CA2188423A1 - Factor interacting with nuclear proteins - Google Patents

Abstract

The present invention provides a nucleic acid encoding a B-lymphocyte specific activator of octamer site-mediated gene transcription, which interacts with the POU domaine of Oct-1 and Oct-2 in order to activate gene transcription, and the protein encoded by the nucleic acid. In a further aspect of the invention, host cells containing or expressing such nucleic acids are provided, as well as methods of using the nucleic acids and cells transformed therewith.

Description

WO 9513~284 2 1 ~ 8 4 23 . I/lrJ _10.14 Factor Ir~teractin~ With Nuclear Proteins The present invention provides nucleic acids and llGIlsl~liu~iul~ factor proteins encoded thereby. In a further aspect of the invention, host cells containing or expressing such nucleic acids are provided.
The B cell-specific expression of immunoglobulin (Ig) genes is controlled by promoter and enhancer elements which are B cell-specific in their activity (Staudt and Lenardo, 1991).
The octamer motif with the consensus sequence -ATGCAMT-, or its inverse l,UlllU~-ATTTGCAT-, is one of the most conspicuous regulatory elements of lg genes, as it is present in every lg promoter as well as in most of the lg enhancers, intronic or 3' (Staudt and Lenardo, 1991). It has been shown that a single octamer motif of the above sequence is able to confer B cell-specific expression to a linked reporter gene: insertion of the octamer site into a non-related minimal promoter renders it largely B cell-specific (Dreyfus et al., 1987;Wirthetal., 1987). ~' ~" lleli 1oftheoctamermotifcreatesapotentBcell-specific enhancer (Gerster et al., 1987). Furthemmore, the octamer motif is also a functionally important element of the promoter or enhancer of many non Iymphoid-specific genes such as the histone H2B or U small nuclear (sn) RNA genes (LaBella et al., 1988).
Several lldl ISUIi, ' I factors have been identified (and their cDNAs cloned) which bind 5,U~ "' 'Iy to the octamer site (e.g. Scholer et al., 1989). One of these nuclear proteins is Oct-1, an ubiquitous protein of about 750 amino acids. In the literature Oct-1 is also referred to as NF-A1, OBP100, NF lll or OTF-1. Another llal ', :' 1 factor binding to the octamer site is Oct-2, a protein of about 479 amino aclds which exists in several different isofomms due to alternative splicing. Oct-2, which is also known as OTF-2 or NF-A2, is expressed mostly, if not exclusively, in B cells (M~iller et ai., 1988; Staudt et al., 1988). These as well as the other Oct proteins all belong to the POU family of hu,,,eû iu,,,ai,l proteins and are highly homologous in their DNA binding domain but quite divergent outside of it (Herr et al., 1988). So far, the two best ~:lldld~1uli5e~i Oct proteins are Oct-1 and Oct-2.
Ig promoters or other artificial octamer-dependent promoters are highly active in B cells, which contain Oct-1 and Oct-2, and weakly active in other cells such as fibroblasts, which contain only the Oct-1 protein. These results suggested that the B cell-spec;~ic activity of the octamer motif is largely due to the presence of the Oct-2 protein in B cells. I i~is early model WO 95132284 2 1 8 8 4 2 3 PCT/EP9~/01834

-2 -WdS further supported by the d~ u~ , that o~ , e ssiu,~ of Oct-2 in non-B cells could efficiently activate octamer-containing promoters (Muller et al., 1988).
However, the early notion of a crr r~ali~~d function for Oct-2 in B cells has been questioned by recent findings. Firstly, now that many B cell lines have been looked at for their levels of Oct-2 protein (or mRNA), it is apparent that the correlation between the Oct-2 levels and the activity of the octamer site is rather poor. For example, several B cell lines have been reported which have only little or no detectable Oct-2, and where octamer-contalnlng promoters are n~ highly active (Johnson et al., 1990). Moreover, in vitro l,d,~s~ iu" ex,[~,i",t"bshowedthatpurified Oct-1 orOct-2 haveasimilarintrinsic capacity to stimulate an lg promoter, yet ulllldutk)l~dlt~d B cell extracts stimulate much more efficiently an lg promoter than e.g. HeLa extracts (LeBowitz et al., 1988; Johnson et al., 1990; Pierani et al., 1990; Luo et al., 1992). In addition, a protein fraction has been recently ~solated from a B cell nuclear extract which, in conjunction with purifled Oct-1 or Oct-2, specifically stimulates lldl-s~ liùl~ from an lg promoter. This fraction, which could not be isolated from HeLa nuclear extracts, has been designated OCA-B (Oct coactivator from B
cells) (Luo et al., 1992).
Finally, Oct-2-deficient mice have recently been generated by gene targeting in embryonic stem (ES) cells; in these mice, which totally lack the Oct-2 protein, lg genes are rearranged and lld~ ed efficiently and B cell development appears normal until the stage of the surface IgM-bearing virgin B cell, suggesting that Oct-2 is ~ "saL~I~ in the first, antigen-ll1d~ l Id~l ,l phase of B cell di~ l - ' , (Corcoran et al., 1993). At later stages, the B
cells from these animals show an impaired capacity to synthesize high levels of immuno-globulin. This finding therefore directly d~lllù~ ldL~s a role for Oct-2 in lg expression, if only at a late B cell stage.
It is therefore apparent that the current theories surrounding the roles of Oct-1 and Oct-2 in the regulation of the lg promoter are not sufficient to explain the observed ,uI,e,-c,,,,~l,a l;ly. Ultimate control of octamer-mediated immunoglobulin gene expression is achieved otherwise than solely through control of the tissue distribution of Oct-1 and Oct-2.
Knowledge of the l,iuul ,t:" ,i~l, y of immunoglobulin gene expression is of importance to medicine and the biul~ oloyi~dl industry, for the purposes of designing, testing and WO 95132284 PCr/~P95/al834 identifying agents capable of influencing disorders of an immunological nature and for the selective modulation of lg gene expression in expression systems. Moreover, knowledge of regulatory ",e.:l,d, li:""s is of importance in the field of gene therapy, where regulated tissue-specific action of therAre~iic~lly active agents is advantageously controlled by restricting the tissue specificity of transgene expression.
It is the object of the present invention to provide a solution to these needs. The present inYention provides nucleic acids encoding a protein specifically interacting with the POU
proteins Oct-1 or Oct-2. Such proteins are d~:l ,u",i, Idl~:d OBF-1 (Oct binding factor 1).
According to a first aspect of the present invention, there is provided a nucleic acid encoding a B-lymphocyte specific activator of octamer site-mediated gene Lldl ,su": 1, which interacts with the POU domain of Oct-1 and Oct-2 in order to activate gene~I dl ~51,1 i ~,t; u, I .
Such activators are referred to herein as OBF-1 and the present invention therefore relates to isolated nucleic acid (DNA, RNA) coding for OBF-1. In addition to being useful for the pnoduction of It:~iulllLJil ,~, IL OBF-1 protein, these nucleic adds are also useful as probes, thus readily enabling those skilled in the art to identify and/or isolate nucleic acid encoding OBF-1. The nucleic acid may be unlabelled or labelled with a detectable moiety.
Furthemmore, nucleic acid according to the invention is useful e.g. in a method d~ "~ li"~
the presence of OBF-1-specific nucleic acid, said method comprising hybridizing the DNA
(orRNA)encoding(or~u",~ult:",~:lllalyto)OBF-1 totestsamplenucleicacidand d~l~lllli(lillg the presence of OBF-1. In anotheraspect, the invention provides nucleic acid sequence that is cu,I~ul~ lldly to, or hybfidizes under stringent conditions to, a nucleic acid sequence encoding OBF-1.
The invention also provides a method for amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase (chain) reaction with nucleic acid (DNA or RNA) encoding (or cu" ,~le",~"Ldry to) OBF-1.
In still another aspect of the inventioR, the nucleic acid is DNA and further comprises a replicable vector comprising the nucleic acid encoding OBF-1 operably linked to control sequences It~u~u,lli~t:d by a host Llal~siullll~d by the vector. Furthermore the invention WO 95/32284 2 1 8 8 4 2 3 PCT/EP95/01834 ~
provides host cells transfommed with such vector and a method of using a nucleic acid encoding OBF-1 to effect the production of OBF-1, comprising expressing OBF-1 nucleic acid in a culture of the l~d~ ulllldd host cells and, if desired, recovering OBF-1 from the host cell culture.
Furthemmore, the present invention relates to isolated OBF-1 proteins encoded by the above-described nucleic acids.
It is an additional object to provide immunogens for raising antibodies against OBF-1 as well as to obtain antibodies capable of binding to OBF-1.
As used l~ert~ lu, t, or hereinafter, the term "isolated" is intended to refer to a molecule of the invention in an enriched or, preferably, pure form obtainable from a natural source or by means of genetic el ,ui"e~,i"g.
The isolated DNAs, RNAs and proteins of the invention may be useful in ways that the DNAs, RNAs and proteins as they naturally occur are not, such as iddl, " , of com-pounds selectively modulating the activity of Oct-1 or Oct-2.
Isolated OBF-1 nucleic acid includes nucleic acid that is free from at least one ~;ull~dlllillalll nucleic acid with which it is ordinarily associated in the natural source of OBF-1 nucleic acid.
Isolated nucleic acid thus is present in other than in the fomm or setting in which it is found in nature. However, isolated OBF-1 encoding nucleic acid includes OBF-1 nucleic acid in ordinarily OBF-1-expressing cells where the nucleic acid is in a cl~u~usv~al location different from that of natural cells or is otherwise flanked by a different DNA sequence than that found in nature.
In accul ddl l~,d with the present invention, there are provided Isolated nucleic acids, e.g.
DNAs or RNAs, encoding OBF-1, particularly ~ alid~ OBF-1, e.g. murine or human OBF-1, or fragments thereof. In particular, the invention provides a DNA molecule encoding OBF-1, or a fragment thereof. By definition, such a DNA comprises a coding single stranded DNA, a double stranded DNA of said coding DNA and Culll,ul~lllt:llldry DNA
thereto, or this uu~ l lidry (single stranded) DNA itself. Exemplary nucleic acids encoding OBF-1 are l~,ul~s~llldd in SEQ ID NOs. 1 and 3. A cDNA encoding human OBF-1 WO 95132284 2 1 ~ 8 ~ 2 3 PCTÆP95/01~4 is obtainable from plasmid pRS31 4/UNVP1 6/clone 9 which has been deposited with the Deutsche Sammlung von ' "' uu~ ",t" und Zellkulturen GmbH (DSM), ' ' ,t:,u~r Weg 1 b, D-38124 Braunschweig, under accession number 9200 on May 9, 1994.
Preferred sequences encoding OBF-1 are those having substantially the same nucleotide sequence as the coding sequences in SEQ ID NOs. 1 and 3, with the nucleic acids having the same sequence as the coding sequence in SEa ID NOs. 1 and 3 being most preferred.
As used herein, nucleotide sequences which are subsldl iti..l'y the same share at least about 90 % identity. However, in the case of splice variants having e.g. an additional exon sequence homology may be lower.
Exemplary nucleic acids can " "~ly be ~,Ilalc~ d as those nucleotide sequences which encode an OBF-1 protein and hybridize to the DNA sequences set forth in SEa ID
NOs. 1 and 3, or a selected portion (fragment) of said DNA sequence. For example, selected fragments useful for l~ , are those employed in the Examples, e.g. the cDNA used for the isolation of the mouse homologue, i.e. the 2 kb Sfi 1 cDNA insert present in plasmid pR31 41UNVP1 6/clone 9. Prefenred are such sequences encoding OBF-1 which hybridize under hi3h-stringency conditions to the above-mentioned 2 kb Sfi 1 cDNA
insert.
Stringency of hybridization refers to conditions under which polynucleic acids hybrids are stable. Such conditions are evident to those of ordinary skill in the field. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (Tm) of the hybrid which decreases ap,un~A;lllat~ly 1 to 1.5C with every 1% decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion cu"~e"~, " , and temperature. Typically, the I .j~, i " , reaction is perfommed under conditions of higher stringency, followed by washes of varying stringency.
As used herein, high stringency refers to conditions that pemmit l,~ of only those nucleic acid sequences that form stable hybrids in 1 M Na~ at 65-68 C. High stringency conditions can be provided, for example, by l ,~ u, i " , in an aqueous solution containing 6x SSC, 5x Denhardt's, 1 % SDS (sodium dodecyl sulfate), 0.1 Na+ pylu~l,u:"ul,..'~ and û.1 mg/ml denatured salmon spemm DNA as non specific competitor. Following hybridization, woss/322s4 2188423 -6- r~ c~-~4 high stringency washing may be done in several steps, with a final wash (about 30 min) at the hybridization temperature in 0.2- 0.1x SSC, 0.1 % SDS.
Moderate stringency refers to conditions equivalent to l.,rL " , in the above described solution but at about 60-62C. In that case the final wash is perfommed at the hybridization temperature in 1x SSC, 0.1 % SDS.
Low stringency refers to conditions equivalent to hybridization In the above described solution at about 50-52C. In that case, the final wash is performed at the h~L " "
temperature in 2x SSC, 0.1 % SDS.
It is understood that these conditions may be adapted and duplicated using a variety of buffers, e.g. fonmamide-based buffers, and temperatures. Denhardt's solution and SSC are well known to those of skill in the art as are other suitable hybridization buffers (see, e.g.
Sambrooketal,19890rAusubeletal.,1990).0ptimal~,JL " ~ ,conditionshavetobe dt:L~I",i"ed empirically, as the length and the GC content of the probe also play a role.
Given the guidance provided herein, the nucleic acids of the invention are obtainable according to methods well known in the art. For example, a DNA of the invention is obtain-able by chemical synthesis, using polymerase chain reaction (PCR) or by screening a genomic library or a suitable cDNA iibrary prepared from a source believed to possess OBF-1 and to express it at a detectable level.
Chemical methods for synthesis of a nucleic acid of interest are known in the art and include triester, phosphite, pl~o~ ' " and H-~,l,u~l,l,ondt~ methods, PCR and other autoprimer methods as well as oligonucleotide synthesis on solid supports. These methods may be used if the entire nucleic acid sequence of the nucleic acid is known, or the sequence of the nucleic acid u~ a~ y to the coding strand is available. Altematively, if the target amino acid sequence is known, one may infer potential nucleic acid sequences using known and preferred coding residues for each amino acid residue.
An alternative means to isolate the gene encoding OBF-1 is to use PCR technology as described e.g. in section 14 of Sambrook et al., 1989. This method requires the use of WO gSr3~284 ' 2 1 8 8 ~ 2 3 oligonucleotide probes that will hybridize to OBF-1 nucleic acid. Strategies for selection of oligonucleotides are described below.
Libraries are screened with probes or analytical tools designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries suitable means include I ~IU~1011UI Idl or polyclonal antibodies that recognize and specifically bind to OBF-1;
oligonucieotides of about 20 to 80 bases in length that encode known or suspected OBF-1 cDNA from the same or different species; andlor ;ù~ l,ul~ diy or h~molog~ lc cDNAs or fragments thereof that encode the same or a hybridizing gene. Appropriate probes for screening genomic DNA libraries include, but are not limited to oligor~ 'e '~ cDNAs or fragments thereof that encode the same or hybridizing DNA; and/or homologous genomic DNAs or fragments thereof.
A nucleic acid encoding OBF-1 may be isolated by screening suitable cDNA or genomic libraries under suitable hybridization conditions with a probe, i.e. a nucleic acid disclosed herein including oligonucleotides derivable from the sequences set forth in SEQ ID NOs. 1 and 3. Suitable libraries are cu,,l,,l~ k~l'y available or can be prepared e.g. from cell lines, tissue samples, and the like.
As used herein, a probe is e.g. a single-stranded DNA or RNA that has a sequence of nucleotides that includes between 10 and 50, preferably between 15 and 30 and most preferably at least about 20 contiguous bases that are the same as (or the complement of) an equivalent or greater number of contiguous bases set forth in SEQ ID NOs. 1 and 3. The nucleic acid sequences selected as probes should be of sufficient length and sufficiently unambiguous so that false positive results are minimized. The nucleotide sequences are usually based on conserved or highly homologous nucleotide sequences or regions of OBF-1. The nucleic acids used as probes may be ~:9t~ 1d~ at one or more positions. The use of ~gtl"~ t~ oligonucleotides may be of particular i" I~JOIldl ,~ where a library is screened from a species in which pl ~ ltidl codon usage in that species is not known.
.

