CN116082456B

CN116082456B - Mutant signal peptide, recombinant vector containing mutant signal peptide and application of mutant signal peptide

Info

Publication number: CN116082456B
Application number: CN202211385590.5A
Authority: CN
Inventors: 余乐; 程威; 刘佩佩; 程昊
Original assignee: Yourui Seth Wuhan Biotechnology Co ltd
Current assignee: Yourui Seth Wuhan Biotechnology Co ltd
Priority date: 2022-11-07
Filing date: 2022-11-07
Publication date: 2023-08-01
Anticipated expiration: 2042-11-07
Also published as: CN116082456A

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a mutant signal peptide, a recombinant vector containing the mutant signal peptide and application thereof. The amino acid sequence of the mutant signal peptide is shown as SEQ ID NO:2. on the basis of a wild type signal peptide, the invention mutates the 2 nd amino acid of the wild type signal peptide from E to K and mutates the 4 th amino acid from D to K to obtain the mutant signal peptide, the positive charge carried by the N end region of the signal peptide is obviously increased, the membrane penetrating capability is strong, the secretory expression of nuclear membrane proteins such as TMEM176B can be realized, the secretory level of the protein is improved, and a reference basis is provided for the signal peptide sequences of secretory expression of other nuclear membrane proteins.

Description

Mutant signal peptide, recombinant vector containing mutant signal peptide and application of mutant signal peptide

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a mutant signal peptide, a recombinant vector containing the mutant signal peptide and application thereof.

Background

The nuclear membrane of eukaryotic cells is a bilayer membranous structure consisting of a nuclear membrane and an outer nuclear membrane, which separates the nucleus from the cytoplasm, protects the genetic material within the nucleus, and maintains the mechanical properties required for normal cell activity. More than 60 nuclear membrane proteins are positioned on the inner nuclear membrane and the outer nuclear membrane, which plays an important role in modifying the nuclear membrane and ensuring the integrity of the nuclear membrane, and the nuclear membrane proteins have important biological significance in aspects of chromatin tissues, gene regulation, signal transduction and the like. It has been found that mutation of genes encoding different nuclear membrane proteins can cause a serious series of nuclear membrane related diseases. Transmembrane protein 176B (TMEM 176B) and transmembrane protein 176A (TMEM 176A) belong to the transmembrane 4A (MS 4A) protein family, both of which have an inhibitory effect on dendritic cell maturation. The expression of TMEM176A and TMEM176B in various tissues of human beings are obviously different, and the expression levels of the TMEM176A and the TMEM176B are obviously related to various tumor tissues, so that the proportion of the TMEM176A and the TMEM176B is expected to become biological markers and treatment targets of lymphomas, melanomas, breast tumors, liver tumors and the like. Despite some progress in the study of nuclear membrane proteins such as TMEM176B and TMEM176A, the physiological function of such proteins has not been elucidated so far. On one hand, the protein is difficult to obtain, separate and purify due to positioning on a nuclear membrane, and on the other hand, the transmembrane structure of the protein prevents the in-vitro recombination of the protein, so that the in-vitro recombination, secretion and expression difficulty of the protein is high, the protein with high quality cannot be obtained, and then related functional research or development of an antibody with diagnostic function cannot be performed. Therefore, the realization of the secretory expression of nuclear membrane proteins by means of genetic engineering and the like is of great importance for the research and application of protein functions.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention provides a mutant signal peptide, a recombinant vector containing the mutant signal peptide and application of the recombinant vector in the field of secretory protein expression, so as to solve the technical problems that nuclear membrane proteins are difficult to secrete and express and high-concentration nuclear membrane proteins cannot be obtained effectively in the prior art.

The invention is realized by the following technical scheme:

in a first aspect, the present invention provides a mutant signal peptide having an amino acid sequence as set forth in SEQ ID NO:2.

in a second aspect the invention provides a polynucleotide encoding a mutant signal peptide as described above.

Further, the polynucleotide has a sequence shown in SEQ ID NO: 3.

In a third aspect the present invention provides a recombinant vector comprising a polynucleotide encoding a mutant signal peptide as described above and comprising a polynucleotide encoding a nuclear membrane protein, said polynucleotide encoding a mutant signal peptide being located immediately 5' to said polynucleotide encoding a nuclear membrane protein.

