JPH10500311A - Factors that interact with nuclear proteins - Google Patents

Abstract

  (57) [Summary] The present invention provides a nucleic acid encoding a B-lymphocyte-specific activator of octamer site-mediated gene transcription that interacts with Oct-1 and Oct-2 POU domains to activate gene transcription, and the nucleic acid. Provide the encoded protein. In a further aspect of the present invention, there are also provided host cells containing and expressing such nucleic acids, as well as methods of using the nucleic acids and cells transformed thereby.

Description

DETAILED DESCRIPTION OF THE INVENTION Factors that interact with nuclear proteins   The present invention provides nucleic acids and transcription factor proteins encoded thereby. In a further aspect of the invention, a host cell comprising or expressing such a nucleic acid I will provide a.   B cell-specific expression of immunoglobulin (Ig) genes in their activity Controlled by promoter and enhancer elements that are B cell-specific (St audt and Lenardo, 1991). Its consensus sequence -ATGCAAAT- or vice versa The octamer motif with the complement -ATTTGCAT- is the most prominent signature of the Ig gene. One of the clause elements. Because it is located in each of the Ig promoters In most of the Ig enhancers, introns or 3 '. Staudt and Lenardo, 1991). A single octamer motif of the above sequence is linked B cell-specific expression can be conferred on selected reporter genes: Insertion of its octamer site into a small promoter makes it large and B cell specific (Dreyfus et al., 1987; Wirth et al., 1987). this Multimerization of the octamer motif provides an effective B cell-specific enhancer Create (Gerster et al., 1987). In addition, this octamer motif Many non-lymphoma-specific genes, such as histone H2B or U micronucleus (sn) RNA genes It is also a functionally important element of a promoter or enhancer (LaBella et al. , 1988).   Several transcription factors that specifically bind to the octamer site have been identified and These cDNAs have been cloned (for example, -1, a ubiquitous protein of about 750 amino acids. In the literature, Oct-1 is NF-A1, OBP100 , NF III or OTF-1. Other transcription factors that bind to the octamer site Are approximately 479 amino acids that exist in several different isoforms due to alternative splicing. Oct-2 is a protein of amino acids. Oct-2, also known as OTF-2 or NF-A2, In all 1988; Staudt et al, 1988). These and other Oct proteins are all home Belonging to the POU family of odomain proteins and their DNA binding domain High homology within the inn but very far out (Herr et al ., 1988). To date, the two best characterized Oct proteins are Oct-1 And Oct-2.   Ig promoters or other artificial octamer-dependent promoters are Oct-1 and Oct Other cells, which are highly active in B cells containing -2 and contain only Oct-1 protein It is weakly active in vesicles, such as fibroblasts. These results are based on the octamer The B cell-specific activity of the motif broadens the presence of Oct-2 protein in B cells. Suggest that the cause. This initial model also provides for Oct-2 overexpression efficiently activates octamer-containing promoters l., 1988).   However, early on about the specialized action for Oct-2 in B cells Has been questioned by recent findings. First, many B cell lines contain Oc Because you have been studying those levels of t-2 protein (or mRNA) There is little correlation between its Oct-2 level and the activity of the octa site Is clear. For example, some B cell lines have little or no detectable Lacks an Oct-2 that can be Is nonetheless reported to be highly active (Johnson et al., 19 90). In addition, in vitro transcription experiments show that purified Oct-1 or Oct-2 It has a similar endogenous ability to stimulate the promoter, but also Eggs stimulate the Ig promoter considerably more efficiently than, for example, Hela extracts (LeBowitz et al., 1988; Johnson et al., 1990; Pierani et al. ., 1990; Luo et al., 1992). Furthermore, the protein fraction has recently been From the product, which together with the purified Oct-1 or Oct-2 form the Ig promoter Specifically stimulates transcription from This fraction is isolated from the HeLa nuclear extract. OCA-B (Oct co-activator from B cells) ) (Luo et al., 1992).   Finally, Oct-2-deficient mice have recently been transformed into embryonic stem (ES) cells. Produced by gene targeting; in these mice, all Oct-2 protein Lacking quality, the Ig gene is rearranged and transcribed efficiently, and B Cell development appears to be normal up to the stage of surface IgM-bearing virgin B cells; Suggest that it is essential during the first antigen-independent phase of B cell differentiation (Co rcoran et al., 1993). At a later stage, B cells from these animals Demonstrate a weakened ability to synthesize high levels of immunoglobulins. This discovery May therefore be only at the late B cell stage, but not for Oct-2 in Ig expression. Directly demonstrate their role.   Therefore, recent studies related to the role of Oct-1 and Oct-2 in regulating the Ig promoter Obviously, theory is not enough to explain the observed phenomenon satisfactorily . Octamer-mediated immunoglobulin inheritance Final control of offspring expression is more than simply through controlling the tissue distribution of Oct-1 and Oct-2. Is achieved in the following manner.   Knowledge of the biochemistry of immunoglobulin gene expression may affect imbalance in immunological properties For the purpose of designing, testing and identifying agents that can exert Pharmaceutical and biotechnological techniques for the selective regulation of Ig gene expression in expression systems Of importance to the technology industry. Moreover, knowledge of regulatory mechanisms can be therapeutic Regulated tissue-specific effects of active agents limit tissue specificity of transgene expression Of importance in the field of gene therapy, which is advantageously controlled by .   It is an object of the present invention to provide a solution to the above needs. The present invention POD proteins that interact specifically with Oct-1 or Oct-2 Nucleic acids to be provided. Such proteins are known as OBF-1 (Oct binding factor 1) Named.   According to a first aspect of the invention, Oct-1 and Oct-2 POs are used to activate gene transcription. B-lymphocyte-specific octamer site-mediated gene transcription interacts with the U domain Provided is a nucleic acid encoding a selective activator.   Such an activator is referred to herein as OBF-1 and, therefore, The present invention relates to isolated nucleic acids (DNA, RNA) encoding OBF-1. Recombinant O In addition to being useful for the production of BF proteins, these nucleic acids can be used as probes. And thus facilitate the skilled artisan in preparing nucleic acids encoding OBF-1. Identification and / or isolation. The nucleic acid may be labeled with a detectable moiety. It does not have to be done. Further, the nucleic acid according to the present invention is, for example, an OBF-1-specific nucleic acid. A method for measuring the presence of OBF-1 (or its complement) on a test sample nucleic acid. DNA (or RNA) encoding Hybridizing and determining the presence of OBF-1 in a method comprising: Useful. In another aspect, the invention provides a nucleic acid sequence encoding OBF-1. A nucleic acid sequence that hybridizes to the sequence under stringent conditions or is complementary thereto I will provide a.   The present invention relates to a nucleic acid (DNA or RNA) encoding OBF-1 (or its complement). Nucleic acid test including priming nucleic acid polymerase (chain) reaction A method of amplifying a pull is also provided.   In yet another aspect of the invention, the nucleic acid is DNA, and further, A state capable of acting on regulatory sequences recognized by a host transformed by a vector And a replicable vector comprising a nucleic acid encoding OBF-1 linked by a. Further, the present invention provides a host cell and OBF-1 transformed with such a vector. Use of a nucleic acid encoding OBF-1 for producing The OBF-1 nucleic acid is expressed in the culture of the transformed host cell, and optionally And recovering OBF-1 from the host cell culture.   Further, the present invention relates to an isolated OBF-1 protein encoded by the nucleic acid. You.   Providing an immunogen to generate antibodies to OBF-1 and binding to OBF-1 Obtaining antibodies that can be used is also an additional objective.   As used herein, the term "isolated" refers to the term In a concentrated or preferably pure form that can be obtained by engineering It is intended to refer to a molecule of the invention.   The isolated DNAs, RNAs and proteins of the present invention are naturally occurring DNAs, RNAs and Proteins are selectively absent, for example, to activate Oct-1 or Oct-2 activity Useful for identifying compounds that regulate Can be   An isolated OBF-1 nucleic acid is one in which it normally associates with the natural source of the OBF-1 nucleic acid. Or at least one contaminant-free nucleic acid. The nucleus thus isolated An acid exists in a form or environment other than in its natural form. However, simply The isolated OBF-1 encoding nucleic acid stains this nucleic acid differently than in natural cells At a position in the body or otherwise adjacent to a DNA sequence that is different from the one in which it occurs naturally. Such OBF-1 nucleic acids in normal OBF-1-expressing cells.   According to the present invention, OBF-1, particularly mammalian OBF-1, such as murine or human OBF-1, Or an isolated nucleic acid encoding a fragment thereof, e.g., DNAs or RNAs is provided. You. In particular, the present invention provides DNA molecules encoding OBF-1, or fragments thereof. You. By definition, such DNA is coding single-stranded DNA, its coding Includes double-stranded DNAN of DNA and its complementary DNA or this complementary (single-stranded) DNA itself . Exemplary nucleic acids encoding OBF-1 are shown in SEQ ID NOs: 1 and 3. Human OBF-1 Was obtained from plasmid pRS314 / UNVP16 / clone 9. On May 9, 1994, under accession number 9200, under Deutsche Sammlun g von Mikrooganismen und Zellkulturen GmbH (DSM), Mascheroder Weg 1b, D-3 8124 Deposited with Braunschweig.   A preferred sequence encoding OBF-1 is the coding sequence in SEQ ID NOs: 1 and 3. SEQ ID NOs: 1 and 3 having substantially the same nucleotide sequence as the Is most preferred. As used herein, Nucleotide sequences that are substantially identical share at least about 90% identity. . However, for example, in the case of a splice variant with additional exons, Sequence homology may be low.   An exemplary nucleic acid alternatively encodes an OBF-1 protein and comprises SEQ ID NO: Hybridize to the DNA sequence described in 1 and 3 or a selected portion (fragment) of the DNA sequence As a nucleotide sequence. For example, Selected fragments useful for hybridization are those used in the Examples. For example, a cDNA used for the isolation of a mouse homolog, i.e., a plasmid 2 kb present in pR314 / UNVP16 / clone 9Sfil  cDNA insert. Above 2kbSfil  OB that hybridizes to the cDNA insert under high stringency conditions Sequences that encode F-1 are preferred.   