liquid, and the collecting tube needs to be inserted on ice to keep low temperature. The column was washed with Elution Buffer A (Elution Buffer A) at a controlled flow rate of 0.6mL/min, the effluent was collected in endotoxin-free tubes, the effluent was collected in one EP tube per column volume (collection tube was placed on an ice-box and kept at low temperature), and after the flow was completed, the column was checked with G250 (100. Mu.L of G250 was placed in a 96-well plate and 10. Mu.L of the eluent that was being dripped was added), and if G250 turned blue, the Elution was continued until G250 did not turn blue.

Eluting the column with Elution Buffer B (Elution Buffer B) at a flow rate of 0.6mL/min, collecting the eluate with endotoxin-free tubes, collecting the eluate in each column volume in an EP tube (the collection tube is placed on an ice box and kept at a low temperature), detecting with G250 after the flow is over (100. Mu.L of G250 is put in a 96-well plate, and 10. Mu.L of the eluate which is dripping out is added), and if G250 turns blue, continuing the Elution until G250 does not turn blue.

Eluting the column with Elution Buffer C (Elution Buffer C), controlling the flow rate at 0.6mL/min, collecting the eluate with endotoxin-free tubes, collecting the eluate in each column volume in an EP tube (the collection tube is placed on an ice box and kept at low temperature), detecting with G250 after the flow is over (taking 100. Mu.L of G250 in a 96-well plate, adding 10. Mu.L of the eluate being dripped), and if G250 turns blue, continuing the Elution until G250 does not turn blue.

The buffers used for ion exchange were as follows:

Balance buffer：20mM HEPES，50mM NaCl，pH 8.0。

Binding Buffer：20mM HEPES，50mM NaCl，pH 8.0。

elution Buffer A:2 mM HEPES,150mM NaCl,10% glycerol, pH8.0.

Elution Buffer B:20mM HEPES,300mM NaCl,10% glycerol, pH8.0.

Elution Buffer C:20mM HEPES,500mM NaCl,10% glycerol, pH8.0.

The eluted sample was collected and prepared as a 6 × loading buffer sample, i.e., 20 μ L protein +5 μ L6 × loading buffer, and subjected to SDS-PAGE.

The results are shown in FIG. 4: after the Q column ion exchange chromatography, the purity of the protein is improved to a certain extent.

(4) Concentration of dialysis liquid

A. The samples purified by ion exchange chromatography in the above step were collected and dialyzed to final buffer (20 mM Tris-HCl,200mM NaCl,50% Glycerol, PH7.5,1mM TCEP), typically 10mL of the samples were dialyzed using 1L of buffer, dialyzed at 4 ℃ for 2h, changed the solution once, and dialyzed again for 2h.

B. After liquid changing, the protein is concentrated to 4mg/mL by using a 30kDa ultrafiltration tube, the centrifugation conditions are 4 ℃,3000rpm and 15min/time, and the centrifugation is repeated until the concentration reaches 4mg/mL.

C. Concentrating, packaging with 100 μ L/tube, and freezing at-80 deg.C.

Comparative example 1

Referring to the above experimental examples, the expression and purification of hTET2 with His-tag in this example resulted in a protein conversion efficiency of only about 50%.

The amino acid and nucleic acid sequences of this project were identical to the above process, except that the previous DYKDDDDK sequence was replaced with a His-tag, i.e., 6 histidine residues. The expression host has the same expression mode and the purification process is Ni ²⁺ Affinity chromatography and Q column ion exchange chromatography; the cell lysis method and Q-column ion exchange chromatography are the same as the above method, and the buffer solution and method used for Ni2+ affinity chromatography are as follows:

matrix: GE Ni-NTA affinity purification matrix

S1, column flow-through: after the incubation, the tube was trimmed and centrifuged at 600rpm for 10min at 4 ℃. And pouring the centrifuged supernatant into a new centrifuge tube to obtain the flow-through. While leaving about 5mL of supernatant for suspending the matrix, the matrix was transferred to a purification cartridge and the flow-through (FT) was collected after the flow-through was completed.