Further, the nuclear membrane protein is TMEM176B protein 148-208aa, and the DNA sequence of the nuclear membrane protein is shown in SEQ ID NO: shown at 5.

Further, the recombinant vector further comprises a polynucleotide encoding a protein tag, the polynucleotide encoding a protein tag being immediately 3' to the polynucleotide encoding a nuclear membrane protein.

Further, the protein tag comprises mFC and 6 XHis which are connected in sequence, and the DNA sequence of the protein tag is shown in SEQ ID NO: shown at 7.

In a fourth aspect, the present invention provides a method for producing a secreted protein, comprising the steps of:

s1, connecting a polynucleotide sequence for coding mutant signal peptide and a polynucleotide sequence for coding nuclear membrane protein to an expression vector, and obtaining a recombinant vector through sequencing verification;

s2, transfecting the recombinant vector into eukaryotic cells, culturing for a period of time, harvesting the transfected eukaryotic cells, and collecting supernatant for purification to obtain the secreted protein.

Further, in step S1, the DNA sequence encoding the mutant signal peptide is as shown in SEQ ID NO:3, the DNA sequence of the encoded nuclear membrane protein is shown as SEQ ID NO:5, the expression vector comprises pcdna3.4.

Further, in step S2, the recombinant vector is transfected into eukaryotic cells, including HEK293F cells, using transient transfection techniques.

In a fifth aspect, the present invention provides a secreted protein, comprising a nuclear membrane protein and a protein tag, prepared by the method for preparing a secreted protein as described above.

Further, the nuclear membrane protein is TMEM176B protein 148-208aa, and the protein tag comprises mFC and 6 XHis connected in sequence.

The invention has the advantages and positive effects that:

on the basis of a wild type signal peptide, the invention mutates the 2 nd amino acid of the wild type signal peptide from E to K and mutates the 4 th amino acid from D to K to obtain the mutant signal peptide, the positive charge carried by the N end region of the signal peptide is obviously increased, the membrane penetrating capability is strong, the secretory expression of nuclear membrane proteins such as TMEM176B can be realized, the secretory level of the protein is improved, and a reference basis is provided for the signal peptide sequences of secretory expression of other nuclear membrane proteins.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly described below, and it is apparent that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a graph showing the results of colony PCR identification when constructing plasmid 1 according to the embodiment of the present invention;

FIG. 2 is a diagram showing the PCR identification result of the reverse amplification plasmid 1 when constructing the plasmid 2 according to the embodiment of the present invention;

FIG. 3 is a graph showing the time course of cell culture concentration after transfection of eukaryotic cells with plasmid 1 and plasmid 2 according to the examples of the present invention;

FIG. 4 is a graph showing the cell viability over time after transfection of eukaryotic cells with plasmid 1 and plasmid 2 according to the examples of the present invention;

FIG. 5 is a diagram showing the protein expression pattern verified by WB after transfection of eukaryotic cells with plasmid 1 and plasmid 2 according to the examples of the present invention;

FIG. 6 is a diagram showing the purification of proteins after transfection of eukaryotic cells with plasmid 1 according to an embodiment of the present invention;

FIG. 7 is a diagram showing the purification of proteins after transfection of eukaryotic cells with plasmid 2 according to an embodiment of the present invention.

Detailed Description

The present invention will be described in further detail with reference to the following examples, in which the apparatus and reagents used in the respective examples and test examples are commercially available unless otherwise specified, in order to make the objects, technical schemes and advantages of the present invention more apparent. The specific embodiments described herein are to be considered in an illustrative sense only and are not intended to limit the invention.

Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit or scope of the appended claims. It is to be understood that the scope of the invention is not limited to the defined processes, properties or components, as these embodiments, as well as other descriptions, are merely illustrative of specific aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be within the scope of the following claims.

For a better understanding of the present invention, and not to limit its scope, all numbers expressing quantities, percentages, and other values used in the present application are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

In order that the above-recited objects, features and advantages of the present invention will become more readily apparent, a more particular description of the invention briefly described above will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings.

The embodiment of the invention provides a mutant signal peptide, wherein the amino acid sequence of the signal peptide is shown as SEQ ID NO:2.

in the context of the present invention, a "signal peptide" is used to direct the secretory expression of a foreign protein. "secretion" refers to the transport of a protein or peptide molecule outside of a cell after intracellular synthesis.

