WO1995032284A9 - Factor interacting with nuclear proteins - Google Patents

Abstract

The present invention provides a nucleic acid encoding a B-lymphocyte specific activator of octamer site-mediated gene transcription, which interacts with the POU domaine of Oct-1 and Oct-2 in order to activate gene transcription, and the protein encoded by the nucleic acid. In a further aspect of the invention, host cells containing or expressing such nucleic acids are provided, as well as methods of using the nucleic acids and cells transformed therewith.

Description

Factor Interacting With Nuclear Proteins

The present invention provides nucleic acids and transcription factor proteins encoded thereby. In a further aspect of the invention, host cells containing or expressing such nucleic acids are provided.

The B cell-specific expression of immunoglobulin (Ig) genes is controlled by promoter and enhancer elements which are B cell-specific in their activity (Staudt and Lenardo, 1991 ). The octamer motif with the consensus sequence -ATGCAAAT-, or its inverse complement -ATTTGCAT-, is one of the most conspicuous regulatory elements of Ig genes, as it is present in every Ig promoter as well as in most of the Ig enhancers, intronic or 3' (Staudt and Lenardo, 1991). It has been shown that a single octamer motif of the above sequence is able to confer B cell-specific expression to a linked reporter gene: insertion of the octamer site into a non-related minimal promoter renders it largely B cell-specific (Dreyfus et al., 1987; Wirth et al., 1987). ultimerisation of the octamer motif creates a potent B cell- specific enhancer (Gerster et al., 1987). Furthermore, the octamer motif is also a functionally important element of the promoter or enhancer of many non lymphoid-specific genes such as the histone H2B or U small nuclear (sn) RNA genes (LaBella et al., 1988).

Several transcription factors have been identified (and their cDNAs cloned) which bind specifically to the octamer site (e.g. Scholer et al., 1989). One of these nuclear proteins is Oct-1 , an ubiquitous protein of about 750 amino acids. In the literature Oct-1 is also referred to as NF-A1 , OBP100, NF III or OTF-1. Another transcription factor binding to the octamer site is Oct-2, a protein of about 479 amino acids which exists in several different isoforms due to alternative splicing. Oct-2, which is also known as OTF-2 or NF-A2, is expressed mostly, if not exclusively, in B cells (fvlϋller et al., 1988; Staudt et al., 1988). These as well as the other Oct proteins all belong to the POU family of homeodomain proteins and are highly homologous in their DNA binding domain but quite divergent outside of it (Herr et al., 1988). So far, the two best characterised Oct proteins are Oct-1 and Oct-2.

Ig promoters or other artificial octamer-dependent promoters are highly active in B cells, which contain Oct-1 and Oct-2, and weakly active in other cells such as fibroblasts, which contain only the Oct-1 protein. These results suggested that the B cell-spec^:'ic activity of the octamer motif is largely due to the presence of the Oct-2 protein in B cells. I nis early model was further supported by the demonstration that overexpression of Oct-2 in non-B cells could efficiently activate octamer-containing promoters (Mϋller et al., 1988).

However, the early notion of a specialized function for Oct-2 in B cells has been questioned by recent findings. Firstly, now that many B cell lines have been looked at for their levels of Oct-2 protein (or mRNA), it is apparent that the correlation between the Oct-2 levels and the activity of the octamer site is rather poor. For example, several B cell lines have been reported which have only little or no detectable Oct-2, and where octamer-containing promoters are nevertheless highly active (Johnson et al., 1990). Moreover, in vitro transcription experiments showed that purified Oct-1 or Oct-2 have a similar intrinsic capacity to stimulate an Ig promoter, yet unfractionated B cell extracts stimulate much more efficiently an Ig promoter than e.g. HeLa extracts (LeBowitz et al., 1988; Johnson et al., 1990; Pierani et al., 1990; Luo et al., 1992). In addition, a protein fraction has been recently isolated from a B cell nuclear extract which, in conjunction with purified Oct-1 or Oct-2, specifically stimulates transcription from an Ig promoter. This fraction, which could not be isolated from HeLa nuclear extracts, has been designated OCA-B (Oct coactivator from B cells) (Luo et al., 1992).

Finally, Oct-2-deficient mice have recently been generated by gene targeting in embryonic stem (ES) cells; in these mice, which totally lack the Oct-2 protein, Ig genes are rearranged and transcribed efficiently and B cell development appears normal until the stage of the surface IgM-bearing virgin B cell, suggesting that Oct-2 is dispensable in the first, antigen- independent phase of B cell differentiation (Corcoran et al., 1993). At later stages, the B cells from these animals show an impaired capacity to synthesize high levels of immuno- globulin. This finding therefore directly demonstrates a role for Oct-2 in Ig expression, if only at a late B cell stage.

It is therefore apparent that the current theories surrounding the roles of Oct-1 and Oct-2 in the regulation of the Ig promoter are not sufficient to explain the observed phenomena satisfactorily. Ultimate control of octamer-mediated immunoglobulin gene expression is achieved otherwise than solely through control of the tissue distribution of Oct-1 and Oct-2.

Knowledge of the biochemistry of immunoglobulin gene expression is of importance to medicine and the biotechnological industry, for the purposes of designing, testing and identifying agents capable of influencing disorders of an immunological nature and for the selective modulation of Ig gene expression in expression systems. Moreover, knowledge of regulatory mechanisms is of importance in the field of gene therapy, where regulated tissue-specific action of therapeutically active agents is advantageously controlled by restricting the tissue specificity of transgene expression.

It is the object of the present invention to provide a solution to these needs. The present invention provides nucleic acids encoding a protein specifically interacting with the POU proteins Oct-1 or Oct-2. Such proteins are denominated OBF-1 (Oct binding factor 1).

According to a first aspect of the present invention, there is provided a nucleic acid encoding a B-lymphocyte specific activator of octamer site-mediated gene transcription, which interacts with the POU domain of Oct-1 and Oct-2 in order to activate gene transcription.