The stringency of hybridization is defined as the The condition under which the brid is stable. Such conditions are known to those skilled in the art. It is obvious. As known to those skilled in the art, the stability of a hybrid depends on the sequence homology. The melting temperature of the hybrid (T m). In general, the stability of a hybrid Function of temperature and temperature. Typically, hybridization reactions are high It is performed under stringency conditions, and then is subject to various stringency Washing is performed.   As used herein, high stringency means 1 string at 65-68 ° C. M Na⁺Of only nucleic acid sequences that form stable hybrids in This refers to the conditions that allow redidation. High stringency is, for example, 6 × SSC, 5 × Denhardt's, 1% SDS (sodium dodecyl sulfate), 0.1Na⁺Piloho Aqueous solution containing 0.1 mg / ml denatured salmon sperm DNA as sulfate and non-specific competitor It can be provided by hybridization in a liquid. Hybrida Number of high stringency washes after A final wash (about 30 minutes) can be performed in 0.2-0.1 x SSC, 0.1 Performed at hybridization temperature in% SDS.   Moderate stringency refers to a solution in the above solution but at about 60-62 ° C. It refers to conditions equivalent to hybridization. In that case, the final wash is 1 XSSC, 0.1% SDS at the above hybridization temperature.   Low stringency refers to hybridization at about 50-52 ° C in the above solution. A condition that is equivalent to dization. In this case, the final wash is 2 x SSC, 0.1 Performed at the above hybridization temperature in% SDS.   These conditions are based on a variety of buffers, such as formamide-based buffers. It can be understood that it can be adapted and duplicated using It is. Denhardt's solution and SSC may be used in other suitable hybridization buffers. As well as those well known to those skilled in the art (eg, Sambrook et al., 1989 or A usubel et al., 1990). The optimal hybridization conditions are Must be determined empirically. Because the probe length and GC content Also play a role.   Given the guidance provided herein, the nucleic acids of the invention can be used in the art. Can be obtained according to well-known methods. For example, the DN of the present invention A is by chemical synthesis, using the polymerase chain reaction (PCR), or OBF-1 Source and is believed to express it at detectable levels Screen the genomic library or a suitable cDNA library prepared from Can be obtained.   Chemical methods for the synthesis of nucleic acids of interest are known in the art. And triesters, phosphites, phosphoramidites and H-phos The phonate method, PCR and other autoprimer methods and oligonucleotides on solid supports Including leotide synthesis. These methods require that the entire nucleic acid sequence of the nucleic acid be known. Or the sequence of a nucleic acid complementary to the coding strand is available. Can be used. Alternatively, if the target amino acid sequence is known, Use known and preferred coding residues for each amino acid residue. Effective nucleic acid sequences can be deduced.   Other means for isolating the gene encoding OBF-1 include, for example, Sambr Using PCR techniques as described in section 14 of ook et al., 1989. It is. This method uses oligonucleotides that will hybridize to OBF-1 nucleic acids. Requires the use of a tide probe. Oligonucleotide selection strategies Will be described below.   Identify the library of interest or the protein encoded by the library Screen using probes or analysis tools designed to You. For a cDNA expression library, the preferred means is OBF-1; the same or a different species. An approximately 20-80 base long oligonucleotide encoding a known or suspected OBF-1 cDNA from And / or encodes the same or hybridizing gene Recognize and specifically bind complementary or homologous cDNAs or fragments thereof Monoclonal or polyclonal antibodies. Genomic DNA library Suitable probes for cleaning include, but are not limited to, the same DNA or hybrid. Or encoding homologous genomic DNA or fragments thereof; Gonucleotides, cDNAs or fragments thereof.   The nucleic acid encoding OBF-1 is a probe, No. 1 The present invention includes oligonucleotides derivable from the sequences shown in 1 and 3. Using the nucleic acids disclosed in the specification, under suitable hybridization conditions, Be isolated by screening cDNA or genomic libraries Can be. Suitable libraries are commercially available or, for example, cells Can be prepared from lines, tissue samples, etc.   As used herein, a probe comprises the contiguous bases shown in SEQ ID NOs: 1 and 3. Between 10 and 50, which is equal (or complement) to a number equal to or greater than , Preferably between 15 and 30, and most preferably at least about 20 contiguous bases Is a single-stranded DNA or RNA having a nucleotide sequence containing Select as probe The nucleic acid sequence used is of sufficient length and sufficient length to minimize false positive results. Should have fever. These nucleotide sequences usually contain OBF-1 protection. Based on existing or high homology nucleotide sequences or regions. As a probe The nucleic acid used can be degenerate at one or more positions. Degenerate ori The use of gonucleotides is important when the library uses preferential codons in that species. Especially important when screening from unknown species Can be.   Preferred regions from which to construct probes are the 5 'and / or 3' Coding sequences, sequences predicted to encode ligand binding sites, etc. Including. For example, the full-length cDNA or a fragment thereof disclosed herein is used as a probe. Can be used. Preferably, the nucleic acid probe of the present invention Labeled using suitable labeling means for easy detection of the . A preferred labeling means is a radiolabel. A preferred method for labeling DNA fragments is , Random, as is well known in the art ・ Α by Klenow fragment of DNA polymerase in priming reaction³²P-dATP This is due to incorporation. Oligonucleotides are usually γ³²P-tagged AT End-labeled with P and polynucleotide kinase. However, Other methods (eg, non-radioactive), for example, using suitable fluorophores and biotinylation Even those containing enzyme labels and fluorescent labels, the fragments or oligonucleotides are labeled Can be used to remove   For example, a portion of DNA comprising substantially the entire OBF-1 coding sequence, or the DNA thereof. Screen of the above library using suitable oligonucleotides based on After hybridization, positive clones are detected for hybridization signals. Identifying the clones by restriction enzyme mapping and / or DNA sequencing Characterized by analysis and then compared, for example, to the sequences provided herein. And whether they contain DNA encoding the complete OBF-1 ( Ie, whether they contain translation start and stop codons) . If the selected clones are incomplete, they will Can be used to rescreen the same or different libraries it can. If the library is a genome, those duplicate clones will Sons and introns. The library is a cDNA library The duplicate clones contain an open reading frame. I will. In both cases, the complete clone is the DNAs provided herein and It can be identified by comparison with a deduced amino acid.   To detect any endogenous OBF-1 abnormalities, Genomic screening using the nucleotide sequence of the present invention as a probe It can be carried out. Also, in this specification Designing an antisense-type therapeutic agent based on the nucleic acid sequence provided it can.   The nucleic acid of the present invention may have a nucleotide substitution, nucleotide deletion, nucleotide insertion or Is easy with inversion of nucleotide extension and any combination of them It is envisioned that it can be modified to: Such mutants are, for example, OBF-1 muteins with a different amino acid sequence from the OBF-1 sequence found in (Mutant proteins). Mutagenesis Can be predetermined (site-specific) or random. Silent sudden change Mutations that are not different must not place the sequence out of the reading frame And preferably create a secondary mRNA structure, such as a loop or hairpin. Will not create complementary regions that will be able to hybridize .   CDNA or genomic DNA encoding native or mutant OBF-1 may be further Can be incorporated into a vector for manipulation. As used herein Sometimes, a vector (or plasmid) is used for either its expression or replication. Refers to a separate element used to introduce heterologous DNA into a cell. Such a medium The choice and use of the body is well within the skill of the artisan. Use many vectors And the selection of an appropriate vector depends on the intended use of the vector. Where it is to be used for DNA amplification or DNA expression. The size of the DNA to be inserted into the vector, and It will depend on the host cell to be transformed. Each vector has its function (DNA Amplification or DNA expression) as well as depending on the host cell to which it is compatible. Contains various components. These vector components generally include, but are not limited to, the following replication origins: Point, one or more marker genes, enhancer required Element, promoter, transcription termination sequence and signal sequence.   Both expression and cloning vectors generally contain one or more vectors. And a nucleic acid sequence capable of replicating in the selected host cell. Typically, claw In the case of a vector, this sequence is used by the vector to It replicates independently of DNA, and has an autonomously replicating sequence or origin of replication. Including. Such sequences are useful for various bacteria, yeasts and viruses. Well known. The origin of replication from plasmid pBR322 is compatible with most Gram-negative Suitable for C. terriers, the 2μ plasmid origin is suitable for yeast and Various viral origins (eg, SV40, polyoma, adenovirus) Useful for cloning vectors in cells. Generally, the replication origin component is In mammalian cells that are competent for high-level DNA replication, such as COS cells If not used, it is not required for mammalian expression vectors.   Most expression vectors are shuttle vectors. That is, they Can be replicated in at least one class of organisms, but may It can be transfected into an object. For example, one vector is E. coli. (E.coli), And then the same vector is A yeast or mammalian cell that cannot be replicated independently of its host chromosome Transfected into the vesicle. DNA is replicated by insertion into the host genome. You can also. However, the recovery of genomic DNA encoding OBF-1 It is more complicated than the recovery of exogenously replicated vectors. Because restriction enzyme digestion Is required to excise the OBF-1 DNA. DNA is amplified by PCR And that Transfected directly into host cells without any replication components Can be   Advantageously, one expression and cloning vector is also referred to as a selectable marker. Selection genes. This gene is used for traits grown in selective culture media. Encodes a protein necessary for the survival or growth of the transformed host cell. This choice Host cells not transformed with the gene-free vector are Will not survive in. Typical selection genes are antibiotics and other toxins, such as For example, ampicillin, neomycin, methotrexate or tetracycline. Resistance, complementary auxotrophic deficiency, or Encodes a protein that confers a nutrient supply.   