Preferred regions from which to construct probes include 5' andlor 3' coding sequences, sequences predicted to encode ligand binding sites, and the like. For example, either the full-length cDNA clones disclosed herein or fragments thereof can be used as probes.
Preferably, nucleic acid probes of the invention are labelled with suitable label means for WO95132284 2 1 8 8423 -8- PCT~EP9~/01834 ready detection upon hybridization. For example, a suitable label means is a radiolabel. The preferred method of labelling a DNA fragment is by il1~u"uo,dli"~ c~æP dATP with the Klenow fragment of DNA polymerase in a random priming reaction, as is well known in the art. Oligonucleotides are usually end-labelled with ~2P-labelled ATP and polynucleotide kinase. However, other methods (e.g. non-radioactive) may also be used to label the fragment or oli30nucleotide, including e.g. enzyme labelling, fluorescent labelling with suitable fluorophores and biotinylation.
After screening the library, e.g. with a portion of DNA including substantially the entire OBF-1 -encoding sequence or a suitable oligonucleotide based on a portion of said DNA, positive clones are identified by detecting a l.~.,,i , signal; the identified clones are.:I ,a, d~ l by restriction enzyme mapping and/or DNA sequence analysis, and then examined, e.g. by ~UIII,Udli~UII with the sequences set forth herein, to ascertain whether they include DNA encoding a complete OBF-1 (i.e., if they include translation initiation and ~t,il llil l - ~ codons). If the selected clones are incomplete, they may be used to rescreen the same or a different library to obtain overlapping clones. If the library is genomic, then the overlapping clones may include exons and introns. If the library is a cDNA library, then the overlapping clones will include an open reading frame. In both ~nstances, complete clones may be identified by l,UllI,Udli::~UI~ with the DNAs and deduced amino acid sequences provided herein.
In order to detect any dbllOIl "'y of endogenous OBF-1, genetic screenin~q may be carried out using the nucleotide sequences of the invention as hybridization probes. Also, based on the nucleic acid sequences provided herein antisense-type therapeutic agents may be deslgned.
It is envisaged that the nucleic acid of the invention can be readily modified by nucleotide ~, Ih~t ~, " nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any ~ulllLil , thereof. Such mutants can be used e.g. to produce an OBF-1 mutein (mutant protein) that has an amino acid sequence differing from the OBF-1 sequences as found in nature. Mutagenesis may be ~ ~""i"~ (site-specific) or random. A mutation which is not a silent mutation must not place sequences out of reading frames and preferably will not create l,u"l,ul~",~l lldl y regions that could hybridize to produce secondary mRNA stnucture such as loops or hairpins.

21 88~23 O~Sr32284 r~,l/r,. __ ~
The cDNA or genomic DNA encoding native or mutant OBF-1 can be i~;ul,uùl~a~ intovectors for further manipulation. As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof. Selection and use of such vehicles are well within the skill of the artisan.
Many vectors are available, and selection of d,U,UIU,~ vectorwill depend on the intended use of the vector, i.e. whether d ~s to be used for DNA , "" , or for DNA expression, the size of the DNA to be inserted into the vector, and the host cell to be l,d,,:,~u,,,,ad with the vector. Each vector contains various cu,.,,uu, l~"l~ depending on its function (amplifi-cation of DNA or expression of DNA) and the host cell for which it is cu, " ' ' The vector cull,,uul,~, Ib generally include, but are not limited to, one or more of the following: an origin of replication, one or more marker genes, an enhancer element, a promoter, a lldl~SI;I', '-sequence and a signal sequence.
Both expression and cloning vectors generally contain nucleic acid sequence that enable the vector to replicate in one or more selected host cells. Typically in cloning vectors, this sequence is one that enables the vector to replicate i, ,~t~u~, "~"tly of the host .,l llu,, ,usu,"al DNA, and includes origins of replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast and viruses. The origin of repli-cation from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2u plasmid origin is suitable for yeast, and various viral origins (e.g. SV 40, polyoma, adenovirus) are useful for cloning vectors in Illdl~lll " ~ cells. Generally, the origin of replication culll,uoll~
is not needed for ",d"""dlidn expression vectors unless these are used in, lldllll llalidl l cells competent for high level DNA replication, such as COS cells.
Most expression vectors are shuttle vectors, i.e. they are capable of replication in at least one class of organisms but can be lldl l~u1t:d into another organism for expression. For example, a vector is cloned in ~Q!. and then the same vector is ll dl l~ d into yeast or idll cells even though it is not capable of replicating ill;ltl~u~ lltly of the host cell .;IIlu,,,osull,e. DNA may also be replicated by insertion into the host genome. However, the recovery of genomic DNA encoding OBF-1 is more complex than that of exogenously replicated vector because restriction enzyme digestion is required to excise OBF-1 DNA.
DNA can be amplified by PCR and be directly transfected into the host cells without any replication uo"luon~"~.

WO95/32284 2 l 8 8 423 ~o P~ .IOS4 Advantageously, an expression and cloning vector may contain a selection gene also referred to as selectable marker. This gene encodes a protein necessary for the survival or growth of lld~ ulllldd host cells grown in a seiective culture medium. Host cells not ~,a"~u""ed with the vector containing the selection gene will not survive ~n the culture medium. Typical selection genes encode proteins that confer resistancd to antibiotics and othertoxins, e.g. ampicillin, neomycin, I"e,tl,u~ alt,ortetracycline, ~,ull,ul~
auxotrophic .l~lk,iencids, or supply criUcal nutrients not available from complex media.
As to a selective gene marker ap,u, u,u~ ial~ for yeast, any marker gene can be used which facilitates the selection for lldllslullllallb due to the phenotypic expression of the marker gene. Suitable markers for yeast are, for example, those conferring rdsistance to antibiotics G418, hygromycin or bleomycin, or provide for prototrophy in an Al I ~. ..),ol~ki yeast mutant, for example the URA3, LEU2, LYS2, TRP1, or~ gene.
Since the replication of vectors is conveniently done in E. coli, an E. cûli genetic marker and an E. coli origin of replication are advd,,tageùu~ly included. These can be obtained from E.
coli plasmids, such as pBR322, Bluescript (TM) vector or a pUC plasmid, e.g. pUC18 or pUC19, which contain both E. coli replication origin and ~QL genetic marker conferring resistance to antibiotics, such as ampicillin.
Suitable selectable markers for Illall,,, ' , cells are those that enable the id~ll--'- - , of cells competent to take up OBF-1 nucleic acid, such as dihydrofolate reductase (DHFR, :lllULl~,~dl~ resistance), thymidine kinase, orgenes conferring resistance to G418 or hygromycin. The I l ldl l ll~ lalial l cell ll dl~ Ul l l ldl lb are placed under selection pressure which only those lldllalulllldlll~ which have taken up and are expressing the marker are uniquely adapted to survive. In the case of a DHFR or glutamine synthase (GS) marker, selection pressurecanbeimposedbyculturingthellall~ullllalll:~underconditionsinwhichthe pressure is progressively increased, thereby leading to . , ' " ' , (at its l..l ll UlllU:~Ull ld integration site) of both the selection gene and the linked DNA that encodes OBF-1.
All,,uli~i~dLiu,l is the process by which genes in greater demand for the production of a protein critical for growth, together with closely associated genes which may encode a desired protein, are reiterated in tandem within the ~I,,u,,,ùs~,,,es of l~culllL,il,d"l cells.
Increased quantities of desired protein are usually synthesized from thus amplified DNA.

2~ 2~
WO 95~32284 PCTIEP95/01834 EA~U~ ;UI I and clûning Yectors usually contain a promoter that is It:vuy, li~d by the host organism and is operably linked to OBF-1 nucleic acld. Such a promoter may be inducible or cu,, ~ ~c. The promoters are operably linked to DNA encoding OBF-1 by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native OBF-1 promoter sequence and many uloyuus promoters may be used to direct ~ , "" " , andlor expression of OBF-1 DNA.
Promoters suitabie for use with prokaryotic hosts include, for example, the ,~-lactamase and lactose promoter systems, alkaline ,ol~,ul Id~d~v~ the tryptophan (trp) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worher operably to ligate them to DNA encoding OBF-1, using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems will also generally contain a Shine-Delgarno sequence operably linked to the DNA encoding OBF-1.
Moreover, the OBF-1 gene according to the invention preferably includes a secretion sequence in order to facilitate secretion of the ~u'~"~,u.;de from bacterial hosts, such that it wili be produced as a soluble native peptide rather than in an inclusion body. The peptide may be recovered from the bacterial p~, iulds,,,i~ space, or the culture medium, as d~U,UI U~UI ia.l~.
Suitabie promoting sequences for use with yeast hosts may be regulated or cu,. ~ ./c and are preferably derived from a highly expressed yeast gene, especially a Savul ldl u~ u~
cerevisiae gene. Thus, the promoter of the Il~ ! gene, the ~ or 9~ gene, the acid ul~ùs,ullcldv~ (~) gene, a promoterof the yeast mating pl~u~u~e genes coding forthe ~- or ~-factor or a promoter derived f rom a gene encoding a glycolytic enzyme such as the promoter of the enolase, y'yvr,l~ l Iyde-3-phosphate dehy~i,uy~"ase (GAP~. 3-phospho glycerate kinase (~ exuhi, l~e, pyruvate dt~ ù~yids~, phosphofnuctokinase, giucose-6-phosphate isomerase, 3-,ui,u:,,ulloy~ve,~l~ mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase or glucokinase genes, or a promoter from the TATA binding protein (TBP) gene can be used. Furthermore, it is possible to use hybrid promoters comprising upstream activation sequences (UAS) of one yeast gene and wos~/32284 21 88423 -12- r~ lh~t4 eal" promoter elemenis including a functional TATA box of another yeast yene, for example a hybrid promoter including the UAS(s) of the yeast PHQ5 gene and ' . ~
pnomoter elements including a functional TATA box of the yeast GAP gene (~i-~e hybrid promoter). A suitable constitutive ~ promoter is e.g. a shortened acid pllo~ dlc,:,e PH05 promoter devoid of the upstream regulatory elements (UAS) such as the PH05 (-173) promoter eiement starting at nucleotide -173 and ending at nucleotide -9 of the gene.
OBF-1 gene lldl~ fnom vectors in ",dm(, ' l hosts may be controlled by promotersderived from the genomes of vinuses such as polyoma vinus, adenovinus, fowlpox vinus, bovine papilloma vinus, avian sarcoma vinus, cyl ~ s (CMV), a retrovinus and Simian Vinus 40 (SV40), from heterologous ~ lldliall promoters such as the actinpromoter or a very strong promoter, e.g. a ribosomal protein promoter, and from the promoter nommally associated with OBF-1 sequence, provided such promoters are c-,", ' 'e with the host cell systems.
Tl ~ UIi~Jtl~ of a DNA encoding OBF-1 by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are relatively orientation and position il~dl~,Ut~ t'lll. Many enhancersequences are known from ~a~ alia~l genes (e.g.
elastase and globin). However, typically one will employ an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) and the CMV early promoter enhancer. The enhancer may be spliced into the vector at a position 5' or 3' to OBF-1 DNA, but is preferably located at a site 5' from the promoter.
Advantageously, a eukaryotic expression vector encoding OBF-1 may comprise a locus control region (LCR). LCRs are capable of directing high-level integration site in"~ "dt:"l expression of lldl ,~y~ s integrated into host cell chromatin, which is of importance especially where the OBF-1 gene is to be expressed in the context of a pe""d~lt~"lly-I,d,,~ ulttdeukaryoticcelllineinwhich~l,,u,,~oso,~,dlintegrationofthevectorhasoccurred,in vectors designed for gene therapy; ,), ' ,s or in transgenic animals.
Suita~le eukaryotic host cells for expression of OBF-1 include yeast, fungi, insect, plant, animal, human, or nucleated cells from other ml llti~r~ r organisms will also contaln WO95/32284 1~_I/r~ 4 sequences necessary for the l~""i"~.';Jn of l, dns~ iun and for stabilizing the mRNA. Such sequences are commonly available from the 5' and 3' ul lll dl~ dl~d regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments lldl l:,~,libts~ as polyadenylated fragments in the u, Illdn~ldl~:d portion of the mRNA encoding OBF-1.
An expression vector includes any vector capable of expressing OBF-1 nucleic acids that are uue, ..ti icly linked with regulatory sequences, such as promoter regions, that are capable of expression of such DNAs. Thus, an expression vector refers to a ~ ,u"~I,i"a"l DNA or RNA constnuct, such as a plasmid, a phage"~" ,L,i~,d"l vinus or other vector, that upon introduction into an d~JlU,Uli.~t~ host cell, results in expression of the cloned DNA.
Appropriate expression vectors are well known to those with ordinary skill irl the art and include those that are replicable in eukaryotic and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome. For example, DNAs encoding OBF-1 may be inserted into a vector suitable for expression of cDNAs in Illdlll " , cells, e.g. a CMV enhancer-based vector such as pEVRF (Matthias et al., 1989).
Particularly useful for practising the present invention are expression vectors that provide for the transient expression of DNA encoding OBF-1 in Illdllllll " ~ cells. Transient expression usually involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell ~rr~ ~m~ t~s many copies of the expression vector, and, in tum, synthesizes high levels of OBF-1. For the purposes of the present invention, transient expression systems are useful e.g. for identifying OBF-1 muteins, to identify potential phosphorylation sites, or to ,lldld~ rl~ functional domains of the protein.
Construction of vectors according to the invention employs conventional ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the fomm desired to generate the plasmids required. If desired, analysis to confimm correct sequences in the ~ull~llu~l~d plasmids is perfommed in a known fashion. Suitable methods for constructing expression vectors, preparing in vitro transcRpts, introducing DNA into host cells, and perfomming analyses for assessing OBF-1 expression and function are known to those skilled in the art. Gene presence, dll, "" 1 and/or expression may be measured in a sample directly, for example, by conventional Southem blotting, Northem blotting to quantitate the l~dl ,~ , of mRNA, dot blotting (DNA or RNA analysis), or in situhybridization, using an d~JUlU~ y labelled probe based on a sequence provided herein.