Such activators are referred to herein as OBF-1 and the present invention therefore relates to isolated nucleic acid (DNA, RNA) coding for OBF-1. In addition to being useful for the production of recombinant OBF-1 protein, these nucleic acids are also useful as probes, thus readily enabling those skilled in the art to identify and/or isolate nucleic acid encoding OBF-1. The nucleic acid may be unlabelled or labelled with a detectable moiety. Furthermore, nucleic acid according to the invention is useful e.g. in a method determining the presence of OBF-1 -specific nucleic acid, said method comprising hybridizing the DNA (or RNA) encoding (or complementary to) OBF-1 to test sample nucleic acid and determining the presence of OBF-1. In another aspect, the invention provides nucleic acid sequence that is complementary to, or hybridizes under stringent conditions to, a nucleic acid sequence encoding OBF-1.

The invention also provides a method for amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase (chain) reaction with nucleic acid (DNA or RNA) encoding (or complementary to) OBF-1.

In still another aspect of the invention, the nucleic acid is DNA and further comprises a replicable vector comprising the nucleic acid encoding OBF-1 operably linked to control sequences recognized by a host transformed by the vector. Furthermore the invention provides host cells transformed with such vector and a method of using a nucleic acid encoding OBF-1 to effect the production of OBF-1 , comprising expressing OBF-1 nucleic acid in a culture of the transformed host cells and, if desired, recovering OBF-1 from the host cell culture.

Furthermore, the present invention relates to isolated OBF-1 proteins encoded by the above-described nucleic acids.

It is an additional object to provide immunogens for raising antibodies against OBF-1 as well as to obtain antibodies capable of binding to OBF-1.

As used hereinbefore or hereinafter, the term "isolated" is intended to refer to a molecule of the invention in an enriched or, preferably, pure form obtainable from a natural source or by means of genetic engineering.

The isolated DNAs, RNAs and proteins of the invention may be useful in ways that the DNAs, RNAs and proteins as they naturally occur are not, such as identification of com¬ pounds selectively modulating the activity of Oct-1 or Oct-2.

Isolated OBF-1 nucleic acid includes nucleic acid that is free from at least one contaminant nucleic acid with which it is ordinarily associated in the natural source of OBF-1 nucleic acid. Isolated nucleic acid thus is present in other than in the form or setting in which it is found in nature. However, isolated OBF-1 encoding nucleic acid includes OBF-1 nucleic acid in ordinarily OBF-1 -expressing cells where the nucleic acid is in a chromosomal location different from that of natural cells or is otherwise flanked by a different DNA sequence than that found in nature.

In accordance with the present invention, there are provided isolated nucleic acids, e.g. DNAs or RNAs, encoding OBF-1 , particularly mammalian OBF-1, e.g. murine or human OBF-1 , or fragments thereof. In particular, the invention provides a DNA molecule encoding OBF-1 , or a fragment thereof. By definition, such a DNA comprises a coding single stranded DNA, a double stranded DNA of said coding DNA and complementary DNA thereto, or this complementary (single stranded) DNA itself. Exemplary nucleic acids encoding OBF-1 are represented in SEQ ID NOs. 1 and 3. A cDNA encoding human OBF-1 is obtainable from plasmid pRS314/UNVP16/clone 9 which has been deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Mascheroder Weg 1b, D-38124 Braunschweig, under accession number 9200 on May 9, 1994.

Preferred sequences encoding OBF-1 are those having substantially the same nucleotide sequence as the coding sequences in SEQ ID NOs. 1 and 3, with the nucleic acids having the same sequence as the coding sequence in SEQ ID NOs. 1 and 3 being most preferred. As used herein, nucleotide sequences which are substantially the same share at least about 90 % identity. However, in the case of splice variants having e.g. an additional exon sequence homology may be lower.

Exemplary nucleic acids can alternatively be characterized as those nucleotide sequences which encode an OBF-1 protein and hybridize to the DNA sequences set forth in SEQ ID NOs. 1 and 3, or a selected portion (fragment) of said DNA sequence. For example, selected fragments useful for hybridisation are those employed in the Examples, e.g. the cDNA used for the isolation of the mouse homologue , i.e. the 2 kb Sfi 1 cDNA insert present in plasmid pR314/UNVP16/clone 9. Preferred are such sequences encoding OBF-1 which hybridize under high-stringency conditions to the above-mentioned 2 kb Sfi 1 cDNA insert.

Stringency of hybridization refers to conditions under which polynucleic acids hybrids are stable. Such conditions are evident to those of ordinary skill in the field. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T_m) of the hybrid which decreases approximately 1 to 1.5°C with every 1 % decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of higher stringency, followed by washes of varying stringency.

As used herein, high stringency refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 1 M Na⁺ at 65-68 °C. High stringency conditions can be provided, for example, by hybridization in an aqueous solution containing 6x SSC, 5x Denhardt's, 1 % SDS (sodium dodecyl sulfate), 0.1 Na⁺ pyrophosphate and 0.1 mg/ml denatured salmon sperm DNA as non specific competitor. Following hybridization, high stringency washing may be done in several steps, with a final wash (about 30 min) at the hybridization temperature in 0.2- 0.1 x SSC, 0.1 % SDS.

Moderate stringency refers to conditions equivalent to hybridization in the above described solution but at about 60-62°C. In that case the final wash is performed at the hybridization temperature in 1x SSC, 0.1 % SDS.

Low stringency refers to conditions equivalent to hybridization in the above described solution at about 50-52°C. In that case, the final wash is performed at the hybridization temperature in 2x SSC, 0.1 % SDS.

It is understood that these conditions may be adapted and duplicated using a variety of buffers, e.g. formamide-based buffers, and temperatures. Denhardt's solution and SSC are well known to those of skill in the art as are other suitable hybridization buffers (see, e.g. Sambrook et al, 1989 or Ausubel et al., 1990). Optimal hybridization conditions have to be determined empirically, as the length and the GC content of the probe also play a role.

Given the guidance provided herein, the nucleic acids of the invention are obtainable according to methods well known in the art. For example, a DNA of the invention is obtain¬ able by chemical synthesis, using polymerase chain reaction (PCR) or by screening a genomic library or a suitable cDNA library prepared from a source believed to possess OBF- 1 and to express it at a detectable level.

Chemical methods for synthesis of a nucleic acid of interest are known in the art and include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods as well as oligonucleotide synthesis on solid supports. These methods may be used if the entire nucleic acid sequence of the nucleic acid is known, or the sequence of the nucleic acid complementary to the coding strand is available. Alternatively, if the target amino acid sequence is known, one may infer potential nucleic acid sequences using known and preferred coding residues for each amino acid residue.