On the basis of wild signal peptide (the amino acid sequence is shown in SEQ ID NO: 1), the 2 nd amino acid of the wild signal peptide is mutated from E to K and the 4 th amino acid is mutated from D to K, so that the amino acid sequence shown in SEQ ID NO:2, the positive charge of the N-terminal region of the signal peptide is obviously increased, which is beneficial to improving the membrane penetration (negative electricity) capability, and then the secretion capability of the signal peptide can be improved. The mutant signal peptide and nuclear membrane proteins such as TMEM176B protein are fused for expression, experiments prove that the secretion expression of the TMEM176B protein is realized by the wild signal peptide and the mutant signal peptide, wherein the secretion capacity of the mutant signal peptide is stronger, the secretion level result of the signal peptide can be improved by improving the charge of the N end of the signal peptide, the recombinant TMEM176B protein is successfully obtained by verification and affinity purification of Western Blot (WB), the expression quantity is about 247mg/1000mL Cells, the secretion expression quantity is improved by 2.4 times compared with that of the wild signal peptide, and the higher expression quantity can be realized by optimizing the transfection expression technology. Namely, the mutant signal peptide can realize secretory expression of nuclear membrane proteins such as TMEM176B, improve the secretory level of the protein, and provide reference basis for signal peptide sequences of secretory expression of other nuclear membrane proteins.

Another embodiment of the invention provides a polynucleotide encoding a mutant signal peptide as described above.

Alternatively, the DNA sequence of the polynucleotide encoding the mutant signal peptide is obtained by mutating both codon 2 GAA and codon 4 GAC of the wild-type signal peptide to AAA, and specifically, the sequence of the polynucleotide is shown in SEQ ID NO: 3.

Still another embodiment of the present invention provides a recombinant vector comprising a polynucleotide encoding a mutant signal peptide as described above and a polynucleotide encoding a nuclear membrane protein, the polynucleotide encoding the mutant signal peptide being immediately 5' to the polynucleotide encoding the nuclear membrane protein.

The advantages of the recombinant vector over the prior art are the same as those of the mutant signal peptide described above over the prior art, and will not be described in detail herein. The recombinant vector of the invention is expressed in eukaryotic cells, and can obtain high-purity and high-concentration secreted proteins.

Optionally, the nuclear membrane protein is TMEM176B protein, and the DNA sequence of the polynucleotide encoding the TMEM176B protein is as shown in SEQ ID NO:5, which is used for encoding amino acids in a region from 148 th (containing) to 208 th (containing) of TMEM176B protein, wherein the amino acid sequence of the region is shown as SEQ ID NO: 4.

TMEM176B is a four-transmembrane protein belonging to the transmembrane 4A (MS 4A) protein family, comprising four transmembrane domains and an Immunoreceptor Tyrosine Inhibitory Motif (ITIM) at the C-terminus, the amino acid sequence of which is set forth in SEQ ID NO: 14. the nucleotide sequence is shown in SEQ ID NO:15. by analyzing the protein structure and the transmembrane domain, the N end and the C end of the protein are in irregular linear structures, the N end and the C end of the protein are irrelevant to the protein function, 65-85aa, 95-115aa, 127-147aa and 209-229aa are transmembrane regions, transmembrane amino acid regions are avoided when the expression regions are selected, and the protein is difficult to secrete due to the positioning of the transmembrane amino acid regions on a nuclear membrane, so 61 amino acids (non-transmembrane regions) in the 148-208 interval are selected to be in a final stable form, and the 148-208aa expression region (the amino acid sequence is shown as SEQ ID NO: 4) can cover an isomer region and can represent the protein function. The proteins expressed from this segment can be used to develop functional antibodies.

Optionally, the recombinant vector further comprises a polynucleotide encoding a protein tag, said polynucleotide encoding a protein tag being immediately 3' to said polynucleotide encoding a nuclear membrane protein.

The addition of protein tags facilitates the separation and purification of proteins, wherein the protein tags are one or more of 6 XHis, trx, 3X FLAG, GST, strep (II) and HA, GFP, cMyc, mFC. The person skilled in the art can specifically set the encoding protein tag according to the purification requirements, so as to adapt to different purification systems and devices, and the invention is not limited thereto.