For a selection gene marker suitable for yeast, see Table of marker genes. Any marker that facilitates selection for transformants for expression of the present type Genes can also be used. Suitable markers for yeast include, for example, Provides resistance to biomaterials, G418, hygromycin or bleomycin Or that provides prototrophy in an auxotrophic yeast mutant For example,URA3,LEU2,LYS2,TRP1OrHIS3Is a gene.   Vector replication is performed using E. coli (E.coli) Can be conveniently done within E. coli gene marker andE.coliAn origin of replication is advantageously included. These are antibiotics Confer resistance to substances such as ampicillinE.coliReplication origin andE.coliRemains Including both gene markers,E.coliPlasmids such as pBR322, Bluescript ( TM) can be obtained from a vector or a pUC plasmid, such as pUC18 or pUC19. Wear.   Suitable selectable markers for mammalian cells incorporate the OBF-1 nucleic acid To identify competent cells, such as dihydrofolate Dactase (DHFR, methotrexate resistance), thymidine kinase, or G418 or Is a gene that confers resistance to hygromycin. These mammalian cells Transformants are only those that have taken up and are expressing that marker. Placed under selective pressure that is uniquely adapted for survival. DHFR or Glutami In the case of synthase (GS), the selective pressure is determined under conditions of progressively increasing pressure. Can be imposed by culturing the transformant, thereby Both the selection gene and the linked DNA encoding OBF-1 (at its chromosomal integration site) Guide) amplification. This amplification can encode the desired protein About the production of proteins essential for growth, together with closely related genes Largely required genes are tandemly repeated in the chromosome of recombinant cells It is such a method. The increased amount of the desired protein is usually amplified in this way. Synthesized from DNA.   Expression and cloning vectors are usually recognized by the host organism, and And a promoter operably linked to the OBF-1 nucleic acid. like this Promoters can be inducible or constitutive. These promoters Removes the promoter from its source DNA by restriction enzyme digestion, and OBF-1 by inserting the isolated promoter sequence into a vector Is operably linked to the DNA encoding Innate OBF-1 promoter Both the sequence and many heterologous promoters provide direct amplification of OBF-1 DNA and / or Can be used for expression.   Suitable promoters for use with prokaryotic hosts include, for example, β-lactamases. And lactose promoter system, alkaline phosphine Tatase, tryptophan (trp) promoter system and hybrid promoter For example, the tac promoter. Their nucleotide sequences have been published And thus a linker to provide any required restriction sites Or, using an adapter, let those skilled in the art convert them to DNA encoding OBF-1. It is connected in an operable state. Promoters for use in bacterial systems The shield is generally operably linked to the DNA encoding OBF-1. It will also contain the Shine-Delgarno sequence.   Moreover, the OBF-1 gene according to the present invention is preferably Rather than being produced as a soluble native peptide. A secretory sequence to facilitate secretion of the polypeptide from a rear host. This Is recovered from the periplasmic space of the bacterium or, as appropriate, from the culture medium. be able to.   Promoting sequences suitable for use with yeast hosts are either regulated or It can be constitutive, and preferably is a highly expressed yeast gene, especially Saccharo Mrs. Selevisier (Saccharomyces cerevisiae) Obtained from the gene. Therefore ,TRP1gene,ADHIOrADHIIGene, acid phosphatase (PH05) From the gene promoter,a-Orα-Yeast mating pheromone gene encoding factor Obtained from a promoter or a gene encoding a glycolytic enzyme -For example, enolase, glyceraldehyde-3-phosphate dehydrogenase (GAP ), 3-phosphoglycerate kinase (PGK), Hexokinase, pyrbe De-carboxylase, phosphofructokinase, glucose-6-phosphate Isomerase, 3-phosphoglycerate mutase, pyruvate quina Ose, triose phosphate isomerase, phosphoglucose isomera Glucokinase gene promoter or TATA binding protein A promoter from the quality (TBP) gene can be used. In addition, one Contains the upstream activation sequence (UAS) of the yeast gene and the functional TATA box of other yeast genes Hybrid promoters containing downstream promoter elements, such as yeastPH05Remains UAS (s) and yeast of the geneGAPRequires a downstream promoter containing a functional TATA box for the gene Hybrid promoters containingPH05−GAPHybrid promoter ) Can also be used. Suitable constructivePH05Promoters, for example, Truncated acid phosphatase lacking flow regulation elements (UAS)PH05A promoter, for example,PH0 Five Begins at nucleotide 173 of the gene and ends at nucleotide -9 ToPH05(-173) promoter.   OBF-1 gene transcription from a vector in a mammalian host is Rioma virus, adenovirus, fowlpox virus, bovine papillomavirus, bird Sarcoma virus, cytomegalovirus (CMV), retrovirus and simian virus From the genome of virus 40 (SV40), a heterologous mammalian promoter, such as actin Promoters or very strong promoters, such as ribosomal proteins Quality promoter and from promoters that normally associate with OBF-1 sequences. Can be controlled by a promoter. However, such a promoter Is compatible with its host cell system.   Transcription of the DNA encoding OBF-1 by higher eukaryotes is contained within the vector. It can be increased by inserting an enhancer sequence. Enhancer Are relatively direction and position independent. Many enhancer sequences are based on mammalian genetics. Offspring (eg, elastase and globin). However, Typeically, Some will use enhancers from eukaryotic cell viruses. An example is SV40 enhancer and CMV early promoter on the late side of the replication origin (base pairs 100-270) Includes data enhancers. This enhancer is 5 'or 5' to OBF-1 DNA. Can be spliced into the vector at the 3 'position, but is preferably Alternatively, it is placed 5 'from the promoter.   Advantageously, the eukaryotic expression vector encoding OBF-1 contains a locus control region ( LCR). LCRs are transduced into host cell chromatin. High levels of integration site-independent expression of the gene can be directed, which The chromosomal integration of the vector has been made permanent-transfected therein. OBF-1 gene in the context of an eukaryotic cell line When expressed in a vector or transgenic animal designed to Of particular importance.   Suitable eukaryotic host cells for expression of OBF-1 include yeast, fungi, insects, plants, animals Nucleated cells from human, or other multicellular organisms, which terminate transcription And will also contain the sequences necessary to stabilize the mRNA. This Such sequences are unique from the 5 'and 3' untranslated regions of eukaryotic or viral DNAs or cDNAs. Generally available. These regions represent the untranslated mRNA encoding OBF-1. Contains nucleotide segments transcribed as polyadenylation fragments within the moiety .   Expression vectors contain regulatory sequences, such as a promoter region, OBF-1 nucleic acid operably linked to one capable of expressing Includes any vector that can be expressed. Therefore, an expression vector is A recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus or other Vector And the expression of the cloned DNA during introduction into a suitable host cell. It refers to something to hang. Suitable expression vectors are well known to those of skill in the art and Those that can replicate in nuclear and / or prokaryotic cells and remain as episomes Or those integrated into the host cell genome. For example, OBF-1 The encoding DNAs may be any vector suitable for expression of cDNAs in mammalian cells, e.g., For example, CMV enhancer-based vectors such as pEVRF (Matthias et al., 198 9) Can be inserted within.   Particularly useful in the practice of the present invention is to encode OBF-1 in mammalian cells. An expression vector that provides for transient expression of DNA. Transient onset Usually, the host cell accumulates many copies of the expression vector, and Can be efficiently replicated in host cells to produce high levels of OBF-1 And the use of expression vectors. For the purposes of the present invention, a transient expression system is For example, to identify OBF-1 muteins, to identify potential phosphorylation sites, Alternatively, it is useful for characterizing a functional domain of the protein.   The construction of the vectors according to the invention uses conventional ligation techniques. Isolation The resulting plasmid or DNA fragment is cleaved, tailored and required Religated into the desired form to make the plasmid. If desired Analysis to confirm the correct sequence in the constructed plasmid is performed in a known manner. Do. Build expression vectors, prepare transcripts in vitro, transfer DNA to host Performing assays to transduce cells and assess OBF-1 expression and function is not an option. Known to the trader. The presence, amplification and / or expression of a gene can be determined, for example, by Conventional probes using appropriately labeled probes based on the sequences provided in Zan blotting, mr Northern blotting, dot blotting to quantify NA transcription (DNA or RNA analysis) or in situ hybridization It can be measured directly in the sample.   Suitable methods include those described in detail in this example. The person skilled in the art You can easily envision how these methods can be modified U.   According to another embodiment of the present invention, a cell comprising the above nucleic acid (ie, DNA or mRNA) Is provided. Such host cells, for example, prokaryotes, yeast and higher eukaryotes Cells can be used to replicate DNA and produce OBF-1. Good Suitable prokaryotes are eubacteria, such as gram negative or gram Positive organisms such as E. coli (E.coli), For example, E. coli strain K-12, DH5a and HB101, or Includes Bacilli. Further accommodations suitable for OBF-1 coding vectors Mainly eukaryotic bacteria such as filamentous fungi or yeasts such as Saccharomyces cerevisiae (Saccharomyces   cerevisiae)including. Higher eukaryotic cells are insect and vertebrate cells. Vesicles, especially mammalian cells. In recent years, the growth of vertebrate cells in culture (tissue culture) Breeding has become a routine procedure. Examples of useful mammalian host cell lines are epithelial or Is a fibroblast cell line, such as Chinese Hamster Oocyte (CHO) cells, NIH 3T3 cells , HeLa cells or 293T cells. The host cells referred to in this disclosure may be in vitro Includes cells in culture as well as cells that are within a host animal.   DNA can be stably taken up into cells or is known in the art It can be expressed transiently using the method. Stable and transfected Isolated mammalian cells using an expression vector with a selectable marker gene. Effect, and Transfected under conditions selective for cells expressing the Can be prepared by growing the isolated cells. Transient transformer To prepare transfectants, mammalian cells must monitor the efficiency of transfection. It is transfected with a reporter gene for monitoring.   