An alternative means to isolate the gene encoding OBF-1 is to use PCR technology as described e.g. in section 14 of Sambrook et al., 1989. This method requires the use of oligonucleotide probes that will hybridize to OBF-1 nucleic acid. Strategies for selection of oligonucleotides are described below.

Libraries are screened with probes or analytical tools designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries suitable means include monoclonal or polyclonal antibodies that recognize and specifically bind to OBF-1 ; oligonucleotides of about 20 to 80 bases in length that encode known or suspected OBF-1 cDNA from the same or different species; and/or complementary or homologous cDNAs or fragments thereof that encode the same or a hybridizing gene. Appropriate probes for screening genomic DNA libraries include, but are not limited to oligonucleotides, cDNAs or fragments thereof that encode the same or hybridizing DNA; and/or homologous genomic DNAs or fragments thereof.

A nucleic acid encoding OBF-1 may be isolated by screening suitable cDNA or genomic libraries under suitable hybridization conditions with a probe, i.e. a nucleic acid disclosed herein including oligonucleotides derivable from the sequences set forth in SEQ ID NOs. 1 and 3. Suitable libraries are commercially available or can be prepared e.g. from cell lines, tissue samples, and the like.

As used herein, a probe is e.g. a single-stranded DNA or RNA that has a sequence of nucleotides that includes between 10 and 50, preferably between 15 and 30 and most preferably at least about 20 contiguous bases that are the same as (or the complement of) an equivalent or greater number of contiguous bases set forth in SEQ ID NOs. 1 and 3. The nucleic acid sequences selected as probes should be of sufficient length and sufficiently unambiguous so that false positive results are minimized. The nucleotide sequences are usually based on conserved or highly homologous nucleotide sequences or regions of OBF-1. The nucleic acids used as probes may be degenerate at one or more positions. The use of degenerate oligonucleotides may be of particular importance where a library is screened from a species in which preferential codon usage in that species is not known.

Preferred regions from which to construct probes include 5' and or 3' coding sequences, sequences predicted to encode ligand binding sites, and the like. For example, either the full-length cDNA clones disclosed herein or fragments thereof can be used as probes. Preferably, nucleic acid probes of the invention are labelled with suitable label means for ready detection upon hybridization. For example, a suitable label means is a radiolabel. The preferred method of labelling a DNA fragment is by incorporating a³²?- dATP with the Klenow fragment of DNA polymerase in a random priming reaction, as is well known in the art. Oligonucleotides are usually end-labelled with γ^P-labelled ATP and polynucleotide kinase. However, other methods (e.g. non-radioactive) may also be used to label the fragment or oligonucleotide, including e.g. enzyme labelling, fluorescent labelling with suitable fluorophores and biotinylation.

After screening the library, e.g. with a portion of DNA including substantially the entire OBF- 1 -encoding sequence or a suitable oligonucleotide based on a portion of said DNA, positive clones are identified by detecting a hybridization signal; the identified clones are characterized by restriction enzyme mapping and/or DNA sequence analysis, and then examined, e.g. by comparison with the sequences set forth herein, to ascertain whether they include DNA encoding a complete OBF-1 (i.e., if they include translation initiation and termination codons). If the selected clones are incomplete, they may be used to rescreen the same or a different library to obtain overlapping clones. If the library is genomic, then the overlapping clones may include exons and introns. If the library is a cDNA library, then the overlapping clones will include an open reading frame. In both instances, complete clones may be identified by comparison with the DNAs and deduced amino acid sequences provided herein.

In order to detect any abnormality of endogenous OBF-1 , genetic screening may be carried out using the nucleotide sequences of the invention as hybridization probes. Also, based on the nucleic acid sequences provided herein antisense-type therapeutic agents may be designed.

It is envisaged that the nucleic acid of the invention can be readily modified by nucleotide substitution, nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any combination thereof. Such mutants can be used e.g. to produce an OBF-1 mutein (mutant protein) that has an amino acid sequence differing from the OBF-1 sequences as found in nature. Mutagenesis may be predetermined (site-specific) or random. A mutation which is not a silent mutation must not place sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structure such as loops or hairpins. The cDNA or genomic DNA encoding native or mutant OBF-1 can be incorporated into vectors for further manipulation. As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof. Selection and use of such vehicles are well within the skill of the artisan. Many vectors are available, and selection of appropriate vector will depend on the intended use of the vector, i.e. whether it is to be used for DNA amplification or for DNA expression, the size of the DNA to be inserted into the vector, and the host cell to be transformed with the vector. Each vector contains various components depending on its function (amplifi¬ cation of DNA or expression of DNA) and the host cell for which it is compatible. The vector components generally include, but are not limited to, one or more of the following: an origin of replication, one or more marker genes, an enhancer element, a promoter, a transcription termination sequence and a signal sequence.

Both expression and cloning vectors generally contain nucleic acid sequence that enable the vector to replicate in one or more selected host cells. Typically in cloning vectors, this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast and viruses. The origin of repli¬ cation from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (e.g. SV 40, polyoma, adenovirus) are useful for cloning vectors in mammalian cells. Generally, the origin of replication component is not needed for mammalian expression vectors unless these are used in mammalian cells competent for high level DNA replication, such as COS cells.

Most expression vectors are shuttle vectors, i.e. they are capable of replication in at least one class of organisms but can be transfected into another organism for expression. For example, a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells even though it is not capable of replicating independently of the host cell chromosome. DNA may also be replicated by insertion into the host genome. However, the recovery of genomic DNA encoding OBF-1 is more complex than that of exogenously replicated vector because restriction enzyme digestion is required to excise OBF-1 DNA. DNA can be amplified by PCR and be directly transfected into the host cells without any replication component. Advantageously, an expression and cloning vector may contain a selection gene also referred to as selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that confer resistance to antibiotics and other toxins, e.g. ampicillin, neomycin, methotrexate or tetracycline, complement auxotrophic deficiencies, or supply critical nutrients not available from complex media.