Illustratively, the protein tag comprises a mFC and a 6 XHis tag, named mFC-6His tag, linked in sequence, and the DNA sequence of the polynucleotide encoding the mFC-6His tag is as shown in SEQ ID NO:7, the amino acid sequence of the mFC-6His tag obtained by encoding is shown as SEQ ID NO: shown at 6.

Alternatively, the expression vector used to construct the recombinant vector is eukaryotic cell expression vector pcdna3.4. The recombinant vector of the present invention was obtained by ligating the DNA sequence encoding the mutant signal peptide (SEQ ID NO: 3) and the DNA sequence encoding the nuclear membrane protein (SEQ ID NO: 5) to the vector pCDNA3.4.

In yet another embodiment, the invention provides the use of the polynucleotide or recombinant vector described above in secretory expression of nuclear membrane proteins and methods of use. Specifically, a preparation method of secreted proteins comprises the following steps:

s1, constructing a recombinant vector: connecting a DNA sequence (shown as SEQ ID NO: 3) for encoding mutant signal peptide and a DNA sequence (shown as SEQ ID NO: 5) for encoding nuclear membrane protein to an expression vector, and obtaining a recombinant vector through sequencing verification;

s2, secretory expression: and transfecting the recombinant vector into eukaryotic cells, culturing for a period of time, harvesting the transfected eukaryotic cells, and collecting supernatant for purification to obtain the secreted protein.

The advantages of the method for producing the secreted protein over the prior art are the same as those of the recombinant vector described above over the prior art, and are not described in detail herein.

It should be noted that secreted proteins include only nuclear membrane proteins and protein tags, the protein tags being located immediately C-terminal to the nuclear membrane proteins, and that mutant signal peptides will be anchored to the cell membrane during their secretion and sheared off, which will not be involved in the function of the protein.

Specifically, the operation of constructing the recombinant vector includes the steps of: using a plasmid (named pUC57-TMEM 176B) comprising a DNA sequence encoding TMEM176B protein 148-208aa and a DNA sequence encoding a signal peptide as templates, the sequence of SEQ ID NO:10 and SEQ ID NO:11, mutating E in the signal peptide into K and mutating D into K to obtain a target gene (whole plasmid sequence fragment), then connecting the target gene to an expression vector pCDNA3.4 after enzyme digestion, then transforming the target gene into E.coli DH5 alpha competent cells, and carrying out positive cloning screening to obtain the recombinant plasmid.

Specifically, the recombinant vector is transfected into eukaryotic cells, including HEK293F cells, using transient transfection techniques.

Specifically, the purification method is affinity purification.

The embodiment of the invention also provides a secreted protein which is prepared by the preparation method of the secreted protein and only comprises a nuclear membrane protein and a protein tag, wherein the protein tag is tightly connected with the C end of the nuclear membrane protein.

The advantages of the secreted protein over the prior art are the same as those of the method for preparing the secreted protein described above over the prior art, and are not described in detail herein.

The invention will be further illustrated with reference to specific examples. The experimental methods, which do not address specific conditions in the following examples, are generally in accordance with the conditions recommended by the manufacturer.

1. Recombinant vector construction

A typical nuclear membrane protein TMEM176B was selected as the subject, the full length of the protein 270aa, with 65-85aa, 95-115aa, 127-147aa, 209-229aa as the transmembrane region, and 148-208aa as the final stable form in combination with mouse sequence homology analysis, was constructed into the mammalian expression vector pCDNA3.4, and the protein was expressed using the Expi-293F mammalian cell eukaryotic system. The techniques employed for insertion of the signal peptide and protein tag into the expression vector pcdna3.4 are conventional in the art and will not be described in detail herein. This section describes only the insertion process of transmembrane protein 176B.

The present example constructs the following recombinant vectors:

numbering device	Gene name	Signal peptides	Region(s)	Label (Label)
					Plasmid 1	TMEM176B	Wild type	148-208aa	C-mFC-6his
Plasmid 2	TMEM176B	Mutant type	148-208aa	C-mFC-6his

The sequence information referred to above is as follows:

1.1 construction of plasmid 1

Primer5 was used for Primer design, the Primer sequences were:

plasmid 1-F	TGCCAGGCTCTACCGGCAATAGCTTCATCTGGCAAACTGAAC (see SEQ ID NO: 8)
		Plasmid 1-R	TTATCATCGTCGTCGGCGGCACGGATTGCTGTGAACAACTTC (see SEQ ID NO: 9)