To create such stable or transiently transfected cells In addition, the cells are supplied with a sufficient amount of the OBF-1-encoding nucleic acid to produce OBF-1. Must be transfected. Accuracy of DNA encoding OBF-1 The exact amount is determined empirically and is optimized for the particular cell and assay. Can be   Host cells can be prepared using the expression or cloning vectors described above in the present invention. Transfected or preferably transformed, and inducing a promoter, Select transformants or amplify the gene encoding the desired sequence Culture in a conventional nutrient medium, modified as appropriate. Heterogeneous DNA is Any known method, such as calcium phosphate coprecipitation technology or electroporation Transfection by vector encoding heterologous DNA Can be introduced into the host cell depending on the application. Many transfections Methods are known to researchers in the field. Successful transfection Generally, when any indication of the operation of the vector occurs in the host cell. Be recognized. Transformation uses standard techniques appropriate to the particular host cell used Is achieved.   Incorporation of cloned DNA into a suitable expression vector, plasmid vector Or plasmid vectors, each encoding one or more distinct genes -Eukaryotic cells by combination or linear DNA Transfection of cells and selection of transfected cells (Eg, Sambrook et al. (1989) Molecular Clon). ing: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory See Press. ).   The transfected or transformed cells are preferably Culture conditions known in the art under conditions in which the encoded OBF-1 is expressed Cultured using soil and culture methods. The composition of suitable media is such that they can be easily prepared. It is known to those skilled in the art as can be made. Suitable culture media are also commercially available Is available at   The DNA provided herein can be any suitable host cell, such as those referred to above. Encodes a functional OBF-1 that can be expressed within Preferred for expression of the DNA are the Oct-1 protein and / or the Oct-2 protein. Commercially available (either endogenously or recombinantly) expressing proteins Eukaryotic expression systems, including baculovirus-systems and other systems known to those of skill in the art. Base systems, and especially mammalian expression systems.   In a preferred embodiment, the OBF-1 coding DNA is ligated into a vector. To generate transformed cell lines that express OBF-1 It is introduced into a suitable host cell. The cell lines obtained will then affect the operation of OBF-1. Reproducible qualitative and / or quantitative analysis of potential drug effects To be made in large quantities. Therefore, OBF-1 expressing cells are compounds, especially A small molecule that can enter the nucleus, OBF-1 and Oct factor (Agonis G) that enhance the specific interaction between, thereby increasing the efficacy of OBF-1 Can be used for the identification of On the contrary, it decreases the activity of OBF-1 In situations where it is desirable to Antagonizing molecules that interfere with Oct / OBF-1 interactions are useful . Yet another alternative to achieving antagonistic effects is antisense Relies on OBF-1 RNA overexpression. Therefore, host cells that express OBF-1 will Compounds that are useful for training and that modulate the activity of OBF-1 A method comprising producing heterologous DNA encoding OBF-1 that produces functional OBF-1. At least try to measure its ability to modulate the activity of OBF-1 Exposure to one compound or signal and then caused by its regulation Also provide methods that include monitoring those cells for changes It is a further object of the present invention. Such assays are based on OBF-1 agonists, Allows identification of agonists and allosteric modulators.   Cell-based screening assays include, for example, reporter proteins, That is, proteins that can be easily assayed, such as β-galactosidase, Loramphenicol acetyltransferase (CAT) or luciferase By constructing cell lines whose expression is dependent on OBF-1, Can be Such assays include compounds that directly modulate OBF-1 function, For example, compounds that antagonize OBF-1 or other cellular functions required for OBF-1 activity Allows detection of inhibiting compounds. The in vitro assay for OBF-1 Can be produced in large quantities in functional form using recombinant DNA methods. And request. The assay then determines the functional properties of the OBF-1 protein, such as Oct-1 or Oct- Designed to measure interactions with 2. Examples for in vitro assays And an electrophoretic mobility shift assay (EMSA) as described in this example.   Furthermore, it is necessary to interact with Oct-1 or Oct-2 in B cells. Thus, OBF-1 regulates the activity of these transcription factors and hence Ig gene expression Can contribute directly to the regulation of Therefore, OBF-1 boosts Ig production For example, to boost monoclonal antibody production be able to. This includes, for example, B cell OBF-1 itself or even stronger OBF-1 Overexpression in base hybrid proteins, such as VP16-OBF-1 chimeras Can be achieved by In contrast, it is desirable to reduce Igs production. In some contexts, molecules that interfere with Oct factor / OBF-1 expression can be useful. Thus, the present invention can be directly or indirectly regulated by OBF-1 An expression system, which is transduced by one or more vectors encoding the desired protein. Provided are those that contain a host cell that can be infected. OBF-1 activity Oct protein required for transfection Can be provided exogenously or can be endogenous to the host cell . Similarly, OBF-1 can be endogenous to its host cell, but is preferably It is provided by a recombinant transcription unit that expresses the OBF-1 gene.   OBF-1 has been found to be expressed mostly in cells of lymphoma origin. Thus, the present invention exogenously affects the OBF-1 independent process that occurs in such cells. Also provided is a method for providing Recombinant OBF-1 producing host cells, such as mammalian cells The vesicle can be contacted with a test compound, and its modulating effect can then be tested. Comparing the OBF-1-mediated response in the presence and absence of the The OBF-1-mediated response of a control cell (ie, a cell that does not express OBF-1) is expressed by its compound. It can be evaluated by relating to the existence of an object.   As used herein, a compound that modulates the activity of OBF-1 or A signal is defined as the activity of OBF-1 (compared to the absence of the compound or signal). G) alters the activity of OBF-1 in different ways in the presence of the compound or signal Refers to a compound that   The present invention relates to transgenics modified to regulate endogenous OBF-1 expression. A non-human mammal is also provided. Preferably, a transgenic non-human mammal The class is transgenic mice. So, for example, OBF-1 production is significant Ensure that transgenic mice are designed to be reduced or eliminated. Can be. Alternatively, the transgenic mouse of the present invention has an elevated OBF-1 Levels can be expressed or in developmental or tissue-specific ways Or can be subject to the regulation of OBF-1 expression through control by an exogenous agent . Studies on such animals provide insight into the importance of OBF-1 in vivo.   In addition, the present invention provides for the treatment of conditions associated with abnormal Ig gene expression by gene therapy techniques. Provided is a transcription unit encoding OBF-1 for use in therapeutic methods. Book A transcription unit provided according to this aspect of the invention may comprise one or more enhancers and / or Together with the LCRs, it contains a regulatory control region including a promoter. This transcription unit is A preferred means of any of these, comprising a viral vector, in particular a retroviral vector. , Including adeno- and adeno-associated virus vectors, non-viral delivery Delivery systems containing liposomes, and antibody-targeted delivery systems, and Naked DNA can be delivered to a subject by direct uptake. Mark The target tissue is advantageously a lymphoma tissue, and preferably the transcription unit is a hematopoietic Delivered to stem cells. In an advantageous embodiment, hematopoietic stem cells are obtained from the patient. Out, transfected ex vivo, and then Will be returned. Alternatively, those cells are, for example, an antibody It can be targeted in vivo using a targeting approach.   Also provided is a protein encoded by the nucleic acid. Therefore, the present invention Interacts with Oct-1 and Oct-2 POU domains to activate gene transcription, Includes B-lymphocyte specific activator of kutamer site-mediated gene transcription. This Is named OBF-1 (Oct binding factor 1). Transcription factor Thus, OBF-1 can affect transcription. This biological activity is favorable Suitable assays, such as transactivation assays, such as those described in this example Such assays can be demonstrated.   Preferably, the proteins of the invention are provided in an isolated form. “Isolated OBF-1 lacks one or more components of its natural environment and has been identified as OBF-1 Means -1. Isolated OBF-1 includes OBF-1 in recombinant cell culture. That Whether the OBF-1 protein is "isolated" or otherwise recombinant O OBF-1 present in organisms expressing the BF-1 gene is also included within the scope of the present invention.   OBF-1 is the amino acid of human and murine OBF-1 shown in SEQ ID NOs: 2 and 4, respectively. Sequences, peptides containing all or part of the sequences and additional sequences, sequences thereof Polypeptide or peptide fragment and plasmid pRS314 / UNVP16 / clone 9 And OBF-1 proteins that can be produced from it. The definition of OBF-1 is Includes functional or immunogenic equivalents. For the purposes of the present invention, a "functional equivalent" is By OBF-1 (regardless of its native or denatured conformation) or In vivo effector performed directly or indirectly by any of the subsequences Means a protein that exhibits a protein function. Effector functions are related to receptor binding and And activation, induction of differentiation, Includes DNA regulatory function and others. The main known effector functions of OBF-1 are Oct-I and O Its ability to interact with ct-2.   “Immunogenic equivalent” refers to a protein or peptide having the antigenic function of OBF-1. To taste. Antigen function is directed against the native or denatured OBF-1 polypeptide or a fragment thereof. Or peptide having an antigenic function capable of cross-reacting with a given antibody Means Thus, OBF-1 provided by the present invention is an alternative to the primary transcript. Splice variants encoded by mRNAs produced by Mino acid mutants (muteins), sugar-added mutants and other covalent derivatives of OBF-1 , Including those that retain the physiological and / or physical properties of OBF-1 . Exemplary derivatives are those in which the protein of the invention has a moiety other than a naturally occurring amino acid. Covalently modified by substitution, chemical, enzymatic, or other suitable means. Molecules. Such a moiety may be a detectable moiety, such as an enzyme or radio eye. Could be a sotope. OB found with certain species, preferably mammals Natural variants of F-1 are further included. Such a mutant is The related gene of the family may be encoded by an allelic variant of a particular gene. Or represents another splicing variant of the OBF-1 gene.   