As to a selective gene marker appropriate for yeast, any marker gene can be used which facilitates the selection for transformants due to the phenotypic expression of the marker gene. Suitable markers for yeast are, for example, those conferring resistance to antibiotics G418, hygromycin or bleomycin, or provide for prototrophy in an auxotrophic yeast mutant, for example the URA3. LEU2. LYS2. TRP1. or HIS3 gene.

Since the replication of vectors is conveniently done in E. coli. an E. coli genetic marker and an E. coli origin of replication are advantageously included. These can be obtained from E. coli plasmids, such as pBR322, Bluescript (TM) vector or a pUC plasmid, e.g. pUC18 or pUC19, which contain both E. coli replication origin and E. coli genetic marker conferring resistance to antibiotics, such as ampicillin.

Suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up OBF-1 nucleic acid, such as dihydrofolate reductase (DHFR, methotrexate resistance), thymidine kinase, or genes conferring resistance to G418 or hygromycin. The mammalian cell transformants are placed under selection pressure which only those transformants which have taken up and are expressing the marker are uniquely adapted to survive. In the case of a DHFR or glutamine synthase (GS) marker, selection pressure can be imposed by culturing the transformants under conditions in which the pressure is progressively increased, thereby leading to amplification (at its chromosomal integration site) of both the selection gene and the linked DNA that encodes OBF-1. Amplification is the process by which genes in greater demand for the production of a protein critical for growth, together with closely associated genes which may encode a desired protein, are reiterated in tandem within the chromosomes of recombinant cells. Increased quantities of desired protein are usually synthesized from thus amplified DNA. Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to OBF-1 nucleic acid. Such a promoter may be inducible or constitutive. The promoters are operably linked to DNA encoding OBF-1 by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native OBF-1 promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of OBF-1 DNA.

Promoters suitable for use with prokaryotic hosts include, for example, the β-lactamase and lactose promoter systems, alkaline phosphatase, the tryptophan (trp) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worker operably to ligate them to DNA encoding OBF-1 , using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems will also generally contain a Shine-Delgarno sequence operably linked to the DNA encoding OBF-1.

Moreover, the OBF-1 gene according to the invention preferably includes a secretion sequence in order to facilitate secretion of the polypeptide from bacterial hosts, such that it will be produced as a soluble native peptide rather than in an inclusion body. The peptide may be recovered from the bacterial periplasmic space, or the culture medium, as appropriate.

Suitable promoting sequences for use with yeast hosts may be regulated or constitutive and are preferably derived from a highly expressed yeast gene, especially a Saccharomyces cerevisiae gene. Thus, the promoter of the TRP1 gene, the ADHI or ADHII gene, the acid phosphatase (PH05) gene, a promoter of the yeast mating pheromone genes coding for the a- or ≤t-factor or a promoter derived from a gene encoding a glycolytic enzyme such as the promoter of the enolase, glyceraldehyde-3-phosphate dehydrogenase (GAP). 3-phospho glycerate kinase (PG_K), hexokinase, pyruvate decarboxyiase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase or glucokinase genes, or a promoter from the TATA binding protein (TBP) gene can be used. Furthermore, it is possible to use hybrid promoters comprising upstream activation sequences (UAS) of one yeast gene and downstream promoter elements including a functional TATA box of another yeast gene, for example a hybrid promoter including the UAS(s) of the yeast PH05 gene and downstream promoter elements including a functional TATA box of the yeast GAP gene (PH05-GAP hybrid promoter). A suitable constitutive PHO5 promoter is e.g. a shortened acid phosphatase PH05 promoter devoid of the upstream regulatory elements (UAS) such as the PH05 (-173) promoter element starting at nucleotide -173 and ending at nucleotide -9 of the PH05 gene.

OBF-1 gene transcription from vectors in mammalian hosts may be controlled by promoters derived from the genomes of viruses such as polyoma virus, adenovirus, fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus (CMV), a retrovirus and Simian Virus 40 (SV40), from heterologous mammalian promoters such as the actin promoter or a very strong promoter, e.g. a ribosomal protein promoter, and from the promoter normally associated with OBF-1 sequence, provided such promoters are compatible with the host cell systems.

Transcription of a DNA encoding OBF-1 by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are relatively orientation and position independent. Many enhancer sequences are known from mammalian genes (e.g. elastase and globin). However, typically one will employ an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) and the CMV early promoter enhancer. The enhancer may be spliced into the vector at a position 5' or 3' to OBF-1 DNA, but is preferably located at a site 5' from the promoter.

Advantageously, a eukaryotic expression vector encoding OBF-1 may comprise a locus control region (LCR). LCRs are capable of directing high-level integration site independent expression of transgenes integrated into host cell chromatin, which is of importance especially where the OBF-1 gene is to be expressed in the context of a permanently- transfected eukaryotic cell line in which chromosomal integration of the vector has occurred, in vectors designed for gene therapy applications or in transgenic animals.

Suitable eukaryotic host cells for expression of OBF-1 include yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and 3' untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding OBF-1.

An expression vector includes any vector capable of expressing OBF-1 nucleic acids that are operatively linked with regulatory sequences, such as promoter regions, that are capable of expression of such DNAs. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector, that upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those with ordinary skill in the art and include those that are replicable in eukaryotic and/or prokaryotic cells and those that remain episomai or those which integrate into the host cell genome. For example, DNAs encoding OBF-1 may be inserted into a vector suitable for expression of cDNAs in mammalian cells, e.g. a CMV enhancer-based vector such as pEVRF (Matthias et al., 1989).

Particularly useful for practising the present invention are expression vectors that provide for the transient expression of DNA encoding OBF-1 in mammalian cells. Transient expression usually involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector, and, in turn, synthesizes high levels of OBF-1. For the purposes of the present invention, transient expression systems are useful e.g. for identifying OBF-1 muteins, to identify potential phosphorylation sites, or to characterize functional domains of the protein.

Construction of vectors according to the invention employs conventional ligation techniques. Isolated piasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the piasmids required. If desired, analysis to confirm correct sequences in the constructed piasmids is performed in a known fashion. Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells, and performing analyses for assessing OBF-1 expression and function are known to those skilled in the art. Gene presence, amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA, dot blotting (DNA or RNA analysis), or in situ hybridization, using an appropriately labelled probe based on a sequence provided herein. Suitable methods include those described in detail in the Examples. Those skilled in the art will readily envisage how these methods may be modified, if desired.