woss/32284 21 88423 -14- PCT/EPg5/0I834 Suitable methods include those described In detail in the Examples. Those skilled in the art will readily envisage how these methods may be modified, if desired.
In ac ;U Vd" ,~ with another ulllb~i,llt lll of the present invention, there are provided cells containing the above-described nucleic acids (i.e., DNA or mRNA). Such host cells such as prokaryote, yeast and higher eukaryote ceils may be used for replicating DNA and pro-ducing OBF-1. Suitable prokaryotes include eubacteria, such as Gram-negative or Gram-pos~tive organisms, such as E. coli, e.g. E. coli K-12 strains, DH5a and HB1û1, or Bacilli.
Further hosts suitable for OBF-1 encoding vectors include eukaryotic microbes such as filamentous fungi or yeast, e.g. Saccharomyces cerevisiae. Higher eukaryotic cells include insect and vertebrate cells, particularly ", , cells. In recent years ~", ~~, 1 of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful Illdllllll , host cell lines are epithelial orfibroblastic cell lines such as Chinese hamster ovary (CHO) cel~s, NIH 3T3 cells, HeLa cells or 293T cells. The host cells referred to in this disclosure comprise cells in 'n vitro culture as well as cells that are within a host animal.
DNA may be stably i, ,cu, ,uulal~d into cells or may be transiently expressed using methods known in the art. Stably lldrl~ V Illd~ cells may be prepared by lldl~ t;lly cells with an expression vector having a selectable marker gene, and growing the 1, dl l~ d cells under conditions selective for cells expressing the marker gene. To prepare transient lldll~ "llldllllll ,cellsaretransfectedwithareportergenetomonitorl,cl"~t"tiv, efficiency.
To produce such stably or transiently transfected cells, the cells should be 1, dn~ d with a sufficient amount of OBF-1 -encoding nucleic acid to fom~ OBF-1. The precise amounts of DNA encoding OBF-1 may be empirically determined and optimized for a particular cell and assay.
Host cells are lldll~ l or, preferably, lldll~ullll~d with the above-captioned expression or cloning vectors of this invention and cultured in ~ul . ~ ivnal nutrient media modified as d~JUIuuridl~ for inducing promoters, selecting ll ~ lu~lll ll ll~, or amplifying the genes encoding the desired sequences. I l~ ..uluguus DNA may be introduced into host cells by any method known in the art, such as lldll~ iVII with a vector encoding a h~lu,vloJu~s WO 9S/32284 2 ~ 8 8 4 2 3 pcT,Ep9s/ol834 DNA by the calcium phosphate cu~ technique or by ele~,l, u~JUI ~ . Nul~erous methods of lldl ,~ ,,ti~", are known to the skilled worker in the field. Successful 1, al lalt:~;ti~
is generally recognized when any indication of the operation of this vector occurs in the host cell. Tldll~rUlllldliUIl is achieved using standard techniques c~ ,UlUpli~'~ to the particular host cells used.
Il ,~;u, ~urdliul~ of cloned DNA into a suitable expression vector, I, al ~ ..tiol1 of eukaryotic cells with a plasmid vector or a c~",l,ir, " ~ of plasmid vectors, each encoding one or more distinct genes or with linear DNA, and selection of lldl I~ d cells are well known in the art (see, e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press).
Transfected orlld,,~lu,,,,ed cells are cultured using media and culturing methods known in the art, preferably under conditions, whereby OBF-1 encoded by the DNA is expressed. The COI I r ~' I of suitable media is known to those in the art, so that they can be readily prepared. Suitable culturing media are also cu"""e,~ available.
While the DNA provided herein may be expressed in any suitable host cell, e.g. those referred to above, preferred for expression of DNA encoding functional OBF-1 areeukaryotic expression systems such as baculovinus-based systems and, particulariy, ~dl~ dlid~ expression systems, including cu"""~ J available systems and other systems known to those of skill in the art, which express the Oct-1 protein and/or the Oct-2 protein (either endogenously or ,~c~" ,~i, Idl ,::J).
In preferred ~ o ii~ , OBF-1 encoding DNA is ligated into a vector, and introduced into suitable host cells to produce lldll~rUll~t`d cell lines that express OBF-1. The resulting cell lines can then be produced in quantity for reproducible qualitative and/or quantitative analysis of the effect(s) of potential dnugs affecting OBF-1 function. Thus OBF-1 expressing cells may be employed for the id~l 1"" " ~ of c~",uou".l~, particulariy small molecules capable of p~ ldlill~ the nucleus, which compounds enhance the specific interaction between OBF-1 and Oct factors (agonists), thereby increasing the potency of OBF-1. By contrast, in situations where it is desirable to tone down the activity of OBF-1, dllldgU~ illg molecules interfering with the Oct I OBF-1 interaction are useful. Yet another altemative to achieve an al lla~ul liali-; effect is to rely on o~ iu~ ~ of antisense OBF-1 RNA. Thus wo 95/32284 2 ~ 8 8 4 2 3 -1 6- Pr~r/EPss/ols34 host cells expressing OBF-1 are useful for druy screening and it is a further object of the present invention to provide a method for identifying compounds which modulate the activity of OBF-1, said method comprising exposing cells containing hetPr~logous DNA encoding OBF-1, wherein said cells produce functional OBF-1, to at least one compound or signal whose ability to modulate the activity of said OBF-1 is sought to be d~'~,,."in~d, and thereafter monitoring said cells for changes caused by said modulation. Such an assay enables the id~ ' , of agonists, hll~dyu~ b and allosteric modulators ûf OBF-1.
Cell-based screening assays can be designed e.g. by constructing cell lines in which the expression of a reporter protein, i.e. an easily assayable protein, such as p ~J~ P
,_lllu,d"",l~dni~ol acetyii,d"~ (CAT) or luciferase, is dependent on OBF-l . Such an assay enables the detection of c~,,,uuur,~ that directly modulate OBF-1 function, e.g.
compounds that antagonize OBF-1, or compounds that inhibit other cellular functions required for the activity of OBF-1. An in vitro assay for OBF-1 requires that it may be produced in large amounts in a functional fomm using It,Cu",~i"~t"I DNA methods. An assay is then designed to measure a functional property of the OBF-1 protein, e.g. interaction with Oct-1 or Oct-2. An exemplary in vitro assay is the ~ I,u~l~u,~lk, mobility shift assay (EMSA) as described in the Examples.
Furthemmore, by interacting with Oct-1 or Oct-2 in B cells, OBF-1 modulates the activity of these L, dl l~ factors and thus is capable of contributing directly to the regulation of lg genes expression. Thus OBF-1 may be useful for boosting lg production, e.g. for boosting "~o~lo~lul lal antibody production. This can be achieved, for example, by ove,~A,u,~i"y in B
cells OBF-1 itself or even more potent OBF-1 based hybrid proteins such as, for example, a VP1 6-OBF-1 chimera. By contrast, in situations where it is desirable to tone down the production of Igs, molecules interfering wlth Oct factor/ OBF-1 expression may be useful.
The invention a~culdillyly provides an expression system which is regulatable directly or indirectly by OBF-1, comprising a host cell which is lldl ,~ ld~le with one or more vectors which encode a desired protein. Oct proteins, which are necessary for OBF-1 activity, may be provided exogenously, by transfected ~u~ Idl ~ dl ,~,i, , unit(s) or may be endogenous to the host cell. Likewise, OBF-1 may be endogenous to the host cell, but preferably it is provided by means of a I~UIII~ dlll lldll~ tiUI~ unit expressing an OBF-1 gene.

21 8~423 WO 9S/32284 ~ . S'01834 I~ has been found that OBF-1 is expressed mostly in cells of Iymphoid origin. Thus the present invention also provides a method to exogenously affect OBF-1 dependent processes occurring in such cells. Recu"~i"~."l OBF-1 producing host cells, e.g." ,~" " "alid,~ cells, can be contacted with a test compound, and the rm~d~ ~' "~ effect(s) thereof can then be evaluated by comparing the OBF-1-mediated response in the presence and absence of test compound, or relating the OBF-1-mediated response of test cells, or control cells (i.e., cells that do not express OBF-1), to the presence of the compound.
As used herein, a compound or signal that modulates the activity of OBF-1 refers to a compound that alters the activity of OBF-1 in such a way that the activity of OBF-1 is different in the presence of the compound or signal (as compared to the absence of said compound or signal).
The invention also provides a transgenic non-human mammal which has been modified to modulate the expression of endogenous OBF-1. Preferablyl the transgenic non-human mammal is a transgenic mouse. For example, therefore, a transgenic mouse may be designed in which OBF-1 production is greatly reduced or eliminated Alternatively, the transgenic mouse of the invention may express elevated levels of OBF-1, or may be subject toregulationofOBF-1 expressioninad~J~Iu~u,,,~,,t~ ortissue-specificmanner,orvia control by exogenous agents. Study of such an animal provides insights into the illlpul~allu~ of OBF-1 in vivo.
Moreover, the invention provides a ll~ll , 1 unit encoding OBF-1 for use in a method of treatment of a condition involving aberrant lg gene expression by gene therapy techniques.
The lld~ ti~ l1 unit provided according to the present aspect of the invention comprises regulatable control regions which include a promoter, together with one or more enhancers and/or LCRs. The lld~ unit may be delivered to the subject by any suitable means, including viral vectors, especially retroviral vectors, adeno- and adeno associated viral vectors, non-viral delivery systems, including liposomal and antibody targeted delivery systems, and direct uptake of naked DNA. The target tissue is advantageously a Iymphoid tissue and preferably the lldl l~ iUI l unit is delivered to l~ stem cells. In an advantageous ~Illbo ii~ , the l~ac""dlu~.r,;~, stem cells are removed from a patient, ~, dn~ d ex vivo and subsequently retumed to the patient. Altematively, the cells may be targeted in vivo, forexample using antibodytargeting d,u,u,uaul,es.