OBF-1 muteins may, for example, add, replace and / or delete one or more amino acids. D encoding OBF-1 subjected to in vitro mutagenesis resulting in Can be produced from NA. For example, a substitution, deletion or insertion mutant of OBF-1 is , Prepared by recombinant methods, and for immune cross-reactivity with the native form of OBF-1 Screened.   The proteins of the present invention can be chemically purified from natural sources, such as nuclear extracts of lymphoma cells. It can be obtained synthetically or by recombinant technology. Wear. Due to its ability to compete with its endogenous OBF-1 partner for endogenous ligand In addition, it interacts with fragments that exhibit selective physiological characteristics of OBF-1 such as Oct-1 or Oct-2. The fragments used are envisioned as therapeutic agents. Thus, the present invention relates to the use in medicine. Provide OBF-1 for   In addition, the present invention provides that a suitable host cell producing the protein can be used in vitro or Is characterized in that it is amplified in vivo and a method for preparing the protein of the present invention. I will provide a. Preferably, those host cells encode a promoter and OBF-1. An expression cassette containing a DNA sequence to be Is transformed (transfected) with a vector containing the vector to be controlled. Thereafter, the protein of the present invention can be recovered. Recovery is, for example, Isolating the protein from the nutrient broth or host cell. Preferred is the machine This is a method for preparing an active protein. Protein from recombinant cell culture Any of the methods known in the art for the purification of Those involving chemical solubilization of the produced protein can be used. However, preferably, the protein is made in a soluble form and Advantageously, it is secreted by the host microorganism.   OBF-1, for example, for affinity purification of OBF-1 antibodies, e.g., immobilized In vitro to prepare labeled OBF-1 and labeled OBF-1 It can be embodied.   The proteins of the invention can be used, for example, as immunogens in drug screening assays. As reagents for immunoassays and in purification methods, for example, Useful in affinity purification of binding ligands and as a therapeutic You.   According to yet another aspect of the present invention, OBF-1 is specifically recognized and And an antibody that binds thereto is provided. For example, such an antibody has the SEQ ID NO: It can be made against OBF-1 having the amino acid sequence shown in 2 or 4. Ah Or OBF-1 or an OBF-1 fragment (synthesized by an in vitro method) Can be (recombinant expression or peptide binding in vitro) ) Is fused to an immunogenic polypeptide, and this fusion polypeptide is in turn Used to generate antibodies to one epitope.   Anti-OBF-1 antibody is recovered from the serum of the immunized animal. Or things Clonal antibodies can be obtained from cells in vitro or in vivo in a conventional manner. Prepared from animals immunized in this manner. Identified by routine screening The preferred antibodies identified inhibit the interaction of Oct-1 or Oct-2 with OBF-1.   The antibodies of the present invention identify OBF-1 tissue positioning, nucleic acids encoding OBF-1. Screening of expression libraries to study the structure of functional domains For OBF-1 purification, in diagnostic applications, and for others. It is for.   The present invention should not be construed as limiting the invention, but rather illustrative of the Of particular relevance to certain embodiments as described in the examples.Example: Cloning of OBF-1   Isolate OBF-1, a protein that interacts specifically with Oct protein An experimental approach based on the two-hybrid technology (Chien et al., 1991) Was used. In this technology, the protein of interest is a DNA binding domain (D BD; this is hybrid protein # 1. As a fusion protein with Yeast cells (S. Cerevisiae) Is expressed within. Usually, DBD of yeast transcription factor Ga14 is used. Used. This yeast strain can be easily assayed for its activity. And a reporter gene under the control of a Ga14 binding site.   On the other hand, the fusion protein is significantly more than its background and level. Do not activate photography. The cDNA library is then loaded (with appropriate cell lines or Is a transcriptional activation domain whose cDNA is active in yeast. Hybrid protein # 2. Hence the name is a two hybrid. ) Is prepared in a yeast expression vector so as to be fused at random. Specific cD The protein (or protein domain) that NA interacts with the target protein (And the cDNA is combined with the expression vector-induced activation domain). (If in frame), measure the enhanced transcription from that reporter gene. Can be Next, the corresponding cDNA is rescued from the yeast cells, and E. coli (E.coli ) Can be amplified and further characterized.   To isolate OBF-1, the principle of the method by Chien et al is described using the intact Oct protein. Is used as a target (ie, Oct not fused to a heterologous DBD) The point was corrected. The logic under this amendment is that two DBDs (ie And endogenous Oct DBD) are inactivated when functionally tested Is that it can be done. Intact proteins have the right interactions It has a greater tendency to have a suitable three-dimensional structure that may be required. Used Methods are described briefly below and in detail in sections 1.1-1.5 below. .   Plasmids are used as promoters and termination sequences for the yeast TATA binding protein gene. Expression of essentially intact Oct-1 protein from a centromere yeast vector using Build to let. Ensuring proper nuclear targeting of Oct-1 protein in yeast For the SV40 T-antigen protein The nuclear localization sequence (NLS) obtained from the protein is engineered at the N-terminus of Oct-1.   The enzymes imidazole glycerol phosphate dehydratase (IGP), The his3 gene, which encodes the enzyme required for histidine amino acid biosynthesis, is Used as a gene. When histidine disappears from its growth medium, his3 inheritance Offspring expression is required for growth (eg, Struhl, 1983). In addition, IGP 3-A competitive inhibitor which allows the use of the his3 gene as a selectable marker Minotriazole (3-AT) is present. In the presence of increasing amounts of 3-AT in the medium, (his3 Only those yeast cells with increased his3 expression (due to increased transcription of the gene) But can grow.   In the his3 promoter, upstream of the TATA box, the Ig heavy chain intron A his3 reporter containing six copies of the octamer site obtained from the sensor (YIp 55-AT / H36).   This reporter construct was reintroduced into yeast at its original his3 locus and Y: AT. A strain called H36 was produced. In this strain, the expression vector encoding Oct-1 The screening strain Y: AT.H36 / OCT1 was then introduced.   An inducible expression vector comprising a hybrid Gal1-10 / his3 promoter. Under the control, the transcriptional activation domain from VP16, from the herpes simplex virus Constructs that contain extremely strong transcription activators (pRS314 / UAS_G-NLS.VP16 (Sfi 1)). This vector contains the V16 activation domain and any one inserted downstream thereof. Allowing expression during galactose induction. This From the human B cell line Namalwa (ATCC CRL-1432) using the expression vector A cDNA library having the extracted mRNA is constructed. Next, the plasmid DNA is Prepared from a cDNA library To transform a yeast strain containing the his3 reporter and expressing Oct-1 Use to It encodes OBF-1, a novel protein Allowed to isolate the cDNA.   General technology: Unless otherwise specified, all recombinant DNA plasmids were  standard techniques (such as those described in Sambrook et al., 1989 and Sambrook et al., 1989). For example, restriction digestion, gel electrophoresis, ligation, fill-in reaction, DNA distribution Column sequencing, polymerase chain reaction, etc.). Yeast medium is especially Unless noted, Guide to Yeast Genetics and Molecular Biology by Sherman , Methods in Enzymology, vol. 194, pp. 3-21 (1991). It is. In particular, use the following media:   YPD1% (w / v) Bacto-Yeast extract (Difco), 2% (w / v) Bacto- Peptone, 2% (w / v) glucose or galactose (for galactose Should use a quality containing less than 0.01% glucose; Sigma).   YPAD: Same as YPD. However, this involves the addition of 0.01 volume of 0.25% adenine.   Minimal medium lacking uracil and tryptophan (CAA medium): 0.67% (w / v) power Zamino acid (Difco), 0.67% (w / v) yeast nitrogen-based amino-free (Di fco), 2% (w / v) glucose, 0.01 volume of 0.25% (w / v) adenine.   Synthetic medium lacking histidine and containing AT: 0.17% (w / v) yeast nitrogen Diene-based amino acid-free and AuSO_Four(Difco), 0.5% (w / v) ammonium sulfate Um, 2% (w / v) glucose or galactose, each 0.01 volume: 0.5% (w / V) tryptophan, 0.25% (w / v) uracil, 1% (w / v) leucine, 0.25% (w / v) adenine, 1% (w / v) lysine. 3-aminotriazole ( AT) at the appropriate concentration.   FOA (5-fluoroorotic acid) medium: 0.1% (w / v) FOA, 0.01 volume of 0 Supplemented with 0.5% (w / v) tryptophan and 0.02 volume of 0.25% (w / v) uracil It is made using the prepared CAA medium.   The solid medium for the plate contains, in addition to the above, 2% agar.Experiment :   1.1 Construction of yeast vector expressing Oct1   Oct1 protein initiates the natural transcription of the yeast TATA-binding protein (TBP) gene And constitutive expression from a single copy plasmid using termination signals.   The parent plasmid p2DN-1, from which the above regulatory sequences are obtained, is the entire yeast TBP gene. And extending 1 kb upstream and 500 bp downstream from its coding region. Carries a 0.3 kb PstI-BamHI genomic fragment (Cormack et al, 1991). This genetic Offspring differ from wild type by the presence of EcoRI introduced upstream of the native ATG initiation codon. Yes (TTTTTTGAATTCATATGCormack et al., 1991). TBP gene promoter And the 5'-untranslated region as a Hind3-EcoRI fragment (from the pUC19 polylinker). Prior to introduction into pRS316 (Sikorski and Hieter, 1989), the PstI and EcoRI sites Into pUC19 (Yanisch-Perron et al., 1985), a PstI-EcoRI fragment of about 1 kb was inserted. As subcloned first, resulting in plasmid pRS316.TBP5 '. pRS31 6 is a centromere plasmid carrying a URA3 selection marker.   The NdeI site was used as a template for pBS-Oct1 + (Sturm et al., 1988) and before Forward and backward oligonucleotide primers: Described by Sturm et al. (1988) by the polymerase chain reaction (PCR) using Introduced in the first ATG of the Oct1 sequence.   Next, the obtained 375 bp PCR fragment was subjected to T / A cloning kit (Invitrogen). Ligated directly into the pCRII vector from pCRII / Oct1 (Nde) 5 Confirm the DNA sequence of the resulting clone, designated '. Nde1 site in this ATG The complete Oct-1 cDNA with the following is then ligated to the three DNA fragments described below. Rebuild by:   Approximately 390 bp (from pCRII polylinker) prepared from pCRII / Oct1 (Nde) 5＼  Nsi1-(including Nde1-modified Oct-1 ATG) NheI fragment,   Oct-1 containing a stop codon prepared from pBS-Oct1 + (Sturm et al., 1988) An approximately 2100 bp NheI-Hind3 fragment containing the C-terminal region,   -BluescriptKS- (Stratagene) cleaved by psI (compatible with Nsi1) and Hind3 A receiving vector.   