In accordance with another embodiment of the present invention, there are provided cells containing the above-described nucleic acids (i.e., DNA or mRNA). Such host cells such as prokaryote, yeast and higher eukaryote cells may be used for replicating DNA and pro¬ ducing OBF-1. Suitable prokaryotes include eubacteria, such as Gram-negative or Gram- positive organisms, such as E. coli, e.g. E. coli K-12 strains, DH5a and HB101 , or Bacilli. Further hosts suitable for OBF-1 encoding vectors include eukaryotic microbes such as filamentous fungi or yeast, e.g. Saccharomyces cerevisiae. Higher eukaryotic cells include insect and vertebrate cells, particularly mammalian cells. In recent years propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are epithelial or fibroblastic cell lines such as Chinese hamster ovary (CHO) cells, NIH 3T3 cells, HeLa cells or293T cells. The host cells referred to in this disclosure comprise cells in in vitro culture as well as cells that are within a host animal.

DNA may be stably incorporated into cells or may be transiently expressed using methods known in the art. Stably transfected mammalian cells may be prepared by transfecting cells with an expression vector having a selectable marker gene, and growing the transfected cells under conditions selective for cells expressing the marker gene. To prepare transient transfectants, mammalian cells are transfected with a reporter gene to monitor transfection efficiency.

To produce such stably or transiently transfected cells, the cells should be transfected with a sufficient amount of OBF-1 -encoding nucleic acid to form OBF-1. The precise amounts of DNA encoding OBF-1 may be empirically determined and optimized for a particular cell and assay.

Host cells are transfected or, preferably, transformed with the above-captioned expression or cloning vectors of this invention and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. Heterologous DNA may be introduced into host cells by any method known in the art, such as transfection with a vector encoding a heterologous DNA by the calcium phosphate coprecipitation technique or by electroporation. Numerous methods of transfection are known to the skilled worker in the field. Successful transfection is generally recognized when any indication of the operation of this vector occurs in the host cell. Transformation is achieved using standard techniques appropriate to the particular host cells used.

Incorporation of cloned DNA into a suitable expression vector, transfection of eukaryotic cells with a plasmid vector or a combination of plasmid vectors, each encoding one or more distinct genes or with linear DNA, and selection of transfected cells are well known in the art (see, e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press).

Transfected or transformed cells are cultured using media and culturing methods known in the art, preferably under conditions, whereby OBF-1 encoded by the DNA is expressed. The composition of suitable media is known to those in the art, so that they can be readily prepared. Suitable culturing media are also commercially available.

While the DNA provided herein may be expressed in any suitable host cell, e.g. those referred to above, preferred for expression of DNA encoding functional OBF-1 are eukaryotic expression systems such as baculovirus-based systems and, particularly, mammalian expression systems, including commercially available systems and other systems known to those of skill in the art, which express the Oct-1 protein and/or the Oct-2 protein (either endogenously or recombinantly).

In preferred embodiments, OBF-1 encoding DNA is ligated into a vector, and introduced into suitable host cells to produce transformed cell lines that express OBF-1. The resulting cell lines can then be produced in quantity for reproducible qualitative and/or quantitative analysis of the effect(s) of potential drugs affecting OBF-1 function. Thus OBF-1 expressing cells may be employed for the identification of compounds, particularly small molecules capable of penetrating the nucleus, which compounds enhance the specific interaction between OBF-1 and Oct factors (agonists), thereby increasing the potency of OBF-1. By contrast, in situations where it is desirable to tone down the activity of OBF-1 , antagonizing molecules interfering with the Oct / OBF-1 interaction are useful. Yet another alternative to achieve an antagonistic effect is to rely on overexpression of antisense OBF-1 RNA. Thus host cells expressing OBF-1 are useful for drug screening and it is a further object of the present invention to provide a method for identifying compounds which modulate the activity of OBF-1 , said method comprising exposing cells containing heterologous DNA encoding OBF-1 , wherein said cells produce functional OBF-1 , to at least one compound or signal whose ability to modulate the activity of said OBF-1 is sought to be determined, and thereafter monitoring said cells for changes caused by said modulation. Such an assay enables the identification of agonists, antagonists and allosteric modulators of OBF-1.

Cell-based screening assays can be designed e.g. by constructing cell lines in which the expression of a reporter protein, i.e. an easily assayable protein, such as β galactosidase, chloramphenicol acetyltransferase (CAT) or luciferase, is dependent on OBF-1. Such an assay enables the detection of compounds that directly modulate OBF-1 function, e.g. compounds that antagonize OBF-1 , or compounds that inhibit other cellular functions required for the activity of OBF-1. An in vitro assay for OBF-1 requires that it may be produced in large amounts in a functional form using recombinant DNA methods. An assay is then designed to measure a functional property of the OBF-1 protein, e.g. interaction with Oct-1 or Oct-2. An exemplary in vitro assay is the electrophoretic mobility shift assay (EMSA) as described in the Examples.

Furthermore, by interacting with Oct-1 or Oct-2 in B cells, OBF-1 modulates the activity of these transcription factors and thus is capable of contributing directly to the regulation of Ig genes expression. Thus OBF-1 may be useful for boosting Ig production, e.g. for boosting monoclonal antibody production. This can be achieved, for example, by overexpressing in B cells OBF-1 itself or even more potent OBF-1 based hybrid proteins such as, for example, a VP16-OBF-1 chimera. By contrast, in situations where it is desirable to tone down the production of Igs, molecules interfering with Oct factor/ OBF-1 expression may be useful. The invention accordingly provides an expression system which is regulatable directly or indirectly by OBF-1 , comprising a host cell which is transfectable with one or more vectors which encode a desired protein. Oct proteins, which are necessary for OBF-1 activity, may be provided exogenously, by transfected recombinant transcription unit(s) or may be endogenous to the host cell. Likewise, OBF-1 may be endogenous to the host cell, but preferably it is provided by means of a recombinant transcription unit expressing an OBF-1 gene. It has been found that OBF-1 is expressed mostly in cells of lymphoid origin. Thus the present invention also provides a method to exogenously affect OBF-1 dependent processes occurring in such cells. Recombinant OBF-1 producing host cells, e.g. mammalian cells, can be contacted with a test compound, and the modulating effect(s) thereof can then be evaluated by comparing the OBF-1 -mediated response in the presence and absence of test compound, or relating the OBF-1 -mediated response of test cells, or control cells (i.e., cells that do not express OBF-1), to the presence of the compound.