wo 95/~22r~4 2 i 8 8 4 2 3 -18- PcT/EPss/olr134 Also provided are proteins encoded by an above-described nucleic acid. The invention therefore comprises a B-lymphocyte specific activator of octamer site-mediated gene lldl ~5-,1i, " ), whlch ~nteracts with the POU domain of Oct-1 and Oct-2 in order to activate gene lldl l~ . Such proteins are designated OBF-1 (Oct binding factor 1). Being a l,d"~-,,i,uliun factor, OBF-1 is capable of influencing Ildllauli, ,. This biological activity can be shown in a suitabie assay such as a ~,d"~a~ . ) assay, e.g. the assay as described in the Examples.
Preferabiy, the protein of the invention is provided in isolated fomm. "isolated" OBF-1 means OBF-1 which has been identified and is free of one or more ~ ,uun~l ,i, of its naturai environment. isolated OBF-1 includes OBF-1 in a It:~,UllliJilldll~ cell culture. OBF-1 present in an organism expressing a It:Cull,iJil,a"~ OBF-1 gene, whether the OBF-1 protein is "isolated" or otherwise, is included w~thin the scope of the present invention.
OBF-1 inciudes the amino acid sequences of human and murine OBF-1 set forth in SEa ID
NOs. 2 and 4"t,~l-e~ ly, as weli as peptides comprising all or part of said sequences and additional sequences, p~ , ' or peptide fragments of said sequences and the OBF-1 protein producible from the plasmid pRS314/UNVP16/clone 9. The definition of OBF-1 Includes functional or immunogenic equivalents of OBF-1. For the purposes herein, "functional equivaient" means a protein dispiaying the in vivo effectorfunction that is directiy orindirectiyperfommedbyOBF-1 (whetherinitsnativeordenaturedcu,,~u,,, ~),orby any subsequence thereof. Effector functions inciude receptor binding and activation, induction of dil~ " ~, DNA regulatory functions and the like.A pfincipai known effector function of OBF-1 is its ability to interact with Oct-1 and Oct-2.
"Immunogenic equivalent" means a protein or peptide having the antigenic functions of OBF-1. Antigenic functions includes pUs5~55iUII of an epitope or antigenic site that is capable of cross-reacting with antibodies raised against a naturaliy occurring or denatured OBF-1 poiypeptide or fragment thereof. Thus OBF-1 as provided by the present invention includes splice variants encoded by mRNA generated by altemative splicing of a primary transcript, amino acid mutants (muteins), glycosylation variants and other covalent derivatives of OBF-1 which retain the physiological and/or physical properties of OBF-1.
Exempiary derivatives include moiecules wherein the protein of the invention is covalently W09~132284 P~ o~4 modified by sl IhCtit~ ~, chemical, enzymatic, or other d,~ JIV,~JI id~e means with a moiety other than a naturally occurring amino acid. Such a moiety may be a detectable moiety such as an enzyme or a ,~ is~ .P Further included are naturally occurrin3 variants of OBF-1 found with a particular species, preferably a mammal. Such a variant may be encoded by a related gene of the same gene family, by an allelic vafiant of a particular gene, or represent an alternative splicing variant of the OBF-1 gene.
OBF-1 muteins may be produced from a DNA encoding OBF-1 which has been subjected to in vitro mutagenesis resulting e.g. in an addition, exchange and/or deletion of one or more amino acids. For example, s~ ' " Idl, deletional or insertional variants of OBF-1 are prepared by It7culllbilldlll methods and screened for immuno-~ilu~alt:d.,'i~;~y with the native fomms of OBF-1.
A protein of the invention is obtainable from a natural source, e.g. from nuclear extracts of Iymphoid cells, by chemical synthesis or by ~t:~,r."ll,ind"l techniques. Due to its capability of competing with the endogenous OBF-1 counterpart for an endogenous ligand, a fragment displaying a selective ~i"~;alogical ~ ': of OBF-1, e.g. a fragment interacting with Oct-1 or Oct-2, is envisaged as a therapeutic agent. The invention accul ~ ly provides OBF-1 for use in medicine.
Moreover, the invention provides a method for preparing a protein of the invention ~l lal dul~ d in that suitable host cells producing said protein are multiplied ~n~ or in vivo. Preferably, the host cells are lldllalull~ d (lldll~ ,~d) with a vector comprising an expression cassette comprising a promoter and a DNA sequence coding for OBF-1 which DNA is controlled by said promoter. Subs~:ql,t:"lly, the protein of the invention may be recovered. Recovery comprises e.g. isolating the protein from the culture broth or from the host cells. Preferred is a method for PILr- I of a functionally active protein. Any method known in the art for purification of proteins from l~Ulll~ dl ,I cell culture may be used, including chemical s~ t " ~ of proteins produced as inclusion bodies. Preferably, however, the protein is produced in soluble form and advantageously it is secreted by the host Illi~,lUUlydl~i~lll.
OBF-1 may also be derivatized in vitro, e.g. to prepare illl ' ' ' OBF-1 and labelled OBF-1, e.g. for affinity purification of OBF-1 antibodies.

w09~2284 2 1 88 423 -20~ 0~4 The pn~teins o~ the invention are useful e.g. as immunogens, in drug screening assays, as reagents for immunoassays and in purification methods, such as affinity purification of a binding ligand, and as therapeutics.
In ac-,u"l~l"ce with yet another t "II,r,~i",~"l of the present invention, there are provided antibodies r ~ ~ " 'ly It:~,uy~ ;"y and binding to OBF-1. For example, such antibodies may be generated against the OBF-1 having the amino acid sequences set forth in SEa ID Nos.
2 or 4. Alternatively, OBF-1 or OBF-1 fragments (which may also be synthesized by in vitro methods) are fused (by l~culllbilldlll expression oran in vitrû peptidyl bond) to an immunogenic polypeptide and this fusion polypeptide, in tum, is used to raise antibodies against an OBF-1 epitope.
Anti-OBF-1 antibodies are recovered from the serum of immunized animals. Altematively, " ,u,lo~lu,lal antibodies are prepared from cells in vitro or from in vivo immunized animals in conventional manner. Preferred antibodies identified by routine screening inhibit the interaction of OBF-1 with Oct-1 or Oct-2.
The antibodies of the invention are useful for studying OBF-1 tissue localization, screening of an expression library to identify nucleic acids encoding OBF-1 or the structure of functional domains, as well as in diagnostic ,, " - Ia~ for the purification of OBF-1, and the like.
The invention particularly relates to the spedfic e"~odi",~"l~ as described in the Examples which serve to illustrate the present invention but should not be construed as a limitation thereof.
FYAmvle 1: CloninrJ of OBF-1 In order to isolate OBF-1, a protein specifically interacting with Oct proteins, an .e,i",~l,ldl approach based on the two-hybrid technique (Chien et al., 1991) was used. In that technique, the protein of interest is expressed in yeast cells (S. cerevisiae) as a fusion protein with a DNA binding domain (DBD; this is hybrid protein #1). Usually, the DBD of the yeast llal l:,~;l 'r " I factor Gal4 is used. This yeast strain also contains a reporter gene whose activity can be easily assayed and which is under the control of Gal4 binding sites.

WO 9513~84 2 1 8 8 4 2 3 PC~ P95/~11834 On its own the fusion protein should not acUvate ~Idl I ', " I biyl 1"' ,tly above the background level. A cDNA library is then prepared in a yeast expression vector such that the cDNA (derived from the dU,UlU,Ulidi.~ cell line or tissue) is fused randomly to a lldl 1~;1', " I activation domain active in yeast (this is hybrid protein #2, thus the name two-hybrid). If a particular cDNA encodes a protein (or protein domain) interacting with the target protein (and if the cDNA is in-frame with the expression vector-derived activation domain) anelevatedll~,s~,,i," ~fromthereportergenecanbemeasured.Thecr,,,t~ u,,di,,y cDNA can then be rescued from the yeast cells, amplified in E. coli and further.
To isolate OBF-1 the principle of the method by Chien et al. has been modified, in that an intact Oct protein (i.e. not Oct fused to a heterologous DBD) is used as target. The reasoning underiying said rr, " ) is that proteins containing 2 DBDs (i.e. the luloyuus one and the endogenous Oct DBD) may be inactive when tested functionally.
Anintactproteinismorelikelytohavetheproperthree-~i,,,~,,siu,,alstnucturethatmightbe required for proper interaction. The method used is described in brief below, and in detail in sections 1.1 to 1.5 which follow.
A plasmid is constructed to express an essentially intact Oct-1 protein from a c~"l,u",~
yeast vector, using the promoter and termination sequences of the yeast TATA binding protein gene. To ensure a proper nuclear targeting of the Oct-1 protein in yeast, a nuclear , sequence (NLS) derived from the SV4û T-antigen protein is enyi"e~,~" at the N
temminus of Oct-1.
The his 3 gene, which codes for the enzyme imidazole glycerol phosphate d,:l l,ri,d~dse (IGP), an enzyme required for the i,iusy, Ill lt~ , of the amino acid histidine, is used as a reporter gene. When histidine is absent from the growth medium his 3 gene expression is required for growth (e. 9. Struhl, 1983). In addition, a ~ull.r ~/c inhibitor of IGP exists, 3-dlllil~ullid~ul~ (3-AT), which allows the use of the his 3 gene as a selectable marker. In the presence of increasing amounts of 3-AT in the medium, only those yeast cells that have an elevated his 3 expression (due to increased lldll , , of the his 3 gene) can grow.

woss/32284 2 1 88423 -22- Pcr/EPss/01834 A his 3 reporter is made which contains, in the his 3 promoter upstream of the TATA box, six copies of an octamer site derived from the lg heavy chain intron enhancer (YlpS5-AT/H36) .
This reporter constnuct is reintroduced in yeast at the oriqinal his 3 locus, to generate the strain called Y:AT.H36. In this strain the expression vector coding for Oct-1 is then ~ntroduced, generating the screening strain Y:AT.H36/OCT1.
An inducible expression vector is constructed which contains the lldl~ activation domain from VP16, a very potent lldl I , '- 1 activator from Herpes Simplex Vinus, under the control of a hybrid Gall -1 0/his 3 promoter (pRS31 4/UASG-NLS.VP1 6(Sfi1)). This vector allows the expression, upon galactose induction, of fusion proteins between the VP16 activation domain and any cDNA that is inserted du. Iall~dlll of it. Using this expression vector a cDNA library with mRNA extracted from the human B cell line Namalwa (ATCC CRL-1432) is constnucted Plasmid DNA is then prepared from the cDNA library and used to transform the yeast strain containing the his 3 reporter and expressing Oct-1. This allows the isolation of a cDNA coding for OBF-1, a novel protein General techniaues: Unless specified otherw~se, all l~cull~billallI DNA plasmids are constnucted using standard techniques (e.g. restriction digestion, gel ~l~u1lu~ sia, ligation, fill-in reactions, DNA sequencing, polymerase chain reaction, efc...) as described in Ausubel et al., 1990 and Sambrook et al., 1989. Yeast media are, unless specified otherwise, as described by Shemman in Guide to Yeast Genetics and Molecular Biolo3y, Methods in Cr, y,,,ulu~y, vol. 194, pp. 3-21 (1991). In particular, the following media are used:
1 % (W/v) Bacto-yeast extract (Difco), 2 % (w/v) Bacto-peptone, 2 % (w/v)glucose or galactose (for galactose, a quality containin3 less than û.01 % glucose should be used;
Sigma).
YPAD: as YPD with the addition of 0.01 volume of 0.25 % adenine.
minimAI m~i nn lA~ na u~^il Anrl tryDtoPhAn (CM medium~: û.67 % (w/v) casamino acids (Difco), 0.67 % (w/v) yeast nitrogen base without amino acids (Difco), 2 % (w/v) glucose, 0.01 volume of û.25 % (w/v) adenine.
Synthetic medium IA~ a histidine and cQntAining AT: Q.17 % (w/v) yeast nitrogen ba3e without amino acids and AmSO4 (Difco), û.5 % (w/v) ammonium sulfate, 2 % (w/v) glucose WO 95/32284 -23- Pcr/EPss/als34 or galactose, 0.01 volume of each: 0.5 % (w/v) tryptophan, 0.25 % (w/v) uracil, 1 % (w/v) leucine, 0.25 % (w/v) adenine, 1 % (w/v) Iysine. 3-A,,,inul, id~ule (AT) is added at the Cl,U,UI U,U~ id~e CU~ 11,~11l dliUI-.
FOA (5-fluoroorotic add) medium: is made with CAA medium su,u,ulelllelll~i with 0.1% (w/v) FOA, 0.01 volume of 0.5 % (w/v) tryptophan and 0.02 volume of 0.25 % (w/v) uracil.
Solid medium for plates contains, in addition to the above, 2 % agar.
F ~ ,u~ i" ,~ dl.
1.1 Constnuction of the yeast vector expressing Octl .
The Oct1 protein is expressed constitutively from a single copy plasmid using the native lldl ISI,I i,u~;ol Idl initiation and l~" "i" 1 signais of the yeast TATA binding protein (TBP) gene.
The parental plasmid p2DN-1 from which these reguiatory sequences are derived carries a 2.3 kb Pstl-BamH1 genomic fragment containing the entire yeast TBP gene and extending 1 kb upstream and 500bp ~u . ,al, ed", of the coding region (Commack et al, 1991). This gene differs from wiid type by the presence of an EcoR1 site introduced upstream of the naturaliy occurring ATG initiator codon ( ~ GAATTCAT ATG; Commack et al., 1991).The promoter and 5'-u, l~ldl l~ d region of the TBP gene is first subclone~ as a ca. 1 kbp Psti-EcoR1 fragment into pUC19 (Yanisch-Perron et al., 1985) between the Psti and EcoR1 sites, before being introduced into pRS316 (Sikorski and Hieter, 1989) as a Hind3 (from the pUC19 polyiinker)-EcoR1 fragment, resuiting in piasmid pRS316.TBP5'. pRS316 is aC~ lulllelil, plasmid carrying the URA 3 selectable msrker.
An Ndel site is introduced at the first ATG of the Octl sequence described by Stumm et al.
(1988) by polymerase chain reaction (PCR) using pBS-Oct1 + (Sturm et al., 1988) as template and the foilowing forward and reverse oligonucleotide primers:
forward 5 ' -GGG CAT ATG AAC AAT CCG TCA G~A ACC-3 ' reverse 5 ' -GAG TAG TA~ CTG TTG CTG GGC AGG-3 ' .
The resulting 375 bp PCR fragment is then directly iigated into the pCRII vector from a T/A
cloning kit (Invitrogen) and the DNA sequence of the resulting clone called pCRII/Oct1 (Nde)5' is confirmed. A complete Oct-1 cDNA with the Nde1 site at the ATG is then reconstnucted by ligating the three DNA fragments described below:
- a ca. 390 bp Nsi1 (from the pCRII polylinker)-Nhel fragment (containing the Nde1-modified Oct-1 ATG) prepared from pCRII/Oct1(Nde)5\
- a ca. 2100 bp Nhel-Hind3 fragment which contains the C terminal region of Oct-1 including stop codon prepared from pBS-Oct1 + (Stumm et al. 1988) - the accepting vector is Bluescript KS- (Stratagene) which is cleaved with Pstl (compatible with Nsi1) and Hind3.
The resulting correct clone is called BlueKS-/Oct1 Nde5'-3'.
The final Oct-1 expression vector is then iulla~lu~ d by ligating four DNA fragments as followS:
- a double-stranded oligonucleotide is sy"ll,~si~d which has 5' EcoR1 and 3' Nde1 compatible single-stranded extensions and provides an ATG as well as a nuclear ' " ~ sequence (NLS) derived from SV40:
5'-AATTCAAA ATG CCC ~AG A~G AAG CGG ~AG GTC CA-31 31 -GTTT TAC GGG TTC TTC TTC GCC TTC CAG GTAT-5 ' - ca. 2450 bp Nde1-Hind3 fragment encoding the Oct-1 protein (with the Nde1-modified ATG) prepared from BlueKS-/Oct1 Nde5'-3';
- a ca. 500 bp Hind3-BamH1 fragment comprising the 16 carboxy-temminal residues of yeast TBP and extending 460 bp in the 3' non coding region prepared from p2DN-1 (Commack et al., 1991);
- the accepting vector is the previously described pRS316 derivative pRS31 6.TBP5' contalning the 5' regulatory region and promoter of the yeast TBP gene. This plasmid is cleaved with EcoR1 and BamH1 (site found in the pRS316 polylinker).
The resulting final plasmid is confimmed by DNA sequencing and is called pRS31 6/TBP5'3'-OCT1 .
1.2 Constnuction of the his 3 reporter allele AT.H36 Our selection strategy relies on the u~s~l ~/dl;ul ~ that only yeast cells expressing induced levels of the his 3 gene will grow in the presence of 3-~,,i,,ul,i~,~ule (AT), a c~" ./c inhibitor of the his 3 gene product. A his 3 allele with six octamer sites 73bp upstream of the TATA box is constnucted from Ylp55-Sc3760, an integrative plasmid carrying the URA 3 wo 95~32284 PCT/EP9S/01834 selectablemarkerandcontaininga6.1kbpsegmentofyeastul"u",vsu",alDNAwiththeentire pet56-his 3-ded1 gene region (Harbury and Struhl, 1989).
First, a synthetic double-stranded oligonucleotide with Xho1 and EcoR1 compatible protruding ends 5 ' -TCGAG(-~r.Z~ CATAG~AGTACGCTAGATTTAGGG
CGTCTTCTAGTATCTTCATGCGATCTA~ATCCCTTA~-5 ' is inserted between the Xho1 and Kpn1 sites of pGEM-7Zf(-) (Promega), together with a 70ûbp long EcoR1-Kpnl fragment obtained from Ylp55-Sc376û which includes the promoter and most of the coding region of the his 3 gene (called here his 3 promoter fragment). In the resulting plasmid, the unique EcoR1 site (which is just upstream of the his