PCR amplification was performed using the above primers using RK20705 kit (available from Wubi Botaike Biotechnology Co., ltd.) in a PCR system of 50uL, wherein: gloria High-Fidelity PCR Master Mix with GC Buffer 25 mu L, ddH ₂ O17. Mu.L, template 1.5. Mu.L, upstream/downstream primer 2.5+2.5 mu L, DMSO 1.5.5 mu L. PCR amplification reaction program set up: denaturation at 98℃for 5min (high temperature disruption of bacterial solution), denaturation at 98℃for 20s, annealing of primer and template binding at 60℃for 30s, extension at 72℃for 2kb/1min at 30cycLe, extension at 72℃for 10min.

After the PCR reaction is completed, the agarose gel electrophoresis is adopted for verification, a single band of 183bp can be seen, which indicates that the pure target gene is obtained, and then the target band is recovered by adopting a recovery kit (goods number: CW 2302) for recovering century agarose gel DNA, so that the pure target gene is obtained.

Carrying out connection transformation on the purified target gene and an expression vector pCDNA3.4 with a signal peptide and a protein tag by adopting a homologous recombination mode, wherein a connection system is as follows: 2. Mu.L of the target gene, 3.4. Mu.L of pCDNA3, 2X MultiF Seamless Assembly Mix (available from Wuhan Aibotake Biotechnology Co., ltd., product number RK 21020) and 5. Mu.L. 10 mu L of the ligation product is completely transferred into DH5 alpha competent cells, and subjected to ice bath, heat shock, resuscitation and overnight culture, colony PCR identification is performed by using universal primers, and the verification result is shown in figure 1. The correct positive clones were selected from FIG. 1 and sequenced using the vector universal primers, and plasmid 1 after correct sequencing was used for subsequent protein expression, resulting in a plasmid 1 concentration of 1109ng/uL.

The sequence of the universal primer is as follows:

plasmid name	Sequence 5′-3′
		Universal primer F	GCAGAGCTCGTTTAGTGAACCG (see SEQ ID NO: 12)
Universal primer R	TCCGATTTCGTCGGTGGAGGAGAT (see SEQ)ID NO：13)

1.2 construction of plasmid 2

Primer5 was used for Primer design, the Primer sequences were:

carrying out PCR reverse amplification by using the primer and the plasmid 1 as a template to mutate E in the wild signal peptide into K, mutate D into K, and carrying out a PCR system of 50uL, wherein:max DNA Polymerase (from Takara, cat# R045B (A.times.4)) 25. Mu.L, template plasmid 1 1. Mu.L, upstream/downstream primer 1+1. Mu. L, ddH ₂ O22. Mu.L. PCR amplification reaction program set up: denaturation at 98℃for 4min (high temperature disruption of bacterial solution), (denaturation at 94℃for 40s, annealing of primer and template binding at 58℃for 30s, extension at 72℃for 10 min). Times.35cycLe, extension at 72℃for 10min.

After the PCR reaction was completed, a single band of about 5000bp was observed by agarose gel electrophoresis (see FIG. 2 for the results), indicating that the pure target gene was obtained, and then the target band was recovered by using the recovery kit for century agarose gel DNA (cat# CW 2302) to obtain the pure target gene.

The above objective gene was digested with DpnI enzyme (available from Wohan Eboltag Biotechnology Co., ltd., cat# RK 21109), and the digestion system was as follows: 10XBuffer cut S5. Mu.L, target gene 1. Mu.g, dpnI 0.5-1. Mu. L, ddH ₂ O was made up to 50. Mu.L. Incubating at 37 ℃ for 5-15min to obtain an enzyme digestion product. Then, the enzyme digestion product is transformed into DH5 alpha competent cells, positive clone screening is carried out after ice bath, heat shock, resuscitating and overnight culture, and sequencing is carried out, and plasmid 2 with correct sequencing is used for subsequent protein expression, wherein the concentration of the obtained plasmid 2 is 1215ng/uL.