As used herein, a compound or signal that modulates the activity of OBF-1 refers to a compound that alters the activity of OBF-1 in such a way that the activity of OBF-1 is different in the presence of the compound or signal (as compared to the absence of said compound or signal).

The invention also provides a transgenic non-human mammal which has been modified to modulate the expression of endogenous OBF-1. Preferably, the transgenic non-human mammal is a transgenic mouse. For example, therefore, a transgenic mouse may be designed in which OBF-1 production is greatly reduced or eliminated Alternatively, the transgenic mouse of the invention may express elevated levels of OBF-1, or may be subject to regulation of OBF-1 expression in a developmentally or tissue-specific manner, or via control by exogenous agents. Study of such an animal provides insights into the importance of OBF-1 in vivo.

Moreover, the invention provides a transcription unit encoding OBF-1 for use in a method of treatment of a condition involving aberrant Ig gene expression by gene therapy techniques. The transcription unit provided according to the present aspect of the invention comprises regulatable control regions which include a promoter, together with one or more enhancers and/or LCRs. The transcription unit may be delivered to the subject by any suitable means, including viral vectors, especially retroviral vectors, adeno- and adeno associated viral vectors, non-viral delivery systems, including liposomal and antibody targeted delivery systems, and direct uptake of naked DNA. The target tissue is advantageously a lymphoid tissue and preferably the transcription unit is delivered to haematopoietic stem cells. In an advantageous embodiment, the haematopoietic stem cells are removed from a patient, transfected ex vivo and subsequently returned to the patient. Alternatively, the cells may be targeted in vivo, for example using antibody targeting approaches. Also provided are proteins encoded by an above-described nucleic acid. The invention therefore comprises a B-lymphocyte specific activator of octamer site-mediated gene transcription, which interacts with the POU domain of Oct-1 and Oct-2 in order to activate gene transcription. Such proteins are designated OBF-1 (Oct binding factor 1). Being a transcription factor, OBF-1 is capable of influencing transcription. This biological activity can be shown in a suitable assay such as a transactivation assay, e.g. the assay as described in the Examples.

Preferably, the protein of the invention is provided in isolated form. "Isolated" OBF-1 means OBF-1 which has been identified and is free of one or more components of its natural environment. Isolated OBF-1 includes OBF-1 in a recombinant cell culture. OBF-1 present in an organism expressing a recombinant OBF-1 gene, whether the OBF-1 protein is "isolated" or otherwise, is included within the scope of the present invention.

OBF-1 includes the amino acid sequences of human and murine OBF-1 set forth in SEQ ID NOs. 2 and 4, respectively, as well as peptides comprising all or part of said sequences and additional sequences, polypeptide or peptide fragments of said sequences and the OBF-1 protein producible from the plasmid pRS314/UNVP16/clone 9. The definition of OBF-1 includes functional or immunogenic equivalents of OBF-1. For the purposes herein, "functional equivalent" means a protein displaying the in vivo effector function that is directly or indirectly performed by OBF-1 (whether in its native or denatured conformation), or by any subsequence thereof. Effector functions include receptor binding and activation, induction of differentiation, DNA regulatory functions and the like. A principal known effector function of OBF-1 is its ability to interact with Oct-1 and Oct-2.

"Immunogenic equivalent" means a protein or peptide having the antigenic functions of OBF-1. Antigenic functions includes possession of an epitope or antigenic site that is capable of cross-reacting with antibodies raised against a naturally occurring or denatured OBF-1 polypeptide or fragment thereof. Thus OBF-1 as provided by the present invention includes splice variants encoded by mRNA generated by alternative splicing of a primary transcript, amino acid mutants (muteins), glycosylation variants and other covalent derivatives of OBF-1 which retain the physiological and/or physical properties of OBF-1. Exemplary derivatives include molecules wherein the protein of the invention is covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid. Such a moiety may be a detectable moiety such as an enzyme or a radioisotope. Further included are naturally occurring variants of OBF-1 found with a particular species, preferably a mammal. Such a variant may be encoded by a related gene of the same gene family, by an allelic variant of a particular gene, or represent an alternative splicing variant of the OBF-1 gene.

OBF-1 muteins may be produced from a DNA encoding OBF-1 which has been subjected to in vitro mutagenesis resulting e.g. in an addition, exchange and/or deletion of one or more amino acids. For example, substitutional, deletional or insertional variants of OBF-1 are prepared by recombinant methods and screened for immuno-crossreactivity with the native forms of OBF-1.

A protein of the invention is obtainable from a natural source, e.g. from nuclear extracts of lymphoid cells, by chemical synthesis or by recombinant techniques. Due to its capability of competing with the endogenous OBF-1 counterpart for an endogenous ligand, a fragment displaying a selective physiological characteristic of OBF-1, e.g. a fragment interacting with Oct-1 or Oct-2, is envisaged as a therapeutic agent. The invention accordingly provides OBF-1 for use in medicine.

Moreover, the invention provides a method for preparing a protein of the invention characterized in that suitable host cells producing said protein are multiplied in vitro or jn vivo. Preferably, the host celts are transformed (transfected) with a vector comprising an expression cassette comprising a promoter and a DNA sequence coding for OBF-1 which DNA is controlled by said promoter. Subsequently, the protein of the invention may be recovered. Recovery comprises e.g. isolating the protein from the culture broth or from the host cells. Preferred is a method for preparation of a functionally active protein. Any method known in the art for purification of proteins from recombinant cell culture may be used, including chemical solubilisation of proteins produced as inclusion bodies. Preferably, however, the protein is produced in soluble form and advantageously it is secreted by the host microorganism.

OBF-1 may also be derivatized in vitro, e.g. to prepare immobilized OBF-1 and labelled OBF-1 , e.g. for affinity purification of OBF-1 antibodies. The proteins of the invention are useful e.g. as immunogens, in drug screening assays, as reagents for immunoassays and in purification methods, such as affinity purification of a binding ligand, and as therapeutics.