The correct clone obtained is called BlueKS- / Oct1Nde5'-3 '.   Next, ligate the last Oct-1 expression vector with the following four DNA fragments: Build by:   It has a 5 'EcoRI and 3' Nde1 compatible single stranded extension and is derived from ATG and SV40. Synthesize a double-stranded oligonucleotide that provides a modified nuclear localization sequence (NLS):   Oct-1 tan (with Nde1-modified ATG) prepared from BlueKS- / Oct1Nde5'-3 ' An approximately 2450 bp Nde1-Hind3 fragment encoding the protein;   -Contains the 16 carboxy terminal residues of yeast TBP and contains p2DN-1 (Corm ack et al., 1991), extending about 5 460 bp into the 3 'non-coding region. A 00 bp Hind3-BamH1 fragment;   PRS316 as described above containing the 5 'regulatory region of the yeast TBP gene and the promoter A receiving vector which is the derivative pRS316.TBP5 '. This plasmid contains EcoRI and BamHI. (A site within the pRS316 polylinker). The last plus obtained The mid was confirmed by DNA sequencing and is called pRS316 / TBP5'3'-OCT1.   1.2 Construction of his3 reporter conflict AT.H36   Our selection strategy is that only yeast cells expressing inducible levels of the his3 gene should Growing in the presence of aminotriazole (AT), a competitive inhibitor of the his3 gene product Rely on the observation that there will be. 6 octamer sites 73 bp upstream of the TATA box One his3 allele carries YIp55-Sc3760, the URA3 selection marker, and Yeast containing the entire pet56-his3-ded1 gene region (Harbury and Struhl, 1989) Constructed from an integrative plasmid containing a 6.1 kbp segment of chromosomal DNA I do.   First, a synthetic duplex strand with Xho1 and EcoRI compatible cohesive ends. Gonucleotide The above promoter and the his3 gene (herein referred to as the his3 promoter fragment) 700 bp EcoR1 obtained from YIp55-Sc3760 containing most of the coding region -Insert between the Xho1 and Kpn1 sites of pGEM-7Zf (-) (Promega) together with the Kpn1 fragment. In the resulting plasmid, a unique (just upstream of the his3 gene TATA box) The EcoRI site is then removed by a filling reaction performed by Klenow polymerase. And the thus obtained construct was purified by GEM.his3.Eco^-When Call.   Mouse immunoglobulin heavy chain intron enhancer (positions 518-564; Ephrus si et al., same numbering as in 1985) (where 6 x octaves An approximately 300 bp Xho1 fragment containing 6 copies of the octamer motif was called p6W + Ie, from pUC derivatives (described in Gerster et al., 1987). This 6 X octa Xho1 fragment was first inserted into the Xho1 site of Bluescript KS- Get Blue 6W. In Blue 6W, the IgH enhancer DNA fragment (position about 560) The HinfI site is adjacent to the Kpn1 site of the Bluescript polymer.   By ligating the last reporter construct and then the three fragments together create:   -(Digestion with Kpn1, T4 DNA polymerase to remove its Kpn1 3 'overhang) , And then digested with EcoR1 (prepared from Blue 6W) 300 bp 6x octa fragment,   -(Digestion with Xho1, filling of 3 'concave end with T4 DNA polymerase, And a his3 promoter of about 700 bp (prepared by subsequent digestion with Kpn1) And coding region fragments,   A large (about 8 kbp) EcoRI-Kpn1 fragment from YIp55-Sc3760 ptins) vector. These various steps involve cutting off the chimeric 6 × octa-his3 promoter. Efficient replacement of the native EcoR1-Kpn1 fragment from YIp55-Sc3760 with pieces To create a final reporter plasmid called YIp55-AT / H36.   4th from the end of the his3 TATA box from the 5 'EcoR1 site of the 6x octa fragment YIp55-AT / H36 promoter region nucleotides presented up to nucleotides The sequence is as shown below. Six repeat IgH enhancer fragment, O ct site and his3 TATA Boxes are highlighted in bold.   1.3 Construction of parent yeast strain Y: AT.H36 / OCT1   Hybridization between VP16 activation domain and random cDNA-encoding polypeptide Screening of libraries that express ubiquitin proteins involves AT / H36 his3 vs. Requires a yeast strain that contains an integrated copy of the prostate gene and constitutively expresses OCT1 And After linearization of YIp55-AT / H36 with Xba1, the AT / H36 his3 allele was Exactly as described (Scherer and Davis, 1979) the his3-D200 allele Introduce into yeast strain KY320 (Chen and Struhl, 1988) by gene replacement. Then got Ura⁺Integrates are streaked on 5-fluoroorotic acid (5-FOA) plates Culture on previous non-selective YPD medium. This step is for the URA3 gene and Therefore, as a result of a homologous recombination event between the parent and a new copy of the his3 gene Select for loss of the plasmid sequence. AT / H36 retains his3 allele Segregants to their ability to grow in media lacking histidine More identification.   Final Y: The AT.H36 / OCT1 strain was transformed using the lithium acetate method (Becker and Guarente, 1991). Desired His used⁺Introducing pRS316 / TBP5′3′-OCT1 into a phenotypic isolate, And made by selecting for growth on plates lacking uracil .   1.4 Construction of inducible yeast expression vector for cDNA library   Hybridization between VP16 acidic activation domain and random cDNA fragment Library of tight proteins in a tightly regulated gal-his3 hybrid Expression from centromere plasmids under the control of a promoter. This expression vector is Build as below.   365bp Gal1-10 UAS fused to his3 promoter_GElements forward and backward Plasmid 3801 (Sing er et al., 1988):   This step involves placing an EcoR1 site immediately upstream of the his3 ATG start codon, and a Gal1-10 UAS_G Introduce a Sal1 site upstream of the element. PCR reaction, UAS_GAnd his3 TATA box The unique EcoR1 restriction site located at has been deleted by filling in the concave 3 'end resulting from oR1 digestion This is performed using a derivative of plasmid 3801 as a template DNA. This PCR product is called Sal1 And EcoR1 and insert into pUC19 for DNA sequencing. Get The clone obtained is called pUC19.Gal.his3.   The VP16 acidic activation domain (amino acids 413-490) was replaced with the following forward and backward oligonucleotides Plasmid pMSVP16D1D3 (Triezenberg et al. l., 1988) by PCR:   This step involves the in-frame fusion of ATG to Ala-413 in the VP16 coding region. A 5 'EcoR1 site was introduced adjacent to the start codon and the native VP16 was introduced by an Nde1 site. Replace the TAG stop codon. Treatment with T4 DNA polymerase followed by Eco After cleavage by R1, the PCR product was cloned between the EcoR1 and Sma1 sites of pUC19. Become Generate pUC19 / VP16. Confirm the DNA sequence of this clone.   By ligating the nuclear localization sequence and then three fragments as follows: In-frame fusion to the amino terminus of the VP16 activation domain:   -5 'flanking region of yeast TBP coding region and pRS316 / TBP5'3'-O Hind3-Nde1 (Klenow filter) containing NLS coding sequence prepared from CT1 Ruin) about 1 kbp fragment,   EcoR1 (K) prepared from pUC19 / VP16 encoding the VP16 activation domain lenow fill-in) -BamH1 (from pUC polylinker),   -Hind3 at the polylinker site (partial digestion) and pRS3 cleaved by BamH1 14 (Sikorski and Hieter, 1989).   Next, the gal-his3 hybrid promoter prepared from pUC19.Gal.his3 was The intermediate structure as a Sal1-EcoR1 fragment between the Xho1 and EcoR1 sites (compatible with Sal1) TBP promoter introduced into the structure and hence upstream of the NLS.VP16 coding sequence Replace the area. (Located 5 'of NLS.VP16 coding sequence) The unique EcoR1 site present in the sumid is ligated by EcoR1 with T4 DNA polymerase. The recessed 3 'end is deleted by filling. Got plus Mid for pRS314 / UAS_G-Call it NLS.VP16.   Transfer the final expression vector to pRS314 / UAS_G-NLS.VP16, ie non-palindromic Chloramphenicol acetyltransferase (CAT ) And the 3 'end of the yeast TBP gene 3 'end of VP16 activation domain in cDNA cloning cassette containing end signal Prepared by insertion at the end (Nde1 site). Do this as follows :   Synthesize two double-stranded phosphorylation adapters with non-palindromic Sfi1 extension These adapters are kinased and annealed, and With an array of: as well as   Double-stranded adapter 1 provides an Nde1 5 'overhang and contains an internal EcoR1 site Double-stranded adapter 2 places a stop codon in each translation reading frame (CGGCCGCTAACTGACTAGGTAC) and provide a 3 'Kpn1 overhang. These two An equimolar mixture of the two adapters was first added to the plasmid EBO-Sfi (Steimle et al. , 1993)) for about 3 hours. To The unligated adapter is then selectively removed using ammonium acetate. Removed by isopropanol precipitation (Sambrook et al., 1989) and The Dapter-ligated CAT DNA fragment is then resuspended in TE. At this point, C The AT fragment contains a copy of the double-stranded adapter 1 at each end, or a double-stranded adapter at each end. Copy of adapter 2 or double-stranded adapter 1 at one end and double-stranded at the other end It is a mixture of CAT fragments with adapter 2. With two different adapters Only the latter fragment is done by ligating the following fragments together: Will be ligated efficiently during the ligation phase after:   -The adapter described above-the ligated CAT fragment,   TBP 3 'termination signal as an approximately 500 bp Kpn1-BamH1 fragment. this To prepare the fragment, pRS316 / TBP5'3'-OCT1 was cleaved with Hind3 and Of the 3 'recess is filled with T4 DNA polymerase and then The plasmid is cleaved with BamH1. The resulting approximately 500 bp fragment is then isolated, It is subcloned between the Sma1 and BamHI sites of pUC19. Then replace it with the above The Kpn1-BamH1 fragment can be excised from the new clone described above.   The receiving vector was pRS314 / UAS cleaved by Nde1 and BamH1._G-NLS.VP16 . Restriction analysis and DNA sequencing should identify the final clone with the following structure: Allow: Ga1-his3 promoter / NLS / VP16 activation domain / Nde1-EcoR1-Sf i1-CAT-Sfi1-termination × 3-Kpn1 / 3'TBP termination signal-BamH1. This expression vector -PRS314 / UAS_G-Call it NLS.VP16 (Sfi1).   1.5 Activation domain obtained from B cell mRNA cDNA synthesis-tagged Construction of cDNA library   Total RNA was purified using an RNA extraction kit from Pharmacia (product # 27-9270-01) And following the manufacturer's instructions exactly, the human B lymphoma cell line Namalwa (ATCC CRL 1432). 3 × 10⁸Use whole cells, and 4.5mg Obtain total RNA. RNA is sterilized to a concentration of 2 mg / ml 10 mM Tris pH 7.5, 1 mM EDTA (TE) And aliquots (0.8 ml, equivalent to about 1.6 mg) are added to the (Using two consecutive oligo-dT columns) as recommended in the manual Use the mRNA purification kit from Pharmacia (product # 27-9258A) according to the manufacturer's instructions. Used for mRNA purification. About 75μg of poly A in total⁺Obtain RNA That is, the yield is about 4.6%).   The cDNA was transferred to the Superscript Choice System from Life Technologies ( Synthesized using product # 530-8090SA). 