S2, impurity washing and elution:

b. Gradient Elution was performed by adding 1mL of Elution Buffer1/2/3, respectively, and the matrix-bound protein was washed off. Gravity flow, collecting the effluent with 1.5mL EP tube without endotoxin, placing the tube on ice box to keep low temperature, detecting with G250 after flowing out (taking 100. Mu.L G250 in 96-well plate, adding 10. Mu.L of dripping eluent), if G250 turns blue, continuing to elute until G250 does not turn blue, ending Elution Buffer Elution.

The buffers used during affinity chromatography were as follows:

Balance buffer：520mM Tris-HCL,250mM NaCl,10mMImidazole,10％glycerol。

Washing buffer1：20mM Tris-HCL,250mM NaCl,40mMImidazole,10％glycerol。

Elution Buffer1：20mM Tris-HCL,250mM NaCl,80mMImidazole,10％glycerol。

Elution Buffer2：20mM Tris-HCL,250mM NaCl,250mMImidazole,10％glycerol。

Elution Buffer3：20mM Tris-HCL,250mM NaCl,500mMImidazole,10％glycerol。

c. the collected flow-through was sampled with an eluent, typically a 6 × loading buffer, i.e., 20 μ L protein +5 μ L6 × loading buffer, and subjected to SDS-PAGE.

The results are shown in FIG. 5: ni warp ²⁺ The purity of the protein after affinity chromatography is general, and a more obvious hybrid band is arranged above the target band.

And S3, collecting the flow-through liquid in the step a, and repeating the affinity chromatography step once. And combining the proteins obtained by twice affinity to perform ion exchange. The ion exchange procedure and the buffer used were the same as before.

The results are shown in FIG. 6: the purity of the protein did not increase significantly after ion exchange chromatography.

Example 3 validation of transformation efficiency

(1) Sample preparation

A. The sample used in this experiment was a mixed sample: human Blood gDNA (STB 0092, 20201124) was mixed with 1% of lambda DNA (dam-, dcm-) (Takara No. 3019) and 0.1% of Methylated pUC19DNA (ZYMO RESEARCH # D0517).

B. Diluting the mixed sample to proper concentration with TE, and mechanically breaking to about 200-300 bp; further purified by 1.8 Xmagnetic beads, and then eluted with water or 10mM Tris pH8.0.

C. 200ng of single conversion reaction is charged.

(2) Base conversion

A. Base conversion was performed using enzymatic conversion.

B. Use of

Enzymic Conversion was carried out using enzyme Conversion method-seq Conversion Module (E7125), and the Conversion protocol was referred to the Protocols of the kit.

The concentration of the transformed product was measured using Qubit and quality control was performed using 2100.

(3) Library construction

All products of a single transformation were subjected to library construction using the Scale ssDNA-seq Lib Prep Kit for Illumina V2 (RK 20228), and the number of PCR cycles was set to 9 by the library construction procedure with reference to the Protocols of the Kit.

The resulting library was assayed for concentration using Qubit and quality using Qseq.

(4) Sequencing analysis

Single library sequencing data volume 1G data, through data analysis to assess transformation efficiency.

The sequencing analysis results were as follows:

library yield

Test set	Conversion reagent	Library concentration (ng/. Mu.L)
			Control 1	TET2-NEB	52.0
Test 7	TET2-9621011101 (obtained by purification in example 2)	29.2
			Test 8	TET2-9621011901 (purified in comparative example 1)	54.0

Basic data analysis results

Transformation efficiency of Unmethylated Lambda DNA reference

Conversion reagent	TET2-NEB	TET2-9621011101	TET2-9621011901
				Clean_Reads	4435224	8808802	7671930
Uniqmap Reads	14256	30286	46338
				MultiMap Reads	0	0	0
UnMapp Reads	4420968	8778516	7625592
				Mapping_Rate	0.32％	0.34％	0.6％
Convert	99.39％	99.36％	99.60％

Efficiency of CpG methylated pUC19 internal reference transformation

Conversion reagent	TET2-NEB	TET2-9621011101	TET2-9621011901
				Clean_Reads	4435224	9668710	7671930
Uniqmap Reads	2294	36542	256
				MultiMap Reads	0	0	0
UnMapp Reads	432930	9662168	7671674
				Mapping_Rate	0.05％	0.07％	0
Convert	99.50％	98.1％	49.8％

As can be seen from the above table, the conversion of the recombinant hTET2 protein prepared in example 2 was as high as 98.1% compared to the conversion of the active protein prepared in comparative example 1.