In accordance with yet another embodiment of the present invention, there are provided antibodies specifically recognizing and binding to OBF-1. For example, such antibodies may be generated against the OBF-1 having the amino acid sequences set forth in SEQ ID Nos. 2 or 4. Alternatively, OBF-1 or OBF-1 fragments (which may also be synthesized by in vitro methods) are fused (by recombinant expression or an in vitro peptidyl bond) to an immunogenic polypeptide and this fusion polypeptide, in turn, is used to raise antibodies against an OBF-1 epitope.

Anti-OBF-1 antibodies are recovered from the serum of immunized animals. Alternatively, monoclonal antibodies are prepared from cells in vitro or from in vivo immunized animals in conventional manner. Preferred antibodies identified by routine screening inhibit the interaction of OBF-1 with Oct-1 or Oct-2.

The antibodies of the invention are useful for studying OBF-1 tissue localization, screening of an expression library to identify nucleic acids encoding OBF-1 or the structure of functional domains, as well as in diagnostic applications, for the purification of OBF-1 , and the like.

The invention particularly relates to the specific embodiments as described in the Examples which serve to illustrate the present invention but should not be construed as a limitation thereof.

Example 1 : Cloning of OBF-1

In order to isolate OBF-1 , a protein specifically interacting with Oct proteins, an experimental approach based on the two-hybrid technique (Chien et al., 1991) was used. In that technique, the protein of interest is expressed in yeast cells (S. cerevisiae) as a fusion protein with a DNA binding domain (DBD; this is hybrid protein #1 ). Usually, the DBD of the yeast transcription factor Gal4 is used. This yeast strain also contains a reporter gene whose activity can be easily assayed and which is under the control of Gal4 binding sites. On its own the fusion protein should not activate transcription significantly above the background level. A cDNA library is then prepared in a yeast expression vector such that the cDNA (derived from the appropriate cell line or tissue) is fused randomly to a transcription activation domain active in yeast (this is hybrid protein #2, thus the name two- hybrid). If a particular cDNA encodes a protein (or protein domain) interacting with the target protein (and if the cDNA is in-frame with the expression vector-derived activation domain) an elevated transcription from the reporter gene can be measured. The corresponding cDNA can then be rescued from the yeast cells, amplified in E. coli and characterised further.

To isolate OBF-1 the principle of the method by Chien et al. has been modified, in that an intact Oct protein (i.e. not Oct fused to a heterologous DBD) is used as target. The reasoning underlying said modification is that proteins containing 2 DBDs (i.e. the heterologous one and the endogenous Oct DBD) may be inactive when tested functionally. An intact protein is more likely to have the proper three-dimensional structure that might be required for proper interaction. The method used is described in brief below, and in detail in sections 1.1 to 1.5 which follow.

A plasmid is constructed to express an essentially intact Oct-1 protein from a centromeric yeast vector, using the promoter and termination sequences of the yeast TATA binding protein gene. To ensure a proper nuclear targeting of the Oct-1 protein in yeast, a nuclear localisation sequence (NLS) derived from the SV40 T-antigen protein is engineered at the N terminus of Oct-1.

The his 3 gene, which codes for the enzyme imidazole glycerol phosphate dehydratase (IGP), an enzyme required for the biosynthesis of the amino acid histidine, is used as a reporter gene. When histidine is absent from the growth medium his 3 gene expression is required for growth (e. g. Struhl, 1983). In addition, a competitive inhibitor of IGP exists, 3- aminotriazole (3-AT), which allows the use of the his 3 gene as a selectable marker. In the presence of increasing amounts of 3-AT in the medium, only those yeast cells that have an elevated his 3 expression (due to increased transcription of the his 3 gene) can grow. A his 3 reporter is made which contains, in the his 3 promoter upstream of the TATA box, six copies of an octamer site derived from the Ig heavy chain intron enhancer (Ylp55- AT/H36).

This reporter construct is reintroduced in yeast at the original his 3 locus, to generate the strain called Y:AT.H36. In this strain the expression vector coding for Oct-1 is then introduced, generating the screening strain Y:AT.H36/OCT1.

An inducible expression vector is constructed which contains the transcription activation domain from VP16, a very potent transcription activator from Herpes Simplex Virus, under the control of a hybrid Gal1-10/his 3 promoter (pRS314/UASQ-NLSNP16(Sfi1)). This vector allows the expression, upon galactose induction, of fusion proteins between the VP16 activation domain and any cDNA that is inserted downstream of it. Using this expression vector a cDNA library with mRNA extracted from the human B cell line Namalwa (ATCC CRL-1432) is constructed. Plasmid DNA is then prepared from the cDNA library and used to transform the yeast strain containing the his 3 reporter and expressing Oct-1. This allows the isolation of a cDNA coding for OBF-1 , a novel protein.

General techniques: Unless specified otherwise, all recombinant DNA piasmids are constructed using standard techniques (e.g. restriction digestion, gel electrophoresis, ligation, fill-in reactions, DNA sequencing, polymerase chain reaction, etc..) as described in

Ausubel et al., 1990 and Sambrook et al., 1989. Yeast media are, unless specified otherwise, as described by Sherman in Guide to Yeast Genetics and Molecular Biology,

Methods in Enzymology, vol. 194, pp. 3-21 (1991). In particular, the following media are used:

YPD: 1 % (w/v) Bacto-yeast extract (Difco), 2 % (w/v) Bacto-peptone, 2 % (w/v)glucose or galactose (for galactose, a quality containing less than 0.01 % glucose should be used;

Sigma).

YPAD: as YPD with the addition of 0.01 volume of 0.25 % adenine. minimal medium lacking uracil and tryptophan (CAA medium : 0.67 % (w/v) casamino acids

(Difco), 0.67 % (w/v) yeast nitrogen base without amino acids (Difco), 2 % (w/v) glucose,

0.01 volume of 0.25 % (w/v) adenine.

Synthetic medium lacking histidine and containing AT: 0.17 % (w/v) yeast nitrogen base without amino acids and A171SO4 (Difco), 0.5 % (w/v) ammonium sulfate, 2 % (w/v) glucose or galactose, 0.01 volume of each: 0.5 % (w/v) tryptophan, 0.25 % (w/v) uracil, 1 % (w/v) leucine, 0.25 % (w/v) adenine, 1 % (w/v) lysine. 3-Aminotriazole (AT) is added at the appropriate concentration.