3 gene TATA box) is then eliminated by a filling reaction done with Klenow polymerase and the construct thus obtained is called GEM.his 3. Eco~.
A ca. 3ûûbp Xhol fragment containing 6 copies of an octamer motif (called here 6x octa fragment) derived from the mouse immunoglobulin heavy chain intron enhancer (positions 518-564; numbering as in Ephrussi et al., 1985) is obtained from p6W+, a pUC derivative (described in Gerster et al., 1987). The 6x octa Xhol fragment is first inserted into the Xhol site of BluescriptKS- and results in clone Blue6W. In Blue6W, the former Hinfl site of the IgH enhancer DNA fragment (position ca. 56û) is next to the Kpn1 site of the Bluescript polylinker.
The final reporter construct is then made by ligating together three fragments:
- the ca. 300 bp 6x octa fragment (prepared from Blue6W by digestion with Kpn1, treatment with T4 DNA polymerase to eliminate the Kpn1 3' overhang and subsequent digestion with EcoR1 ) - the ca. 700 bp his 3 promoter and coding region fragment (prepared from Gem.his 3.
Eco~ by digestion with Xho1, filling of the 3' recessed end with T4 DNA polymerase, and subsequent digestion with Kpn1) - the accepting vector is the large (ca. 8kbp) EcoR1-Kpn1 fragment from Ylp55-Sc3760.
These various steps effectively replace the native EcoR1-Kpn1 fragment from Ylp55-Sc3760 by the chimeric 6x octa-his 3 promoter fragment, and generate the final reporter plasmid called Ylp55-AT/H36.

4 2 1 ~ 8 4 2 3 PCT/EP95/01834 The nucleotide sequence of the Ylp55-AT/H36 promoter region, presented from the EcoR1 site 5' of the 6x octa fragment to the 4th nucleotide past the end of the his 3 TATA box, is as presented below. The borders of the 6 times repeated IgH enhancer fragment, the oct site and the his 3 TATA box are highlighted in bold.

5 ' -GAATTCGATATCAAGCTTATCGATACCGTCGaCCTCGAGA
T (CTGl~,r.r~ r~rr~CCTGGGTAATTTGCATTTCTAA
AATAAGTCGA) 6X CTGAATcTcGAGGGGGl~(~cc~lc~AG
CAGAAGATr~T~r.~i~r.TACGCTAGATTTAGGGAATTAATT
CCTATA~AGTAA-3 ' 1.3 Construction of the parentai yeast strain Y:AT.H36/OCT1 The screening of the library expressing hybrid proteins between the VP16 activation domain and random cDNA-encoded pu~yp-,: '~ requires a yeast strain containing an integrated copy of the AT/H36 his3 allele and expressing ~,u,, ~ iciy OCT1.
After li,,ed,is~Liun of Ylp55-AT/H36 with Xba1, the AT/H36 his 3 allele is introduced into yeast strain KY32û (Chen and Struhl, 1988) by gene It:~ld~ llL of the his 3-D200 allele exactly as described (Scherer and Davis, 1979). The resulting Ura+ integrants are then grown on ,-u"st,le~ti~ YPD medium before being streaked on 5-fluoroorotic acid (5-FOA) plates. This step selects against the URA 3 gene and hence for the loss of the piasmid sequence as a result of homologous ,~,o,.,l,i, , events between the parental and the new copies of the his 3 gene. The segregants that retain the AT/H36 his 3 allele are identified by their ability to grow in medium lacking histidine.
The final Y:AT.H36/OCT1 strain is generated by introducing pRS31 6/TBP5'3'-OCT1 into the segregant with the desired His+ phenotype using the iithium-acetate method (Becker and Guarente, 1991 ) and selecting for growth on plates lacking uracil.
1.4 Construction of an inducibie yeast expression vector for the cDNA library The library of hybrid proteins between the VP16 acidic activation domain and random cDNA
fragments is expressed from a u~,,L,u,,,t,-i~ plasmid undercontrol of the tightly regulated gal-his 3 hybrid promoter. This expression vector is constructed as follows.

wo951322~4 2 1 8 8 ~23 ~ 10.4 The 365 bp Gal1-10 UASG element fused to the his 3 promoter is derived from plasmid 3801 (Singer et al., 1988) by PCR, using the following forward and reverse oligonucleotide primers:
for~vard 5 ' -TCTAGA GTCGAC G;~TCAAAAATCATCGC-3 ' reverse 5 ' -CCG GAATTC 11 lGCl,l lCGTTTATCTTG CC-3 ' .
This step introduces an EcoR1 site just upstream of the his 3 ATG initiator codon and a Sal1 site upstream of the Ga11-10 UASG element. The PCR reaction is carried out using as template DNA a derivative of plasmid 3801 in which the unique EcoR1 restriction site located between the UASG and the his 3 TATA box is deleted by filling the recessed 3' temmini resulting from EcoR1 digestion with the Klenow fragment of DNA p~ . ,e,a~e 1. The PCR product is digested with Sal1 and EcoR1 and inserted into pUC19 for DNA
sequencing. The resulting clone is called pUC1 9.Gal.his 3.
The VP16 ac~dic activation domain (amino acids 413 to 490) is amplified by PCR from plasmid pMSVP16 D1 D3 (Triezenberg et al., 1988), using the following forward and reverse oligonucleotide primers:
forward 5 ' -CCC GAATTC ACCATGGCCCCCCCGACCGATGTC-3 ' reverse 5 ' -CCG CATATG CCCACCGTACTCGTCAATTC-3 ' .
This step introduces a 5' EcoR1 site flanking an ATG initiator codon fused in frame to Ala-413 of the VP16 coding region, and replaces the native VP16 TAG stop codon by a Nde1 site. After treatment with T4 DNA polymerase and subsequent cleavage with EcoR1, the PCR product ~s cloned bet~veen the EcoR1 and Sma1 sites of pUC19 to generate pUC1 9NP16. The DNA sequence of the clone is confimned.
A nuclear lo~;,,'i~.,.';v,, sequence is subsequently fused in frame to the amino terminus of the VP16 activation domain by ligating three fragments as follows:
- a Hind3-Nde1 (Klenow filled-in) ca. 1 kbp fragment inc~uding the 5' flanking region of yeast TBP coding region and sequences encoding the NLS prepared from pRS316tTBP5'3'-- an EcoR1 (Klenow filled-in)-BamH1 (from the pUC polylinker) fragment prepared from pUC19/VP16 encoding the VP16 activation domain - the accepting vector is pRS314 (Sikorski and Hieter, 1989) cleaved with Hind3 at the polylinker site (partial dig~t) and BamH1.

WO 95132284 2 1 8 8 4 2 3 PcrlEP9sl01834 The gal-his :3 hybrid promoter prepared from pUC19.Gal.hls 3 is then introduced into this didlt: construct as a Sall-EcoR1 fragment between the Xhol (compatible with Sal1) and EcoR1 sites, hence replacing the TBP promoter region upstream of the NLS.VP16 coding sequence. The unique EcoR1 site present in this plasmid (located 5' of the NLS.VP16 coding sequence) is deleted by filling the EcoR1 recessed 3' temmini with T4 DNA puly,~ d:,e. The resulting plasmid is called pRS314/UASG-NLS.VP16.
The final expression vector is prepared by inserting, at the 3' end of the VP16 activation domain (Nde1 site) in pRS3141UASG-NLS.VP16, a cDNA cloning cassette comprising a800 bp long stufferfragment derived from the ~I,Iu,d",,ul~:ni~ol acety' ~ ,d~e (CAT) geneflankedbynon-, " Idlullli-,Sfi1 sitesandthe3'~t:,,,,indliu,,signalsoftheyeastTBP
gene. This is done as follows:
Two double-stranded phosphorylated adaptors having non-, " ,d,u,,,i~ Sfi1 extensions are synthesized; these adaptors are kinased and annealed and have the following sequence:
5 ' -TATGGAATTCCGGCCGCAC-3 ' 3 ' - ACCTTAAGGCCGGC-3 ' dsAdaptor and 5 ~ - ~u-.~rr~c~rTGACTAGGTAC-3 ' 3 ' -CACGCCGGCGATTGACTGATC-3 ' dsAdaptor 2 dsAdaptor1 provides a Nde1 5' overhang and contains an intemal EcoR1 site; dsAdaptoR
introduces stop codons in each lldll ' ". ~dl reading frame (CGGCCGCTAACTGACTAGGTAC) and provides a 3' Kpn1 overhang.
An equimolar mixture of these two adaptors is first ligated for 3 hrs to ca. 1 ~Lg of the purified 800 bp CAT Sfil fragment prepared from plasmid EBO-Sfi (Steimle et al., 1993).
Unligated adaptors are then eliminated by selective iau,ulu~ llol u,. , - ~ with ammonium acetate (Sambrook et al., 1989), and the adaptor-ligated CAT DNA fragment is then resuspended in TE. At this point the CAT fragment is a mixture of CAT fragments having a copy of dsAdaptor1 at each end, or a copy of dsAdaptoR at each end, or dsAdaptorl at one end and dsAdaptor2 at the other end. Only this latter fnagment having two different adaptors will be efficiently ligated in the subsequent ligation step which is perfommed by ligating together the following fragments:
- the adaptor-ligated CAT fragment mentioned above, ~ WO 95/32284 ' 2 1 8 8 4 2 3 PCTÆPgS/01834 - the TBP 3' I~""i, l ~ signals as a ca. 500bp Kpn1-BamH1 fragment. To prepare this fragment, pRS31 6/TBP5'3'-OCT1 is cleaved with Hind3, the 3' recessed ends are fi~led with T4 DNA polymerase, and the plasmid is subsequently cleaved with BamH1. The resulting ca. 500bp fragment is then isolated and subcloned between the Sma1 and BamH1 sites of pUC19. It can then be excised form this new clone as the Kpn1-BamH1 fragrnent mentioned just above.
The accepting vector is pRS314/UASG-NLS.VP16 deaved with Nde1 and BamH1.
Restriction analysis and DNA se4ut:"-;i"g allows to identlfy the final clone having the following structure: Gal-his3 ~)Iulllul~l/NLSNP16 activation domain/ Nde1-EcoR1-Sfi1-CAT-Sfi1-stop3x-Kpn1/3' TBP temmination signals-BamH1. This expression vector is called pRS31 4/UASG-NLS.VP1 6(Sfl1 ) .
1.5 Construction of an activation domain-tagged cDNA library derlved from B cell mRNA
cDNA synthesis Total RNA is isolated from the human B Iymphoid cell line Namalwa (ATCC CRL 1432) using an RNA Extraction Kit from Pharmacia (product # 27-9270-01 ) and following exactly the manufacturers instructions. A total of 3 x 108 cells are used and ca. 4.5 mg of total RNA
is obtained. The RNA is diluted in sterile 10 mM Tris pH 7.5,1 mM EDTA (TE) to a con-centration of 2 mg/ml and an aliquot (0.8 ml, equivalent to ca. 1.6 mg) is used for mRNA
purification using an mRNA Purificdtion Kit from Pharmacia (product #27-9258A), following exactly the manufacturers ill~lluuti~ (as ,t:~,on""~:"ded In the manual, two successive oligo-dT columns are used). A total of ca. 75 ,ug polyA+ RNA is obtained (i.e. yield ca.
4.6%).
cDNA is synthesized using a Superscrlpt Choice System from Life T~,l " lol~ s (product # 530-8090SA). To 5 ~9 of polyA+ RNA, 2 1ll of oligodT (tube A1 ) and 1 ul of random hexamer (tube A2) are added; after 10 min at 70C, the mixture is chilled on ice. To that tube, 0.5 1ll RNAsin (Promega), 4 1ll 5x first strand buffer (tube A3), 2 1ll 0.1 M DTT, 1 ~ul dNTPs (tube A5) and 1 ILI a-~P-dATP (Amersham, diluted 1:5; 0.666 pmole) are added. The first strand synthesis reaction is started by adding 5 111 S~ IrP~t~npt reverse lldl ~ iuldse (from the kit) and incubating the reaction for 60 min at 42C. The reaction is then ~Idl~ l.l on ice. To the tube the following are added sequentially: 93 1ll H20, 30 ul 5x second strand buffer (tube B1), 3 1ll dNTPs (tube A5), 1 1ll E. coli ligase (tube B2), 4 ~11 WO 9S/32284 2 1 8 8 4 2 3 PCI/EP95/01834 ~