It should be noted that the above examples are only for further illustration and description of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment, and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. The sequence of the active recombinant hTET2 protein is shown in SEQ ID NO. 1.

2. A gene encoding the active recombinant hTET2 protein of claim 1, whose sequence is shown in SEQ ID No. 2.

3. A method for expressing and purifying an active recombinant hTET2 protein according to claim 1, comprising the steps of:

synthesizing the gene of claim 2 for encoding the recombinant hTET2 protein of claim 1, inserting into the vector pcDNA3.1 to obtain a recombinant plasmid pcDNA3.1-hTET2;

transferring the recombinant plasmid pcDNA3.1-hTET2 into HEK293F cells, and culturing until the cell viability is lower than 70 percent to obtain cell culture;

carrying out ultrasonic lysis on cells, and centrifuging to obtain supernatant;

carrying out affinity chromatography on the supernatant, dialyzing and desalting to obtain a crude purified product of the recombinant hTET2 protein;

further carrying out ion exchange chromatography on the crude protein purification product to obtain a recombinant hTET2 protein essence purification product;

dialyzing the purified product of the recombinant hTET2 protamine, ultrafiltering, concentrating and packaging to obtain the recombinant hTET2 protamine.

4. The method for expressing and purifying recombinant hTET2 protein according to claim 3, characterized in that the technological parameters of ultrasonic cleavage are as follows: the power is 250W, the time is 5min, the time is 3s/3s, and the adopted bacteria breaking liquid comprises the following components: 50mM Tris-HCl pH7.5, 300mM NaCl,0.1 × cOmplete TM Protease Inhibitor cocktail,0.1mM AEBSF,1% Triton X-100.

5. The method for expressing and purifying recombinant hTET2 protein according to claim 3, wherein the process parameters of affinity chromatography are as follows: the washing solution used for washing the hybrid protein is Tris-HCl buffer solution containing 300mM NaCl and having pH of 7.5, and the eluent for eluting the target protein is HEPES buffer solution containing 300mM NaCl,0.1mg/mL synthetic polypeptide DYKDDDDK,0.1 x cOmplete TM Protease Inhibitor Cocktail,0.1mM AEBSF and having pH of 8.0;

desalting buffer used for dialysis desalting was HEPES buffer containing 50mM NaCl and having pH of 8.0.

6. The method for expressing and purifying recombinant hTET2 protein as claimed in claim 3, characterized in that the process steps of the ion exchange chromatography are as follows:

flushing the hybrid protein with HEPES buffer solution containing 50mM NaCl,10% glycerol and pH 8.0;

and then eluting sequentially by using an Elution Buffer A, an Elution Buffer B and an Elution Buffer C, wherein the Elution Buffer A is an HEPES Buffer solution containing 150mM NaCl and 10% glycerol and having a pH value of 8.0, the Elution Buffer B is an HEPES Buffer solution containing 300mM NaCl and 10% glycerol and having a pH value of 8.0, and the Elution Buffer C is an HEPES Buffer solution containing 500mM NaCl and 10% glycerol and having a pH value of 8.0, and collecting a sample containing the target protein.

7. The method for expressing and purifying recombinant hTET2 protein according to claim 3, characterized in that the step of dialyzing the refined purified product of recombinant hTET2 protein is Tris-HCl buffer containing 200mM NaCl,50% glycerol, 1mM TCEP and pH7.5 using desalting buffer.

8. The method of claim 3 for expression and purification of recombinant hTET2 protein, wherein the ultrafiltration concentration is performed using a 30kDa ultrafiltration tube, centrifugation, and concentration to a protein concentration of 4mg/mL.

9. Use of the recombinant hTET2 protein according to claim 1 or the recombinant hTET2 protein produced by the expression and purification method according to any one of claims 3 to 8 in methylation sequencing.