5 μg of poly A⁺Add 2 μl of oligo to RNA Add dT (tube A1) and 1 μl of random hexamer (tube A2); After 10 minutes, the mixture is cooled on ice. Add 0.5 μl RNAsin (Promeg a) 4 μl 5 × first strand buffer (tube A3), 2 μl 0.1 M DTT 1 μl dNTPs (tube A5) and 1 μl α-³²P-dATP (Amersham, dilution 1: 5; 666 pmol) are added. This first strand synthesis reaction was performed (from the above kit). Add 5 μl Superscript reverse transcriptase and react the reaction at 42 ° C. for 60 minutes. Start by incubating. The reaction is then transferred on ice. To this tube, add in order: 93 μl H_TwoO, 30μl 5x 2nd stra Buffer (tube B1), 3 μl dNTPs (tube A5), 1 μl Ecoli ligase (Tube B2), 4 μl E. coli DNA polymerase (tube B3), 1 μl RNAse H (tube B4). The reaction was incubated at 16 ° C. for 2 hours and 2 μl T4 DNA Add polymerase (tube B5) and incubate for an additional 10 minutes at 16 ° C. And quench on ice. 10 μl 0.5 M EDTA and 16 μl 3 M NaAc was added and the reaction was deoiled with phenol: chloroform (1: 1). And the nucleic acids in the supernatant are sedimented by adding 425 μl 100% EtOH. Sun The pull is centrifuged in a microfuge, washed with 80% EtOH, and re- Suspension and removal of small cDNAs exactly according to the manufacturer's instructions epharose 4CLB column (Size Sep column from Pharmacia; product # 27-5105-01) Let it pass. Divide the eluate into three equal aliquots (about 20 μl each) and Aliquot each aliquot into a double-stranded Sfi1 adapter in each translation reading frame Used for a separate ligation reaction. These adapters are Kinase treatment and annealing And has the following sequence:   Each ligation reaction contained 20 μl of cDNA in a final volume of 30 μl, and Includes 190 pmol kinased and annealed adapter. 1 at 16 ° C After 5 hours, the 3 reactions were pooled and NH_FourPrecipitate with Ac and EtOH. The cDNA is collected by centrifugation, washed with 80% EtOH, and 10 μl TEN (10 mM Tris pH 7.5; 1 mM EDTA; 25 mM NaCl). The cDNA is then transferred to the manufacturer Pass through Sephacryl column (provided in cDNA synthesis kit) exactly as instructed Separating the size by letting it. The different cDNA fractions were individually precipitated with EtOH and Each cDNA pellet is finally resuspended in 10 μl TE.   Preparation of vector for library construction   13 μg of pRS314 / UAS_G-NLS.VP (Sfi1) vector in mineral oil under about 30 u. By Sfi1 Digest about 14 hours. The reaction is then_FourPrecipitate with Ac and EtOH and centrifuge the DNA. Collect by centrifugation and resuspend in 200 μl TE. The cut vector Prepared in a SW41 centrifuge tube (as described by Kieffer, 1991). Place on sucrose gradient. Reduce these gradients to 30,000 rpm in the SW41 rotor. And centrifuge for 16 hours. The lower band (vector) was collected and EtBr was added to 1-butano Removed by tool extraction. Transfer the sample to one volume of H_TwoDiluted with O, and its D NA up to 0.2M (final) The NaCl concentration was adjusted and 12 mg of linear polyacrylamide was added as carrier It is later precipitated with isopropanol. Vector DNA was recovered by centrifugation And resuspend in TE at a concentration of about 50 ng / μl.   cDNA ligation and E. coli transformation   The ligation reaction was performed using 50 ng vector (prepared as described above). 50 mM Tris pH 7.6, 10 mM MgCl_Two, 1 mM ATP, 5% (w / v) PEG 8000, 1 mM  In a 20 μl reaction containing DTT and 20u T4 DNA ligase (N.E. The amount of the separated Sfi1 adapter-ligated cDNA is changed and set. 16 ℃ After 12 hours of ligation, the DNA was purified with phenol and phenol-C. HCl_ThreeExtraction and then addition of NaAc (0.3 M final concentration) and 1.5 mg yeast RNA as carrier. After addition, EtOH is allowed to settle. The DNA is recovered by centrifugation and the pellet is thorough with 80% EtOH. Wash in minutes and then resuspend in 4 μl TE. 1 μl of each ligation Then, follow the manufacturer's instructions exactly as in the Electro Max DH 10B Electron of competent bacteria (Life Technologies # 530-8290SA) Use for poration. Optimal cD based on the number of transformants obtained Measure the NA: vector ratio and set up additional ligation reactions And then proceed as described.   cDNA library amplification   The products corresponding to several electroporations as described above were obtained (about 8 × 10⁶Pooled, corresponding to the total number of individual transformants) and 50,000 colonies 100 μg / ml ampicillin at a density of cfus / 132 mm plate Plate on the containing LB / agar plate. After overnight culture at 37 ° C, these The colony Wash, and pool from plates containing LB medium. About half the sample The corresponding aliquots are stored frozen for future reamplification, and the remainder is For plasmid DNA preparation using the Magic Maxiprep Kit from a (Product # A7270) Used for The resulting DNA is then used for yeast screening.   Screening of VP16.cDNA fusion library   The library of fusion proteins was modified by Schiestl and Gietz with the following modifications: (1989) introduced into the yeast screening strain Y: AT.H36 / OCT1: originating from OCT1 Glucose lacking uracil to maintain selection for the appearing plasmid 1x10 in minimal medium⁷Overnight culture grown to cells / ml was added to fresh YPAD medium 2 × 10 in⁶Diluted to cells / ml and 1x10⁷Regrow to cells / ml. 50 Cells from the ml culture were resuspended in 500 μl TE / LiAc buffer and 20 μg cDNA library / plasmid DNA and 500 μg human poly A^-Mix directly with RNA Combine. After incubating for 30 minutes at 300 ° C with shaking, the cell suspension Into 5 Eppendorf tubes equally. The next step is to Perform exactly according to the protocol. After heat shock, these cells are pooled and And incubate for 1 hour at 500C in 500 ml YPAD with shaking. So Library complexity (2 × 10⁶Independent double transformant) was Plate the culture on a glucose minimal plate lacking tryptophan. To estimate. Transformants are recovered by centrifugation and 500 ml glue lacking uracil and tryptophan to select for transformants Inoculate in coarse minimal medium and incubate at 30 ° C. for 16 hours. This When the culture is about 25% Trp⁺/ Ura⁺Consists of cells. That culture Aliquot of (1.7 × 10⁸ 7 × 10 showing transformants⁸Cells) are harvested by centrifugation and galactose And resuspended in 50 ml of YP medium supplemented with Incubate for hours. While the cells are not dividing, this step It is necessary to induce the expression of the protein / library. After centrifugation, The cells were resuspended in 5 ml TE / LiAc buffer and lacked histidine, The transformants on a galactose synthesis medium containing 10 mM AT; 2 × 10⁷Cells (5 × 10⁶Double transformant) on each of 20 plates . After 10 days incubation at 300 ° C, 20-30 aminotriazols A resistant colony is observed on each plate. 55 of them is 5-fluoro Rotinic acid (5-FOA), i.e., cells expressing OCT1 from URA3 plasmid Drugs to select (Sikorski and Boeke, Guide to Yeast Genetics and Molecular Biology, in Methods in Enzymology vol.194, pp302-318, 1991) Grow on synthetic medium lacking tryptophan but containing uracil before plating Let it. Next obtained Ura^-/ Trpf⁺Isolates were grown for growth on AT-containing media. Testing. Only 6 of the transformants had their OCT1 plasmid cured. Lose their ability to grow on the ATs when they Suggests that both Oct1 and cDNA library plasmids are required for . This phenotype was derived from 5-FOA resistant colonies according to Robzyk and Kassir (1992). Rescue the plasmid containing the cDNA and the presence or absence of the OCT1 expression vector Now, the parent Y: more directly by reintroducing them individually into the AT.H36 yeast strain Can be ascertained. Growth on 10 mM AT-containing medium was performed in the presence of Oct-1 plasmid. Observed only in. This is due to Oct-1 and its cDNA library plasmids. Both loaded proteins And therefore the interaction between these two proteins It clearly convinces that it is defined by the gene. Partial distribution of the cDNA insert Column analysis and restriction mapping showed that four of them were OBF-1 (Oct binding factor 1). )), Three independent clones obtained from the same mRNA corresponding to the novel gene Clarify what to present. pRS314 / UNVP16 / Clone 9 The deposit has been deposited with the DSM under accession number 9200.   Of rescued human OBF-1 cDNA clone (pRS314 / UNVP16 / clone 9) Some of the overlapping restriction fragments from 1 are subcloned in pUC19 or Bluescript. And their DNA sequences are determined. Of the resulting sequence (SEQ ID NO: 1) Analysis shows that OBF-1 is an entirely new gene and is present in the Gen EMBL database Show no homology to any of the sequences (research, Several different programs, such as programs of the tFASTA or BLAST series Is performed by using.)   Example 2: Rat OBF-1   By homology hybridization, the mouse homolog of OBF-1 can Isolated from a cDNA library prepared from the mouse B cell line S194. As a probe In human clone pRS314 / UNVP16 / clone 9 (DSM accession number 9200) An existing approximately 2 kbp Sfi cDNA insert is used. Hybridization was performed using 6 × SC C (20 × SCC is: 3 M NaCl, 0.3 M trisodium citrate), 5 × Denhard t's (100 × Denhardt's is 2% (w / v) bovine serum albumin, 2% (w / v) Fic oll 4000, 2% (w / v) polyvinylpyrrolidone. ), 0.5% SDS (dodeci Sodium sulfate) and 0.1mg / ml denatured salmon sperm DNA for 16 hours at 67 ° C Do it. The filters are then washed as follows: in 2 × SSC, 0.1% SDS At room temperature 2 × 5 min; 2 × SSC, 0.1% SDS at 60 ° C. for 3 × 30 min; 1 × SSC, 0 2x30 minutes at 60 ° C in 1% SDS. Several clones were isolated and identical Confirm by secondary and tertiary screening under conditions. Mouse OBF-1 cDNA (sequence number No .: 3), the progressive deletion of BluescriptIIKS⁺Subcloth within After it has been generated from either end of the cloned cDNA.   OBF-1 cDNA can be transformed into other species (eg, L-type) by using a PCR-based strategy. ). Degenerate (for degeneracy of its genetic code) A primer that allows amplification of a DNA fragment corresponding to a portion of the OBF-1 cDNA. Designs can be made based on the indicated sequences (the "products" of these primers). “Quality” or “efficacy” is determined by performing a test reaction with mouse or human clones. Can be evaluated. ). Using such available primers, First, the cDN obtained from a B cell (or any other OBF-1 expressing cell) from that species Use A (already prepared cDNA libraries are also suitable for that purpose) To amplify the corresponding DNA fragment from the species of interest. it can. The amplified DNA fragment is then subcloned in a standard vector, Then, its nucleotide sequence is determined. Once the correct fragment is presented ( Obtained based on the sequence similarity to the mouse or human OBF-1 sequence). Live cDNA from the species of interest to isolate a complete OBF-1 clone from that species. It can be used to rescreen rallies.   Conceptually translated starting from the first ATG of both OBF-1 clones (human and mouse) Sequences can be derived from known protein motifs (eg, leucine zippers) , A 256 amino acid OB that does not contain any of the following: F-1 protein (sequence Create numbers: 2 and 4). Rich in proline residues (39 residues in human clones, OBF-1 has all obvious features except for 41 residues in the mouse clone). Not shown. Known transcription factors, such as CTF-1, are rich in proline residues and It has been shown to contain a proline-rich activation domain (Me rmod et al., 1989). Therefore, some of the proline residues of OBF-1 have similar functions. Can help you.   