E. coli DNA polymerase Itube B3), 1 1ll RNAse H (tube B4). The neaction is incubated for 2 hours at 1 6C, 2 ul T4 DNA polymerase (tube B5) are added and the reaction is incubated for another 10 min at 1 6C and then finally quenched on ice. 10 ,ul 0.5 M EDTA and 16 111 3M NaAc are added, the reaction is extracted with phenol: chlorofomm (1:1), and the nucleic acids in the supernatant are ~J,. , ' by addition of 425 111100 % EtOH. The sample is centrifuged in a microfuge, washed with EtOH 80 %, resuspended in 75 ~LI TE and passed over a Sepharose 4CLB column to get rid of the small cDNAs (SizeSep column from Phammacia; product # 27-5105-01 ) following exactly the manufacturers instructions.
The eluate is divided in three equal aliquots (of ca. 20 ul each) and each aliquot is used for a separate ligation reaction to double-stranded Sfi1 adaptors, in each lldl l:~ldt;~ l ,al reading frame. The adaptors have previously been kinased and annealed and have the following sequence:
5 ' -AGGCCAI~AG-3 ' 3 ' -GTGTCCGGTTTC-5 ' - -5 ' -AGGCCA~AGC- 3 ' 3 ~ -GT(~ c~ cG-5 ~
5 ' -AGGCCA~AGCG-3 ' 3 ' -GTGTCCGGTTTCGC-5 ' Each ligation reaction contains 20 1ll cDNA and 190 pmoles kinased and annealed adaptor In a final volume of 30 ,ul. After 15 hrs at 1 6C the 3 reactions are pooled and ~ ,;ldlt:d with NH4Ac and EtOH. The cDNA is collected by centrifugation, washed with 80% EtOH
and resuspended in 100 1ll TEN (10 mM Tris pH 7.5;1 mM EDTA; 25 mM NaCI). The cDNA
is then size-l,~"ti~" Idl~d by passing over a Sephacryl column (provided in the cDNA
synthesis kit), following exactly the manufacturers instructions. The different cDNA fractions are EtOH pl~ dl~d individually, and each cDNA pellet is finally resuspended in 10 ul TE.
Preparation of the vector for library construction 13 ,ug of the pRS31 4/UASG-NLS.VP1 6(Sfi1 ) vector are digested for ca. 14 hr with ca. 30 u.
Sfi1 under mineral oil. The reaction is then p~ dl~d with NH4Ac and EtOH, the DNA is 21 8~423 i-- WO 9S13~2S.4 31 ~ ~,1111 ,~_lnS4 collected by centrifugation and resuspended in 200 ,ul TE. The cut vector is deposited on 2 sucrose gradients prepared (as described by Kieffer, 1991) in SW41 centrifuge tubes. The gradients are centrifuged for 16 hrs at 30 000 rpm in a SW41 rotor. The lower band (vector) Is collected, the EtBr is removed by 1-Butanol extraction, the sample is diluted with 1 vol.
H20 and the DNA is ,u~ , ' ' ' with isuu,uud,~ol after adjusting the NaCI vu"~ "' " , to û.2 M (final) and adding 12mg linear polyvvlyldl~lidt~ as carrier. The vector DNA is collected by centrifugation and resuspended in TE at a cu,~c~": , of ca. 50 ng/~.
cDNA ligation and E. coli lldllafulll "
Ligation reactions are set up with 50 ng vector (prepared as above) and varying amounts of siZe-lld-it;ùl-d~d, Sfi1 adaptors-ligated cDNA in 20 1ll reactions containing 5û mM Tris pH
7.6, 1û mM MgCI2, 1 mM ATP, 5% (w/v) PEG 8000, 1 mM DTT and 20 u T4 DNA ligase (N.
E. Biolabs). After ligation for 12 hrs at 16 C, the DNA is phenol and phenol-CHCI3 extracted and then EtOH p,~ui,uildled after addition of NaAc. (0.3 M final ;u"c~"l, ' ~) and 1.5mg yeast RNA as carrier. The DNA is collected by centrifugation, the pellet is washed extensively with 80% EtOH and then It:su~u~" i~d in 4 ul TE. 1 1ll of each ligation is then used for vlvullupul " , of ElectroMax DH1 ûB el~,,l,uvu" I,U~ bacteria (Life Te.:l " luluyivs product # 530-8290 SA) following exactly the manufacturers instructions. On the basis of the number of lld"a~u" "dl lb obtained the optimal cDNA:vector ratio is ~i~t~ ed and additional ligation reactions are set up and subsequently processed as described.
cDNA library dl, "" " ~
The products Cullt~:,,uull iilly to several el~l,.r " ,s as described above are pooled (co"~,uu" ii"g to a total numberof ca. 8 x 106 individual lldllalulllldllb) and plated onto LB/agar plates containing 100 ~lg/ml ampicillin at a density of 50 000 colony fomming units (cfus)/132 mm plate. After ovemight growth at 37C, the colonies are washed from the plates with LB medium and pooled. An aliquot Cull~:~,uull iilly to ca. half of the sample is frozen away for future l~dl 11, "" " ~, and the rest is used for plasmid DNA ~ ,UdldliUI I
using a Magic Maxiprep Kit from Promega (product # A7270). The resulting DNA is then used for the yeast screening.
Screening of the VP1 6.cDNA fusion library The library of fusion proteins is introduced into the yeast screening strain Y:AT.H36/OCT1 according to Schiestl and Gietz (1989), with the following ", "" " s.

w0 ss/32284 ~ 1 8 8 4 ~ 3 -32- r~ s4 1 an overnight culture, grown to 1x107 cellslml in glucose minimal medium lacking urdcil to maintain selection for the plasmid expressing OCT1, is diluted to 2x1 o6 cells/ml in fresh YPADmediumandregrownto1x107cells/ml.Cellsfroma50mlcultureareresuspendedin 500 ul TE/LiAc buffer and directly mixed with 20 jl9 cDNA library plasmid DNA and 500 119 human polyA~ RNA. After 30 min incubation at 30C with agitation, the cell suspension is dispensed equally in five eppendorf tubes. The subsequent steps are done exactlyaccording to the published protocol. After heat shock, the cells are pooled and incubated for 1 hour at 30C in 500 ml of YPAD with agitation. The complexity of the library (2x1 o6 i" lt,~uel~d~"l double lldll~lUlllldllt~) is estimated by plating an aliquot of the culture on glucose minimal plates lacking uracil and tryptophan. Tldll~lulllldllla are recovered by centrifugation, inoculated into 500ml of glucose minimal medium lacking uracil and tryptophan to select for double lldll~U llldlli~, and incubated for 16 hr at 30C, at which time the culture consists of d,u,uluA;,lldl~ly 25% Trp+/Ura+ cells. An aliquot of the culture (7x108 cells ,~:,u,~s~ 1.7x108 lldll~lUlllldllla) is harvested by centrifugation, resuspended in 50ml YP medium su,uul~,,,~,,l~d with galactose, and incubated for 5 hr at 30C with constant agitation. This step, during which the cells do not divide, is required to induce the expression of the hybrid protein library. After centrifugation, the cells are resuspended in 5mi TElLiAc buffer, and the lldll~Ulllldlli~ plated on galactose synthetic medium lacking histidine and containing 10mM AT; d,u,uluA;,lldl~ly 2x107 cells (5x106 double l,d,~lu""a"la) are plated on each of 20 plates.
After 10 days incubation at 3ûC, 20 to 30 d",inul,id ul~ resistant colonies are observed on each plate. Fifty five of them are grown on synthetic medium lacking tryptophan but containlng uracil before being plated on medium containing 5-fluoroorotic acid (5-FOA), a drug that selects against cells expressing OCT1 from the URA 3 plasmid (Sikorski and Boeke, Guide to Yeast Genetics and Molecular i3iology, in Methods in Enzymology vol. 194, pp 3û2-318, 1991). The resulting Ura~/Trp+ segregants are then tested for growth on AT-containing medium. Only six of the l,d"~u""d"l~ loose their ability to grow on AT whentheir OCT1 plasmid is cured, this suggests that these clones require both Oct1 and the cDNA library plasmid for growth. This phenotype is confirmed more directly by rescuing the VP1 6.cDNA containing plasmids from 5-FOA resistant colonies according to Robzyk and i~assir (1992), and reintroducing them individually into the parental Y:AT.H36 yeast strain in presence or absence of the OCT1 expressing vector. Growth on 10 mM AT-containingmedium is observed only in the presence of the Oct-1 plasmid. Thls defin~tively confimms WO 95/32284 PCT/~P9~/01834 that both Oct-1 and the cDNA library plasmid-encoded protein are required for growth and therefore genetical~y defines an interaction between these two proteins.
Partial sequence analysis and restriction mapping of the cDNA inserts reveals that four of them represent three i,ldept~"~ "l clones derived from the same mRNA uu"~ li"g to a novel gene which we call OBF-1 (Oct Binding Factor 1). One clone referred to as pRS31 4/UNVP1 6/clone9 has been deposited with the DSM under accession no. 9200.
Several u,r~.ld~,uil ,~ restriction fragments from one of the rescued human OBF-1 cDNA
ciones (pRS314/UNVP16/clone9) are subcloned in pUC19 or Bluescript and their DNAsequence is d~ t7d. Analysis of the sequence obtained (SEQ ID No.1 ) shows that OBF-1 is an entinely novel gene, with no homology to any sequence present in theGenEMBL database (searches done with several different programs such as FASTA, tFASTA or the BLAST series of programs).
ExamDle 2: Murine OBF-1 By homology hybridisation the mouse homologue of OBF-1 is also isolated from a cDNA
library prepared from the mouse B cell line S194. As a probe, the ca. 2 kbp Sfi cDNA insert presentinhumanclonepRS314/UNVP16/clone9, DSMaccessionnumber9200)isused.
The hybridisation is performed at 67 C for 16 hours in a solution containing 6 x SSC (20 x SSC is: 3 M NaCI, 0.~ M trisodium citrate), 5 x Denhardt's (100 x Denhardt's Is 2 % (w/v) bovine serum albumin, 2 % (w/v) Ficoll 400, 2 % (w/v) polyvinylpyrollidone), 0.5 % SDS
(sodium dodecyl sulfate) and 0.1 mg/ml denatured salmon spemm DNA. The filters are then washed as follows: 2 x 5 min at room l~lllyt:ldlUI~7 in 2 x SSC, 0.1 % SDS, 3 x 30 min at 60C in 2 x SSC, 0.1 % SDS; 2 x 30 min at 60 C in 1 x SSC, 0.1 % SDS. Several clones are isolated and confimmed by secondary and tertiary screenings under the same conditlons.
The nucleotide sequence of the mouse OBF-1 cDNA (SEQ ID No. 3) is d~l~""i"ed after progn~ssive deletions are generated from either end of the cDNA subcloned in Bluescript IIKS+-The OBF-1 cDNA can also be isolated from another species (e.g. rat) by using a PCR-based strategy. Degenerate primers (because of the genetic code de~"e,dcy) can be deslgned on the basis of the presented sequence allowing to amplify a DNA fragment ~U~ di~ ~9 to part of the OBF-1 cDNA (the "quality" or "efficacy" of these primers can be evaluated by performing test reactions with the mouse or the human clone). With such WO9~/32284 2 ~ 8~423 -34- PCT/EP95/01834 prjmers available, it is then possible to attempt the ~ , "" , o~ the ,u,,~:-,uu,,di,,g DNA
fragment from the species of interest, by using cDNA derived from B cells (or any other OBF-1 expressing cells) from that species (an already prepared cDNA library is also suitable for that purpose). The amplified DNA fragment can then be subcloned in a standard vector and its nucleotide sequence detemmined. Once the correct fragment is obtained (on the basis of the sequence similarity with the presented mouse or human OBF-1 sequence), it can then be used to rescreen cDNA libraries from the species of interest in order to isolate a complete OBF-1 clone from that species.
The conceptually translated sequences cu"""~:"~;i"g at the first ATG of both OBF-1 clones (human and mouse) produce 256 amino acid OBF-1 proteins (SEO ID Nos. 2 and 4) which do not contain any known protein motif (such as a leucine zipper, a l ,u",eo~c",di", etc.).
Except for its richness in proline residues (39 residues in the human clone, 41 in the mouse clone) OBF-1 does nût show any obvious feature. Known ~Idl la~,l ', '- ~ factors, such as CTF-1, have been shown to be fich in proline residues and to contain proline-rich activation domains (Memmod et al., 1989). Thus it is possible that some of the proline residues of OBF-1 might serve a similar function.
FY~mDle 3: Pattem of expression of the OBF-1 gene Northem blot analysis of RNAs from various sources, either organ (polyA+ RNAs) or cell lines (total RNAs), shows that OBF-1 expresslon is highly restricted. In the expressing cells or organs a major RNA species is detected ca. 3.û to 3.2 kb in size.
Analysis with a ~ d probe derived from hOBF-1 (the ca. 2 kb Sfi1 cDNA insert present in pRS31 4/UNVP1 6/clone 9) shows strong expression in spleen and peripheral blood leukocytes, weak expression in thymus and small intestine and no detectable expression in prostate, testis, ovary and colon (polyA+ RNAs). Analysis of total RNA derived from various human cell lines shûws strong expression in Namalwa and BJA-B (B cell lines), weak expression in Molt3 and Hut78 (T cell lines) and in HepG2 (I~,udlucy'~), and no detectable expression in the following cells: K562 (myeloid leukemia), U937 (monocyIt,/l"a~,upl-age), 293T (fibroblast), HeLa (cervix carcinoma, epithelial), MCF-7 (mammary carcinoma). Furthemmore, analysis of total RNA from several mouse B cell lines with the mouse OBF-1 probe gives the following pattem: illlt lllldd;~ to high expression in J558L, MPC11 and S194 B cell lines and weak expression in 7ûZ/3, 4ûE-1, 18-81 and 22û-8 pre-B cell lines.