2. Transfection

Eukaryotic HEK293F is classified into transient transfection and stable transfection, and the transient transfection plasmid DNA is not integrated into chromosome after entering the cell, and expresses exogenous gene in a free state; the transient transfection period is short, the target protein can be obtained rapidly, and the method can be applied to fumbling in the research and development stage and large-scale high-flux protein screening. This example uses transient transfection techniques comprising the steps of:

(1) Eukaryotic HEK293F was isolated at 1.3E6 cells/mL one day prior to transfection in medium, cell volume 27mL;

(2) Prior to transfection, all reagents were left at room temperature and cell density was adjusted to 2.6E6/mL;

(3) Mu.g of plasmid DNA (plasmid 1 or plasmid 2) was diluted with 1.5mL of Opti-MEM in a sterile tube, and 90. Mu.L of PEI (1 mg/mL, pH 7.1) was added to 1.5mL of Opti-MEM, mixed well and left to stand for 5min;

(4) Adding the PEI mixed solution into the plasmid mixed solution, turning over or pipetting the mixture (the mixing process is required to be carried out slowly), and then incubating the mixture for 20 minutes or less at room temperature;

(5) Adding the plasmid/PEI mixture into eukaryotic cell culture liquid, fully mixing the mixture by gentle rotation, and carrying out total cell volume 30mL after mixing;

(6) 1.5mL of the first feed is fed 16-20h after transfection, and the cell survival rate and the cell density are measured 96h later; counting the day of transfection as day 0, expressing for 4 days, detecting the number of living cells and the cell survival rate every day, stopping expression and collecting HEK293F cells and cell culture supernatant when the cell survival rate is reduced to below 70%, and measuring the results shown in figures 3-4;

(7) The supernatant was collected and affinity purified by adding 10mM AEBSF.

3. Expression and purification

3.1, western Blot (WB) validation of expression

Sample preparation: taking 100 mu L of transfected HEK293F cells, centrifuging for 10min at 3000r/min, collecting 20 mu L of supernatant after centrifugation, adding 20 mu L of 2×loading buffer for sample preparation, and heating at 97 ℃ for 10min, and named supernatant; meanwhile, collecting the precipitate, suspending with 100 μl PBS, adding 20 μl to obtain 2×loading buffer sample, heating at 97deg.C for 10min, and naming as cell; the WB detection procedure is as follows:

(1) Loading 5 mu L of the prepared sample to SDS-PAGE electrophoresis, adopting a constant pressure mode, concentrating 5% gel at 80V, starting separation for about 25min when a marker starts, adjusting to 120V, and stopping electrophoresis when bromophenol blue reaches the bottom of the separation gel;

(2) Transferring: the assembly sequence is as follows: the black surface (negative electrode) -foam-rubber cushion-3 layers of filter paper-glue-membrane-3 layers of filter paper-foam-rubber cushion-red surface (positive electrode) is clamped by the transfer membrane; film transfer time: 200mA, 90-180min;

(3) Closing: labeling and washing off transfer solution (TBST, 5min×2 times) after transfer is completed; placing the cleaned membrane into a container containing 3% skimmed milk (TBST preparation), and sealing at room temperature for 60-90min;

(4) Incubation of 6His-tag primary antibody: after the sealing is completed, the sealing liquid is poured out. A1:7000 dilution of primary antibody solution in 3% skim milk (TBST) was added and gently shaken on a shaker and incubated at room temperature for 2h or at 4℃overnight (15-30 min after incubation at 4 ℃). Pouring out the primary antibody solution after the primary antibody incubation is completed; the membrane was rinsed with TBST 4 times, 5min each time;

(5) Secondary antibody incubation: before the incubation of the primary antibody is completed, the enzyme-labeled secondary antibody 1 corresponding to the primary antibody species is prepared: 5000 dilution to the amount required for the experiment (TBST dilution). Placing the cleaned membrane into a container containing a secondary antibody solution, slowly shaking on a shaking table, and incubating at room temperature for 60-80min. Pouring out the secondary antibody solution after the secondary antibody incubation is completed; the membrane was rinsed with TBST 4 times, 5min each time;

(6) Exposure: the membranes were removed from the TBST with forceps, properly drained and placed in a gel tray. Equal volumes of ECL Solution I and Solution II were mixed and applied to the membrane uniformly to complete the coating. The substrate was reacted with the membrane for about 30 seconds and placed in a chemiluminescent imaging system. The exposure time is set to be 3s;10s;30s;60s;120s.