Example 3: OBF-1 gene expression pattern   Organ (Poly A⁺RNAs) or cell lines (total RNAs) Northern blot analysis of RNAs shows that OBF-1 expression is highly restricted . In the above expressing cells or organs, large RNA species are about 3.0-3.2 kb in size. Is detected. Radiolabeled probe obtained from hOBF-1 (pRS314 / UNVP16 / A 2 kb Sfi cDNA insert present in clone 9). Strong expression in peripheral blood leukocytes, weak expression in thymus and small intestine, and prostate, Undetectable expression in testis, ovary and colon (poly A⁺RNAs). Various Analysis of total RNA from human cell lines was performed in Namalwa and BJA-B (B cell line). Strong expression in Molt3 and Hut78 (T cell lines) and weak in HepG2 (hepatocytes) Expression and the following cells: K562 (myeloid leukemia), U937 (monocytes / macrophages) ), 293T (fibroblast), HeLa (cervical sarcoma, epithelium), MCF-7 (breast carcinoma) Indicates an inability to express. In addition, some mice using mouse OBF-1 probe Analysis of total RNA from B cell lines shows the following pattern: J558L, MPC11 and S194 B cells Medium to high expression in the system, and 70Z / 3, 40E-1, 18-81 and 220-8 play B cells Giving weak expression in the cell system.   In conclusion, the expression of the OBF-1 gene is highly cell-specific, It is expressed mostly in cells of lymphoma origin. In addition, the gene It seems to be adjusted. Because some play B cell lines have been tested Because it shows significantly lower levels of expression than mature B cell lines.   Example 4: Interaction between OBF-1 and Oct factor   The yeast assay identifies the interaction between Oct-1 and OBF-1 genetically. Biochemistry To directly demonstrate this interaction in the bell, hOBF-1 cDNA was cloned into pEVRF, That is, a CMV enhancer-based expression suitable for expression of cDNAs in mammalian cells. It was recloned into the current vector (Matthias et al., 1989) and the plasmid pEV-OBF Was generated. pEV-OBF-1 construction, ligating together the following three DNA fragments Went by:   SmaI-SfiI fragment from pEVRFO (Matthias et al., 1989); The fragments include the ampicillin resistance gene, the prokaryotic origin of replication and the CMV eukaryotic promoter / Enhancer sequences as well as the ATG translation initiation codon in an optimized context;   EcoRI (fill in) from plasmid pRS314 / UNVP16 / clone 9 to Hind III OBF-1 cDNA fragment; this fragment is a complete OBF-1 cDNA clone whose EcoRI site is Obtained from the above vector, and its HindIII site is the 3 'untranslated OBF-1 cDNA. In the area. ) And is present in the sequence shown as SEQ ID NO: 1 Contains a 5 'leader sequence; and HindIII to SfiI fragment; this fragment was derived from the rabbit β-globin gene. Contains the price and polyadenylation signals (this fragment is usually pEVRF P3S / 2-45, which is in the vector and simply because of the presence of a convenient HindIII restriction site Obtained from 7. ).   pEV-OBF-1 plasmid directs the expression of OBF-1 protein in eukaryotic cells, and Translation starts in the ATG obtained from the pEVRF vector.   Next, the pEV-OBF-1 plasmid can be transfected into 293T cells, Oct-2 expression vector (OEV1 + Project. Two days later, nuclear extracts were prepared from the transfected cells and (Similar to the Oct site monomer present in plasmid YIp55-AT / H36) Labeled DN containing octamer site from intron heavy chain enhancer Electrophoretic mobility shift assay performed with the A probe (gel retardation n) Or EMSA, also called gel shift test; Rezvin 1989) Used. The control extract has only one shift due to endogenous Oct-1 protein However, extracts from OBF-1 transfected cells showed two shifts Oct-1 shift, and the complex between endogenous Oct-1 and transfected OBF-1 Second shift with lower mobility due to the so-called super shift in gels Caused a supershift higher up. Similarly, OBF-1 and Oct-2 simultaneously trigger Extracts from transfected cells contain the complex between Oct-2 and OBF-1 or Oct- Either of the two alone resulted in an additional shift. Control reactions were OBF-1 and PV.1 I.e., co-tracing with an expression vector for transcription factors from the Ets family. This was performed using extracts from the transfected 293T cells. In this case smell For example, a single DNA probe with a PV.1 binding site can be used to Coalescence was observed. This indicates that OBF-1 does not interact with PV.1. This result indicates that OBF-1 can specifically interact with both Oct-1 and Oct-2, And it is different Biochemical evidence that it does not interact with the transcription factor from Millie, PV.1. Sa Furthermore, the OBF-1 / Oct-2 interaction was determined by using yeast strains expressing Oct-2 protein. It was also demonstrated in the mother test. Add additional transfections to Oct-1, Oct-2 or Expresses only Oct-6, the POU domain of other Oct factors in the POU family It carried out similarly using an expression vector. The results obtained were either Oct-1 or Oct-2. That the POU domain is sufficient for interaction with OBF-1; Oct-6 POU domain showed no detectable interaction with OBF-1 . This indicates that OBF-1 is a cofactor specific to Oct-1 and Oct-2, but other Oct families Suggests that the members are not specific. OBF-1 is By itself, it does not seem to bind to DNA.   Example 5: OBF-1-based transactivation expression system   As would be expected from a coactivator, OBF-1 is Transactivation to determine if it can be directly affected The designed mammalian expression system was designed. In this system, the desired polypeptide, In this case, the expression plus coding for the reporter polypeptide The plasmid was incubated with a second plasmid (pEV-OBF) that directs the expression of OBF-1 or as a control. Co-transfected with the empty expression vector and obtained from its reporter. The activity obtained is measured after 2-3 days. The expression plasmid used was Lucifer. Controls transcription of the lase gene (obtained from the intron heavy chain enhancer) Includes promoter with kutamer motif (This reporter is available from Promega or Based on their pGL2-enhancer plasmid and whose promoter is Identical to the promoter present. ). Obtained result is OBF-1 Activates transcription from this plasmid approximately 10-fold (through the endogenous Oct-1 protein) It shows that it becomes sexual. In HeLa cells and using other reporter plasmids Additional transactivation experiments performed confirm the initial results.   As expected, activation by OBF-1 resulted in the promotion of the reporter plasmid promoter. Depends on the integrity of the Oct site present in the protein.   Thus, the transcriptional activation domain is derived from the conceptually translated OBF-1 protein sequence. Although not at all obvious, OBF-1 appears to be a strong transcription activator Probably defines a new class of such proteins. It is probably isolated It is the first cell-specific coactivator that will be used.   Deposit data   On May 9, 1994, plasmid pRS314 / UNVP16 / clone 9 was replaced with accession number 9200. Under the issue, Deutsche Sammlung von Mikroorganismen unt Zellkulturen GmbH (DSM) , Mascheroder Weg 1b, D-38124 Braunschweig.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI C12Q 1/68 9282-4B C12N 5/00 B // (C12N 1/19 C12R 1: 865) (C12P 21 / 02 C12R 1:91) (C12P 21/02 C12R 1: 865) (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN, TD, TG), AP (KE, MW, SD, SZ, UG) , AM, AU, BB, BG, BR, BY, CA, CN, CZ, EE, FI, GE, HU, IS, JP, KG, KP, KR, KZ, LK, LR, LT, LV, MD, M G, MN, MX, NO, NZ, PL, RO, RU, SG, SI, SK, TJ, TM, TT, UA, US, UZ, VN

Claims (1)

[Claims]   1. B-lymphocyte-specific activator of octamer site-mediated gene transcription Encoding nucleic acids, Oct-1 and Oct-2 for activating gene transcription A nucleic acid that interacts with a POU domain.   2. A nucleic acid probe comprising at least 20 base pairs of the nucleic acid according to claim 1.   3. A vector comprising the nucleic acid of claim 1.   4. A host cell comprising the nucleic acid of claim 1.   5. An isolated protein encoded by the DNA of claim 1.   6. A composition comprising the protein of claim 5.   7. An isolated antibody capable of binding to the protein of claim 5.   8. A method for identifying a nucleic acid encoding the protein according to claim 5, Contacting the nucleic acid probe according to claim 2 with a nucleic acid sample, wherein the contact is performed. Performed under hybridization conditions and hybridized to the probe A method comprising identifying a nucleic acid to be reacted.   9. A nucleic acid polymerase chain reaction with the nucleic acid of claim 1 or a fragment thereof. A method for amplifying a nucleic acid test sample, which comprises performing an imming.   Ten. Identification of a compound capable of modulating the activity of the protein according to claim 5. A method comprising encoding the protein expressed in a functional form A host cell containing a heterologous DNA that is capable of regulating the activity of the protein Contacting at least one compound or signal to be measured Then monitor those cells for changes caused by the regulation A method characterized in that:   11． The nucleic acid according to claim 1, which is DNA.   12． 2. The nucleic acid according to claim 1, which encodes a mammalian, especially a human protein.   13. A protein having an amino acid sequence substantially identical to that shown in SEQ ID NO: 2 The nucleic acid according to claim 1, which encodes:   14. Having a nucleotide sequence substantially identical to that set forth in SEQ ID NO: 1. Item 12. The DNA according to Item 11.   15． A protein having an amino acid sequence substantially identical to that shown in SEQ ID NO: 4 The nucleic acid according to claim 1, which encodes:   16． Claims having a nucleotide sequence substantially identical to that set forth in SEQ ID NO: 3. Item 12. The DNA according to Item 11.   17． The nucleic acid of claim 1, wherein the nucleotides of the nucleic acid are: Hybridizer covering substantially the entire coding region of the DNA shown in SEQ ID NO: 2 or 4 A nucleic acid characterized in that   18． The nucleic acid according to claim 1, which is an mRNA.   19. Plasmid pRS314 / UNVP16 / cloth deposited with DSM under accession number 9200 The vector according to claim 3, which is vector 9.   20. A host cell that expresses the nucleic acid of claim 1.   twenty one. The host cell according to claim 20 for expressing the protein according to claim 5. Culturing cells and recovering the protein from the host cell. Way.   twenty two. 7. The composition according to claim 6, wherein the protein is functionally active. thing.   twenty three. 7. The composition of claim 6, wherein the protein is antigenically active. some stuff.   twenty four. Regulates the interaction of Oct-1 and / or Oct-2 with its protein 21. Further expressing Oct-1 and / or Oct-2 for identification of a nodal molecule. Use of the host cell described in 1.   twenty five. 2. Complementary to the nucleic acid sequence of claim 1 or under stringent conditions. A nucleic acid sequence that hybridizes to it.   26. The method according to claim 11, wherein the probe according to claim 3 is connected to DNA. Touch, where the contact is at low stringency to moderate stringency Under the hybridization conditions of A method comprising identifying DNA exhibiting a degree of hybridization.