W095132~84 2 1 8 8 4 2 3 F~ . 4 ln conclusion the expression of the OBF-1 gene is highly cell-specific, being expressed mostly in cells of Iymphoid origin. In addition the gene appears to be dc~ t-ll'y regulated, as several pre-B cell lines show siy" " Illy lower levels of expression than the mature B cell lines tested.
FY~m~le 4: Interaction between OBF-1 and Oct factors The yeast assay genetically identifies an interaction between Oct-1 and OBF-1. To directly d~l l lul l~ at the uiu~ ",i-,al level this interaction, the hOBF-1 cDNA was recloned in pEVRF, a CMV enhancer-based expression vector suitable for expression of cDNAs in Illdlll " I cells (Matthias et al., 1989) giving rise to plasmid pEV-OBF. The pEV-OBF-1 constnuct was made by ligating together the three DNA fragments indicated below:aSma/toSfilfragmentfrompEVRFO(Matthiasetal., 1989~;thisfragment contains the ampicillin resistance gene, prokaryotic origin of replication and CMV eukaryotic ~u,u" ,u~ "l ,a~ , sequences as well as an ATG translation initiation codon in an optimised context;
an Eco ~1 (filled in) to Hind 1/1 OBF-1 cDNA fragment from plasmid pRS314/UNVP16/clone 9; this fragment is derived from the complete 08F-1 cDNA clone (the Eco Hl site is derived from the vector and the H~nd 111 site is within the 3' u, l~ldl l::>ld~d region of the OBF-1 cDNA) and includes the 5' leader sequences present in the sequence shown as Seq ID No: 1; and aHindllltoSfilfragmentfromplasmidp3S/2-457(Muller-l,,,,,,~,ylu.,hetaL, 1990): this fragment contains splice and polyadenylation signals derived from the rabbit ,B-globin gene (the fragment is nommally found in pEVRF vectors and was derived from p3S/2-457 simply because of the presence of a convenient Hind 111 restriction site).
The pEV-OBF-1 plasmid leads to the expression, in eukaryotic cells, of the OBF-1 protein with translation starting at the ATG deRved from the pEVRF vector.
The pEV-OBF-1 plasmid was then transiently transfected, alone or in ~;u, "~i" ~ with an Oct-2 expression vector (OEV1~, Muller et al, 1988), into 293T cells, a highly I, dl lal~;ldbll:!
human fibroblastic cell line. After 2 days nuclear extracts were prepared from the Ildl~ d cells and used in an el~,upl~u,~, mobility shift assay (EMSA, also called gel retardation or gel shift assay; Rezvin, 1989) done with a labelled DNA probe containing an octamer site derived from the intron heavy chain enhancer (similar to a monomer of the oct 21 88~

site present in plasmid Ylp55-AT/H36) While the control extract yave rise to only one shift due to the endogenous Oct-1 protein, the extrast from OBF-1 transfected cells yave rise to 2 shifts; the Oct-1 shift, and a sesond shift of lower mobility (a so-called supershift higher up in the gel) due to the complex between endogenous Oct-1 and transfected OBF-1.
Similarly, the extracts from cells Cutld~ J with OBF-1 and Oct-2 gave rise to yet additional shifts due to either Oct-2 alone or to the complex between Oct-2 and OBF-1. A
sontrol reaction was perfommed w~th an extract from 293T cells that had been ~iulldl lal~tt:d with expression vectors for OBF-1 and PU.1, a lldll~ factor from the Ets family. In that case, with the d~UUlU,Ul;dl~ DNA probe containing a PU.1 binding site, only a single complex due to PU.1 was observed, indicating that OBF-1 does not interast with PU.1.
This result biu~ l'y ~ IVrl~lldl~ that OBF-1 can interact specifically with both Oct-1 and Oct-2, and that it does not interact with a l,d":,~,ir , factor from a different family, PU.1. Furthemmore the OBF-1 / Oct-2 interaction was also dtll~lullblldl~d in the yeast assay using a yeast strain expressing the Oct-2 protein.
Additional lldl~ l,tiul~s have been similarly perfommed with expression vectors expressing only the POU domain of Oct-1, Oct-2 or Oct-6, another Oct factor of the POU family. The results obtained showed that the POU domain of either Oct-1 or Oct-2 is sufficient for interaction with OBF-1: by contrast, the POU domain of Oct-6 does not interact detectably with OBF-1. This suggests that OBF-1 is a cofastor specific for Oct-1 and Oct-2, but not for other Oct family members. OBF-1 does not appear to bind to DNA by itself.
FYslrrlDle 5: OBF-1 based lldllsd~th/dl~d expression system To assay whether OBF-1 can directly influence 1, dl ,~, i, " as would be expected from a coactivator, a llm ,~a~,tii~tcd Illdlllllldlidll expression system was designed. In this system, an expression plasmid encoding a desired poly~ , in this case a reporter polypeptide, is cotransfected with a second plasmid directing expression of OBF-1 (pEV-OBF) or with an empty expression vector as a control, and the resulting activity from the reporter is measured after 2 to 3 days. The expression plasmid used contains a promoter with an octamer motif (derived from the intron heavy chain enhancer) controlling lldl ~s~ of the luciferase ~ene (this reporter is based on the pGL2-enhancer plasmid from Promega and the promoter is identical to the promoter present in the OCTA(1 ) plasmid described by Muller et al., 1988). The result obtained shows that OBF-1 activates lldll~;li, , from this plasmid ca 1û fold (through the endogenous Oct-1 protein). Additional lldll~d~;~i,r.ltiul~
e,~,ue,i,,,e,,b done in HeLa cells and with other reporter plasmids confimm the initial results.

2 1 ~8423 As expected, activation by OBF-1 is dependent of tne integrity of the oct site present in the promoter of the reporter plasmid.
Thus, although no l~ I activation domain is clearly evident from the conceptually translated OBF-1 protein sequence, it appears that OBF-1 is a strong ~ a~ , activator, - perhaps defining a novel class of such proteins. It is perhaps the first cell-specific cua,'i ~tvl to be isolated.
DeDosition D51t~
On May 9, 1994 plasmid pRS314/UNVP16/clone9 was deposited with the Deutsche Sammlung von ~ .o,~ und Zellkulturen GmbH (DSM), M~ ,u~e, Weg 1 b, D-38124 Braunschweig, und~r accession no. 92û0.

n~ "~
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. &
Stnuhl, K. eds. (1990) Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
Becker and Guarente, Guide to Yeast Genetics and Molecular Biology, in Methods in Enzymology vol. 194, pp 182-187,1991 Chen, W. & Struhl, K. (1988) PNAS 85, 2691-2695 Chien, C.-T., Bartel, P. L., Stemglanz, R. & Fields, S. (1991) PNAS 88, 9578-9582 Corcoran, L. M., Karvelas, M., Nossal, G. J. V., Ye, Z.-S., Jacks, T. & Baltimore, D. (1993) Genes Dev. 7, 570-582 Commack, B. P., Stnubin, M., Ponticelli, A. S. & Struhl, K. (1991) Cell 65, 341-348 Dalton, S. & Treisman, R. (1992) Cell 68, 597-612 Dreyfus, M., Doyen, N. & Rougeon, F. (1987) EMBO J. 6, 1685-1690 Ephrussl, A., Church, G. M., Tonegawa, S. & Gilbert, W. (1985) Science 227, 134-140 Gerster, T., Matthias, P., Thali, M., Jiricny, J. & Schaffner, W. (1987) EMBO J. 6, 1323-1330 Guthrie, C. & Fink, G. R. eds. (1991) Guide to Yeast Genetics and Molecular Biology, in Methods in Enzymology, vol. 194 Harbury, & Stnuhi, K. (1989), Mol. Ceii. Biol. 9, 5298-5304 Herr, W., Stumm, R. A., Clerc, R. G., Corcoran, L. M., Baltimore, D., Sharp, P. A., Ingraham, H. A., Rosenfeld, M. G., Finney, M., Ruvkun, G. & Horvitz, H. R. (1988) Genes Dev. 2, Johnson, D. G., Carayd", luuuulO~, L., Capra, J. D., Tucker, P. W. & Hanke, J. H. (1990) Mol. Celi. Biol. 10, 982-990 Kieffer, B. I. (1991) Gene 109,115-119 LaBeila, F., Sive, H. L., Roeder, R. G. & Heintz, N. (1988) Genes Dev. 2, 32-39 LeBowitz, J. H., Kobayashi, T., Staudt, L. M., Baitimore, D. & Sharp, P. A. (1988) Genes Dev. 2, 1227-1237 Luo, Y., Fujii, H., Gerster, T. & Roeder, R. G. (1992) Cell 71, 231-241 Matthias, P., Muiler, M. M., Schreiber, E., Rusconi, S. & Schaffner, W. (1989) NAR 17, 6418 Memmod, N., ONeill, E. A., Kelly, T. J. & Tjian, R. (1989) Ceil 58, 741-753 Muller, M. M., Ruppert, S., Schaffner, W. & Matthias, P. (1988) Nature 336, 544-551 Muller-lmmergluck, M. M., Schaffner, W. and Matthias, P. (1990) EMBO J. 9, 1625-34 Peterson, M. G. & Baichwal, V. R. (1993) TiBTECH 11, 11-18 Pierani, A., Heguy, A., Fujii, H. & Roeder, R. G. (1990) Mol. Cell. Biol. 10, 6204-6215 Revzin, A. (1989) Biotechniques 7, 346-355 W095132~84 r~.,~. -D~4 Robzyk, K & Kassir, Y. (1992) NAR 20, 3790 Sambrook, J., Fritsch, E. & Maniatis, T. eds. (1989) Molecular Cloning: A Lrlboratory Manual, Cold Spring Harbor Laboratory Press, New York Scholer, H. R., I IA~7- ro~los A. K., Balling, R., Suzuki, N. & Gnuss, P. (1989) EMBO J. 8, Scherer, S. & Davis, R. W. (1979) PNAS 76, 4951-4956 Schiestl, R. H. & Gietz, R. D. (1989) Current Genetics 16, 339-346 Sikorski, R. S. & Hieter, P. (1989) Genetics 122,19-27 Singer, V., Wobbe, R. C. & Stnuhl, K. (1990) Genes Dev. 4, 636-645 Staudt, L. M., Clerc, R. G., Singh, H., LeBowitz, J. H., Sharp, P. A. & Baltimore, D. (1988) Science241, 577-580 Staudt, L. M. & Lenardo, M. J. (1991) Annual Rev. Immunol. 9, 373-398 Steimle, V., Otten, L. A., Zufferey, M. & Mach, B. (1993) Cell 75,135-146 Stnuhl, K. (1983) Cold Spring Harbor Symposia on Quantitative Biology vol. XLVII, pp.901-Sturm, R. A., Das, G. & Herr, W. (1988) Genes Dev. 2,1582-1599 Triezenberg, S. J., Kingston, R. C. & McKnight, S. L. (1988) Genes Dev. 2, 718-729 Van Dljk, M. A., Voorhoeve, P. M. & Murre, C. (1993) PNAS 90, 6061-6065 Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33,103-119 Wirth, T., Staudt, L. M. & Baltimore, D. (1987) Nature 329,174-178 ~0-SEQUENCE LISTING
~1) GENERAL INFORMATION:
( i ) AP PL ICANT:
~A) NAME: CIBA-GEIGY AG
(B) STREET: EClybeckstr. 141 (C) CITY: Basel (E) COUNTRY: SCHWEIZ
(F) POSTAL CODE (ZIP): 4002 (G) TELEPHONE: +41 61 69 11 11 (H) TELEFAX: + 41 61 696.79 76 (I) TELEX: 962 991 (ii~ TITLE OF INVENTION: Factor Interacting With Nuclear Protein (iii) NUMBER OF ~ yu~;Ne~:g: 4 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) soFTnARE: PatentIn Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS: : -(A) LENGTH: 9û9 base pairs (B) TYPE: nucleic acid (C) sTRANn~nN~.c~: single (D) TOPOLOGY: linear 21 ~8423 WO 95132284 ~1- PCr/EP95/OlU4 (ii) MOLECULE TYPE: cDNA
( ix ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 97..864 (D) OTHER INFORMATION: ~LuJu~L- "human OBF-1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
L~ CACTGGAGGA ~r~r~rrc CGGTCTCACA TT~ Pr.r. CAAACTGTCG 60 GCTTCA~AGA f~ CA'~ ~A CAGGCC ATG CTC TGG CAA A~A CCC 114 Met Leu Trp Gln Lys Pro ACA GCT CCG GAG C~A GCC CCA GCC G GCC CGG CCA TAC CAG GGC GTC 162 Thr Ala Pro Glu Gln Ala Pro Ala Pro Ala Arg Pro Tyr Gln Gly Val 1û 15 20 CGT GTG AAG GAG C~A GTG AAG GAA CTG CTG AGG AGG AAG CGA GGC CAC 210 Arg Val Lys Glu Pro Val Lys Glu Leu Leu Arg Arg Lys Arg Gly His Ala Ser Ser Gly Ala Ala Pro Ala Pro Thr Ala Val Val Leu Pro His CAG CCC CTG ~CG ACC TAC ACC ACA GTG GGT CCT TCC TGC CTG GAC ATG 3 0 6 Gln Pro Leu Ala Thr Tyr Thr Thr Val Gly Pro Ser Cys Leu Asp Met 55 6û 65 70 Glu Gly Ser Val Ser Ala Val Thr Glu Glu Ala Ala Leu Cys Ala Gly WO 95l32284 2 1 8 8 4 2 3 PCTIEP9~/01834 ~
~2-Trp Leu Ser Gln Pro Thr Pro Ala Thr Leu Gln Pro Leu Ala Pro Trp 90 95 . : lOQ ==
ACA CCT TAC ACC GAG TAT GTG CCC CAT GAP. GCT GTC AGC TGC CCC TAC 450 Thr Pro Tyr Thr Glu Tyr Val Pro His Glu Ala Val Ser Cys Pro Tyr 105 110 . 115 Ser Ala Asp Met Tyr Val Gln Pro Val Cys Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser Pro Pro Leu Ile Thr Asn 135 _ 140 .~ 145 . 150 GTC ACG ACA AGA AGC TCC GCC ACG CCC GCA GTG GGG CCC CCG CTG G~G 5 9 4 Val Thr Thr Arg Ser Ser Ala Thr Pro Ala Val Gly Pro Pro Leu Glu Gly Pro Glu Xis Gln Ala Pro Leu Thr Tyr Phe Pro Trp Pro Gln Pro Leu Ser Thr Leu Pro Thr Ser Thr Leu Gln Tyr Gln Pro Pro Ala Pro 185; 190 195 GCC CTA CCT GGG CCC CAG TTT GTC CAG CTC CCC ATC TCT ATC CCA G~G 738 Ala Leu Pro Gly Pro Gln Phe Val Gln Leu Pro Ile Ser Ile Pro Glu 200 . 205 210 --CCA GTC CTT CAG GAC ATG G~A GAC CCC AGA AGA- GCC GCC AGC TCG TTG 786 Pro Val Leu Gln Asp Met Glu Asp Pro Arg Arg Ala Ala Ser Ser 1eu Thr Ile Asp Lys Leu Leu Leu Glu Glu Glu Asp Ser Asp Ala Tyr Ala W0 95132204 2 1 8 8 4 2 3 A ~ l l r.l _ ~o~4 -43- =