The cells and supernatants after harvest were subjected to WB assay, the results are shown in FIG. 5. The target bands are detected in culture supernatants and cells of HEK293F cells transfected by the plasmid 1 and the plasmid 2, and the TMEM176B protein 148-208aa is expressed in and out of the cells, and the intracellular and extracellular expression amounts of the plasmid 1 are not greatly different, and the protein of the plasmid 2 is mainly secreted and expressed in and out of the cells, so that the supernatant can be purified.

3.2 His purification

Cell supernatants of plasmid 1 and plasmid 2 with secretory expression verified by WB were taken for affinity purification, and the purification column was prepared using Polv-prep@chromatography Columns (available from BIO-RAD, cat# 731-1550) and Ni Bestarose FF (available from Shanghai Bodazuron), and the operation procedure was as follows:

(1) Incubation: the sterilized 10mL purification cartridge was removed and the cartridge was rinsed 1-2 times with endotoxin free water. The Ni-IDA affinity purification matrix was removed from the refrigerator at 4℃and 0.5mL of matrix was pipetted into the purification column after ethanol was run out (commercial matrix was stored with 20% ethanol) and 6 column volumes were washed with endotoxin free water. Column volume refers to the volume of matrix in the purification column, not the volume of the column tubes. The packing 6 column volumes were balanced with Binding Buffer. Adding the balanced matrix into the upper tube cleaning tube, sealing with sealing film, and placing on rotary incubator at 20rpm and 4deg.C for 4 hr-overnight.

(2) And (3) flow through: after incubation, the tube was trimmed and centrifuged at 600rpm for 10min at 4 ℃. Pouring the supernatant after centrifugation into a new centrifuge tube, namely, flow-through. While leaving about 5mL of supernatant for suspending the matrix, transfer the matrix to the purification column, and leave the flow through (this flow through is not collected).

(3) Eluting and washing impurities:

a. a3 mL Washing Buffer wash column was added to the purification column to wash off the foreign proteins from the matrix. Gravity flow, effluent was collected with a sterilized 5mL EP tube, which was kept cold by insertion on ice. After running out, the column was washed with G250 (100. Mu. L G250 in 96 well plates, 10. Mu.L of the eluting solution was added) and if G250 turned blue, the column was further washed with 3mL Washing Buffer until G250 did not turn blue, ending the Washing Buffer pre-elution.

b. The column was washed with 0.5mL Elution Buffer 1 to wash off the matrix bound proteins. Gravity flow, effluent was collected with a 1.5mL endotoxin free EP tube, which was placed on an ice bin to maintain low temperature. After running out, the mixture was detected by G250 (100 mu L G in 96-well plates, 10 mu L of the eluting solution being dropped was added), if G250 turns blue, the Elution was continued until G250 did not turn blue, ending the Elution with the Elutation Buffer 1.

c. The column was washed with 0.5mL Elution Buffer 2 to wash off the matrix bound proteins. Gravity flow, effluent was collected with a 1.5mL endotoxin free EP tube, which was placed on an ice bin to maintain low temperature. After the flow was completed, the mixture was detected by G250 (100. Mu. L G250 in 96-well plates, 10. Mu.L of the eluting solution was added), and if G250 turned blue, the Elution was continued until G250 was not turned blue, ending the Elution by the Elutation Buffer 2.

d. The column was washed with 0.5mL Elution Buffer 3 to wash off the matrix bound proteins. Gravity flow, effluent was collected with a 1.5mL endotoxin free EP tube, which was placed on an ice bin to maintain low temperature. After the flow was completed, the mixture was detected by G250 (100. Mu. L G250 in 96-well plates, 10. Mu.L of the eluting solution was added), and if G250 turned blue, the Elution was continued until G250 was not turned blue, ending the Elution by the Elutation Buffer 3.

e. The column was washed with 0.5mL Elution Buffer 4 to wash off the matrix bound proteins. Gravity flow, effluent was collected with a 1.5mL endotoxin free EP tube, which was placed on an ice bin to maintain low temperature. After the flow was completed, the mixture was detected by G250 (100. Mu. L G250 in 96-well plates, 10. Mu.L of the eluting solution was added), and if G250 turned blue, the Elution was continued until G250 was not turned blue, ending the Elution by the Elutation Buffer 4.

f. The flow-through and eluate (Elution Buffer) collected above was subjected to SDS-PAGE electrophoresis, typically 6-sample preparation, i.e.20. Mu.L of protein+5. Mu.L of 6-Loading Buffer.

The above mentioned Buffer (Binding Buffer) formulation is specifically as follows:

buffer name	Composition of the components
		Binding Buffer	20mM Tris-HCL,250mM NaCl,10mM Imidazole,10％glycero pH 8.0
Elution Buffer 1	20mM Tris-HCL,250mM NaCl,40mM Imidazole,10％glycero pH 8.0
		Elution Buffer 2	20mM Tris-HCL,250mM NaCl,80mM Imidazole,10％glycero pH 8.0
Elution Buffer 3	20mM Tris-HCL,250mM NaCl,250mM Imidazole,10％glycero pH 8.0
		Elution Buffer 4	20mM Tris-HCL,250mM NaCl,500mM Imidazole,10％glycero pH 8.0

According to mFC-6His tag carried by plasmid, his tag purification is carried out on the harvested supernatant, gradient Elution is carried out by Imidazole (Imidazole) with different concentrations, BSA, marker (MK), supernatant (upper), purified flow-through liquid (FT), wash Buffer (W) in the purification process and different gradient Elutation Buffer are subjected to electrophoresis, and the amount of protein in the eluent is judged, and the result is shown in figures 6-7.

As can be seen from the electrophoresis gel diagram of FIG. 6, the plasmid 1 proteins were eluted at 80mM and 250mM imidazole concentration, a small amount of 40mM imidazole was eluted, and the eluates of several gradients of 80-1, 80-2, 80-3, 250-1, 250-2 were collected, and the protein concentration was determined to be 110mg/1000mL Cells. As can be seen from the electrophoresis gel diagram of FIG. 7, the plasmid 2 protein was eluted at 80mM and 250mM imidazole concentration, and the eluates of several gradients of 80-1, 80-2, 80-3, 250-1, 250-2, 250-3 were collected to obtain a high protein purity, and the protein concentration was measured to be 247mg/1000mL Cells.

In conclusion, the mutant signal peptide is obtained by mutating a specific site on the basis of the wild signal peptide, wherein the secretion capacity of the mutant signal peptide is enhanced, TMEM176B recombinant protein is successfully obtained through WB verification and affinity purification, the obtained protein has high concentration and purity, the expression quantity is about 247mg/1000mL Cells, and the expression quantity is improved by about 2.4 times compared with the wild signal peptide, so that the mutant signal peptide can realize the secretion expression of nuclear membrane protein TMEM176B and the like, and the obtained secreted protein product with high concentration and purity can be used for researching specific antibodies, such as developing functional antibodies of anti-TMEM 176B protein.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Claims

1. A mutant signal peptide, which has an amino acid sequence as set forth in SEQ ID NO:2.

2. a polynucleotide encoding the mutant signal peptide of claim 1.

3. The polynucleotide of claim 2, wherein the polynucleotide has the sequence set forth in SEQ ID NO: 3.

4. A recombinant vector comprising the polynucleotide of claim 2 or 3 and comprising a polynucleotide encoding a nuclear membrane protein, wherein the polynucleotide of claim 2 or 3 is immediately 5' to the polynucleotide encoding a nuclear membrane protein.

5. The recombinant vector according to claim 4, wherein the nuclear membrane protein is TMEM176B protein 148-208aa having a DNA sequence as set forth in SEQ ID NO: shown at 5.

6. The recombinant vector according to claim 4, further comprising a polynucleotide encoding a protein tag immediately 3' to the polynucleotide encoding a nuclear membrane protein.

7. The recombinant vector according to claim 6, wherein the protein tag comprises mFC and 6 xhis linked in sequence, and the DNA sequence thereof is as shown in SEQ ID NO: shown at 7.

8. A method for producing a secreted protein, comprising the steps of:

s1, connecting a polynucleotide sequence encoding mutant signal peptide and a polynucleotide sequence encoding nuclear membrane protein to an expression vector, and obtaining the recombinant vector according to any one of claims 4-7 through sequencing verification;

9. The method for producing a secretory protein according to claim 8, wherein in step S1, the DNA sequence encoding the mutant signal peptide is as set forth in SEQ ID NO:3, the DNA sequence of the encoded nuclear membrane protein is shown as SEQ ID NO:5, the expression vector comprises pcdna3.4;

in step S2, the recombinant vector is transfected into eukaryotic cells, including HEK293F cells, using transient transfection techniques.