Leu Asn llis Thr Leu Ser Val Glu Gly Phe (2) INFORMATION ~OR SEQ ID NO: 2:
( i ) SEQUENCE CE~RACTE~ISTICS:
(A) LENGTH: 256 amino acids (B) TYPE: amino acid (D~ TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
Met Leu Trp Gln Lys Pro Thr Ala Pro Glu Gln Ala Pro Ala Pro Ala Arg Pro Tyr Gln Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu Arg Arg Lys Arg Gly His Ala Ser Ser Gly A~a Ala Pro Ala Pro Thr Ala Val Val Leu Pro His Gln Pro Leu Ala Thr Tyr Thr Thr Val Gly Pro Ser Cys Leu Asp ~et Glu Gly Ser Val Ser Ala Val Thr Glu Glu Ala Ala Leu Cys Ala Gly Tr,o Leu Ser Gln Pro Thr Pro Ala Thr Leu Gln Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Pro His Glu W095l32284 21 88423 44 PCT/EP95/01834 Ala Val Ser Cys Pro Tyr Ser Ala Asp Met Tyr Val Gln Pro Val Cys 115 120 . .. . 125 Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser 130 135 . 140 .
Pro Pro Leu Ile Thr Asn Val Thr Thr Arg Ser Ser Ala Thr Pro Ala 14S 150 155 . . ~~ 16D
al Gly Pro Pro Leu GIu Gly Pro Glu ~is GIn Ala Pro Leu Thr Tyr he Pro Trp Pro Gln Pro Leu Ser Thr Leu Pro Thr Ser Thr Leu Gln 180 1~5 190 Tyr Gln Pro Pro Ala Pro Ala Leu Pro Gly Pro Gln Phe Val Gln Leu Pro Ile Ser Ile Pro Glu Pro Val 1eu Gln Asp Met Glu Asp Pro Arg Arg Ala Ala Ser Ser Leu Thr Ile Asp Lys Leu LeU Leu Glu Glu Glu Asp Ser Asp Ala Tyr Ala Leu Asn His Thr Leu Ser Val Glu Gly Phe 245 250 255 :
( 2 ) INFORIYATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1150 base pairs .-(3) TYPE: nucleic acid = ~:
(C~ STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

. 2~ 23 WO 9~132284 ~ 6 s4 ( i x ) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 178 . . 945 (D) OTHER INFOR~5ATION: /product= "murine OBF-1"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CCTGAGGTAG GAGGATGTGA TGACGTGGCC CCTCTCAGCG GGAACTCGGG CCTTTA~AAA 60 GCTGAAGAPA CAGCCTCAGA G~T~r(:~TG GTTCCACGGG ~fx~ - GCCCAGTCAC 120 ATTAMh~AG CCA~ACTGTC TGCTTCA~AG ~ h~ ACATCCTGTC ACAAGCC 177 ATG CTC TGG CAA A~A TCC ACA GCT CCA GAG CAA GCT CCT GCC CCA CCA 225 Met Leu Trp Gln Lys Ser Thr Ala Pro Glu Gln Ala Pro Ala Pro Pro Arg Pro Tyr Gln Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu AGA AGA AAG CGT GGC CAT ACC AGC GTT GGG GC~ GCT GGG CCA CCG ACC 321 Arg Arg Lys Arg Gly His Thr Ser Val Gly Ala Ala Gly Pro Pro Thr Ala Val Val Leu Pro His Gln Pro Leu Ala Thr Tyr Ser Thr Val Gly Pro Ser Cys Leu Asp Met Glu Val Ser Ala Ser Thr Val Thr Glu Glu GGA ~CA TTA TGT GCT GGC TGG CTC TCC CAA CCT GCC CCG GCC ACT CTT 4 65 Gly Thr Leu Cys Ala Gly Trp Leu ser Gln Pro Ala Pro Ala Thr Leu WO 95l32284 21 8 8 4 2 3 ~6- PCTIEP95/01834 CAG CQ TTG GCT CCA TGG ACA CCC TAC ACG GAG TAT GTG TCC CAT GAA 513 _ - -Gln Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Ser His Glu 100 105 110_ Ala Val Ser Cys Pro Tyr Ser Thr Asp 2qet Tyr Val Gln Pro Val Cys 115 12D . _ . 125 Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser 130 ~: 135 . ~ 140 Pro Pro Leu Ile Thr Asn Val Thr Pro Arg Ser Thr Ala Thr Pro Ala GTG GGG CCC CAG CTG ~ GAG GGT CCC GAG CAC CAG GCG CCC CTC ACT TAT 705 Val Gly Pro Gln Leu Glu Gly Pro Glu His Gln Ala Pro Leu Thr Tyr Phe Pro Trp Pro Gln Pro Leu Ser Thr Leu Pro Thr Ser Ser Leu GIn Tyr Gln Pro Pro Ala Pro Thr Leu Ser Gly Pro Gln Phe Val Gln Leu 195 - .. 200 ~ 205 CCC ATC TCT ATC CCA GAG CCA GTC CTT CAG G~S ATG GAT GAC CCC AGA 8 4 9 Pro Ile Ser Ile Pro Glu Pro Val Leu Gln Asp Met Asp Asp Pro Arg Arg Ala Ile Ser Ser Leu Thr Ile Asp Lys Leu Leu Leu GLu Glu Glu 225 230 235 ~~ . 240 Glu Ser Asn Thr Tyr Glu Leu Asn His Thr Leu Ser Val Glu Gly Phe 21 ~423 WO 95132'L84 PCT/I~P95/01834 TAGGGCTGGC TTGCATCTAA CAGATGTTTC ACCCATAGCT GAGATTTTAA ~AGTGTTCAA 1005 T~r~r.rrr~r. A~ ,lll GAAGTAGCTA TTTCACAGGC ~llu~ ,ll CCTAAAGCTA 1065 AATTGTATCC ~llvlll~ ,llc~ U:Lc~ ell'_~: CCCACTGCCA 1125 ,llAT TTCTTATTTC TCCTT 1150 (2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
~A) LENGTH: 256 amino acids ( E ) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
et Leu Trp Gln Lys Ser Thr Ala Pro Glu Gln Ala Pro Ala Pro Pro rg Pro Tyr Gln Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu rg Arg Lys Arg Gly His Thr Ser Val Gly Ala Ala Gly Pro Pro Thr Ala Val Val Leu Pro His Gln Pro 1eu Ala Thr Tyr Ser Thr Val Gly Pro Ser Cys Leu ASp Met Glu Val Ser Ala Ser Thr Val Thr Glu Glu Gly Thr Leu Cys Ala Gly Trp Leu Ser Gln Pro Ala Pro Ala Thr Leu W095l32284 2 1 88423 ~8 PCT/EP95/01834 85 9o 95 ln Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Ser His Glu Ala Val Ser Cys Pro Tyr Ser Thr Asp Met Tyr Val Gln Pro Val Cys , 115 - 120 125 Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Al~ Ser 130 - 135 . 140 Pro Pro Leu Ile Thr Asn Val Thr Pro Arg Ser Thr Ala Thr Pro Ala al Gly Pro Gln Leu Glu Gly Pro Glu His Gln Ala Pro Leu Thr Tyr he Pro Trp Pro Gln Pro Leu Ser Thr Leu Pro Thr Ser Ser Leu Gln Tyr Gln Pro Pro Ala Pro Thr Leu Ser Gly Pro Gln Phe Val Gln Leu Pro Ile Ser Ile Pro Glu Pro Val Leu Gln Asp Met Asp Asp Pro Arg Arg Ala Ile Ser Ser Leu Thr Ile Asp 1ys Leu Leu Leu Glu Glu Glu Glu Ser Asn Thr Tyr Glu Leu Asn His Thr Leu Ser Val Glu Gly Phe 24~ Z5~ ~5

Claims (26)

Claims:

1. A nucleic acid encoding a B-lymphocyte specific activator of octamer site-mediated gene transcription, which interacts with the POU domain of Oct-1 and Oct-2 in order to activate gene transcription.

2. Nucleic acid probe comprising at least 20 bases of the nucleic acid according to claim 1.

3. Vector comprising a nucleic acid according to claim 1.

4. Host cells containing nucleic acid according to claim 1.

5. Isolated protein encoded by the DNA of claim 1.

6. Composition comprising a protein according to claim 5.

7. An isolated antibody that is capable of binding to a protein according to claim 5.

8. A method for identifying nucleic acid encoding a protein according to claim 5, said method comprising contacting a nucleic acid sample with a nucleic acid probe according to claim 2, wherein said contacting is carried out under hybridization conditions, and identifying nucleic acid which hybridizes to said probe.

9. A method of amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase chain reaction with the nucleic acid of claim 1, or a fragment thereof.

10. A method for identifying compounds which are capable of modulating the activity of a protein according to claim 5, said method comprising contacting host cells containing heterologous DNA encoding said protein which is expressed in functional form, to at least one compound or signal whose ability to modulate the activity of said protein is sought to be determined, and thereafter monitoring said cells for changes caused by said modulation.

11. Nucleic acid according to claim 1 which is a DNA.

12. Nucleic acid according to claim 1 which codes for a mammalian, particularly human protein.

13. Nucleic acid according to claim 1 which encodes a protein having substantially the same amino acid sequence as set forth in SEQ ID No. 2.

14. DNA according to claim 11 having substantially the same nucleotide sequence as set forth in SEQ ID No. 1.

15. Nucleic acid according to claim 1 which encodes a protein having substantially the same amino acid sequence as set forth in SEQ ID No. 4.

16. DNA according to claim 11 having substantially the same nucleotide sequence as set forth in SEQ ID No. 3.

17. Nucleic acid according to claim 1 wherein the nucleotides of said nucleic acid hybridize to substantially the entire coding region of the DNA set forth in SEQ ID Nos. 2 or 4, respectively.

18. Nucleic acid according to claim 1 which is a mRNA.

19. Vector according to claim 3 which is plasmid pRS314/UNVP16/clone9 deposited with the DSM under accession number 9200.

20. Host cell expressing a nucleic acid of claim 1.

21. A method comprising culturing the host cell of claim 20 to express a protein according to claim 5 and recovering the protein from the host cell.

22. Composition of claim 6 wherein the protein is functionally active.

23. Composition according to claim 6 wherein the protein is antigenically active.

24. Use of host cells according to claim 20 additionally expressing Oct-1 and/or Oct-2 for the identification of molecules modulating the interaction of the protein with Oct-1 and/or Oct-2.

25. A nucleic acid sequence that is complementary to, or hybridizes under stringent conditions to a nucleic acid sequence according to claim 1.

26. A method according to claim 11, said method comprising contacting DNA with a probe according to claim 3, wherein said contacting is carried out under low-stringency to moderate-stringency hybridization conditions, and identifying DNA(s) which display(s) a substantial degree of hybridization to said probe.