FOA (5-fluoroorotic acid) medium: is made with CAA medium supplemented with 0.1% (w/v) FOA, 0.01 volume of 0.5 % (w/v) tryptophan and 0.02 volume of 0.25 % (w/v) uracil. Solid medium for plates contains, in addition to the above, 2 % agar.

Experimental:

1.1 Construction of the yeast vector expressing Oct1.

The Oct1 protein is expressed constitutively from a single copy plasmid using the native transcriptional initiation and termination signals of the yeast TATA binding protein (TBP) gene.

The parental plasmid p2DN-1 from which these regulatory sequences are derived carries a 2.3 kb Pstl-BamH1 genomic fragment containing the entire yeast TBP gene and extending 1kb upstream and 500bp downstream of the coding region (Cormack et al, 1991). This gene differs from wild type by the presence of an EcoRI site introduced upstream of the naturally occurring ATG initiator codon ( I I I I I I GAATTCAT ATG: Cormack et al., 1991). The promoter and 5'-untranslated region of the TBP gene is first subcloned as a ca. 1 kbp Pstl-EcoR1 fragment into pUC19 (Yanisch-Perron et al., 1985) between the PstI and EcoRI sites, before being introduced into pRS316 (Sikorski and Hieter, 1989) as a Hind3 (from the pUC19 polylinker)-EcoR1 fragment, resulting in plasmid pRS316.TBP5'. pRS316 is a centromeric plasmid carrying the URA 3 selectable marker.

An Nde1 site is introduced at the first ATG of the Oct1 sequence described by Sturm et al. (1988) by polymerase chain reaction (PCR) using pBS-Oct1+ (Sturm et al., 1988) as template and the following forward and reverse oligonucleotide primers: forward 5 ' -GGG CAT ATG AAC AAT CCG TCA GAA ACC-3 ¹ reverse 5 ' -GAG TAG TAA CTG TTG CTG GGC AGG-3 * .

The resulting 375 bp PCR fragment is then directly ligated into the pCRII vector from a T/A cloning kit (Invitrogen) and the DNA sequence of the resulting clone called pCRII/Oct1(Nde)5' is confirmed. A complete Oct-1 cDNA with the Nde1 site at the ATG is then reconstructed by ligating the three DNA fragments described below:

- a ca. 390 bp Nsi1 (from the pCRII polylinker)-Nhel fragment (containing the Nde1 -modified Oct-1 ATG) prepared from pCRII/Oct1(Nde)5\

- a ca. 2100 bp Nhel-Hind3 fragment which contains the C terminal region of Oct-1 including stop codon prepared from pBS-Oct1+ (Sturm et al., 1988)

- the accepting vector is Bluescript KS- (Stratagene) which is cleaved with PstI (compatible with Nsi1) and Hind3.

The resulting correct clone is called BlueKS-/Oct1 Nde5'-3'.

The final Oct-1 expression vector is then constructed by ligating four DNA fragments as follows:

- a double-stranded oligonucleotide is synthesized which has 5' EcoRI and 3' Nde1 compatible single-stranded extensions and provides an ATG as well as a nuclear localisation sequence (NLS) derived from SV40:

5'-AATTCAAA ATG CCC AAG AAG AAG CGG AAG GTC CA-3¹

3'-GTTT TAC GGG TTC TTC TTC GCC TTC CAG GTAT-5'

- ca. 2450 bp Nde1 -Hind3 fragment encoding the Oct-1 protein (with the Nde1 -modified ATG) prepared from BlueKS-/Oct1 Nde5'-3';

- a ca. 500 bp Hind3-BamH1 fragment comprising the 16 carboxy-terminal residues of yeast TBP and extending 460 bp in the 3' non coding region prepared from p2DN-1 (Cormack et al., 1991);

- the accepting vector is the previously described pRS316 derivative pRS316.TBP5' containing the 5' regulatory region and promoter of the yeast TBP gene. This plasmid is cleaved with EcoRI and BamH1 (site found in the pRS316 polylinker).

The resulting final plasmid is confirmed by DNA sequencing and is called pRS316/TBP5'3'- OCT1.

1.2 Construction of the his 3 reporter allele AT.H36

Our selection strategy relies on the observation that only yeast cells expressing induced levels of the his 3 gene will grow in the presence of 3-aminotriazole (AT), a competitive inhibitor of the his 3 gene product. A his 3 allele with six octamer sites 73bp upstream of the TATA box is constructed from Ylp55-Sc3760, an integrative plasmid carrying the URA 3 selectable marker and containing a 6.1 kbp segment of yeast chromosomal DNA with the entire pet56-his 3-ded1 gene region (Harbury and Struhl, 1989). First, a synthetic double-stranded oligonucleotide with Xhol and EcoRI compatible protruding ends

5'-TCGAGCAGAAGATCATAGAAGTACGCTAGATTTAGGG

CGTCTTCTAGTATCTTCATGCGATCTAAATCCCTTAA-5'

is inserted between the Xhol and Kpn1 sites of pGEM-7Zf(-) (Promega), together with a 700bp long EcoRI -Kpn1 fragment obtained from Ylp55-Sc3760 which includes the promoter and most of the coding region of the his 3 gene (called here his 3 promoter fragment). In the resulting plasmid, the unique EcoRI site (which is just upstream of the his 3 gene TATA box) is then eliminated by a filling reaction done with Klenow polymerase and the construct thus obtained is called GEM.his 3. Eco^".

A ca. 300bp Xhol fragment containing 6 copies of an octamer motif (called here 6x octa fragment) derived from the mouse immunoglobulin heavy chain intron enhancer (positions 518-564; numbering as in Ephrussi et al., 1985) is obtained from p6W+, a pUC derivative (described in Gerster et al., 1987). The 6x octa Xhol fragment is first inserted into the Xhol site of BluescriptKS- and results in clone Blue6W. In Blue6W, the former Hinfl site of the IgH enhancer DNA fragment (position ca. 560) is next to the Kpn1 site of the Bluescript polylinker.

The final reporter construct is then made by ligating together three fragments:

- the ca. 300 bp 6x octa fragment (prepared from Blue6W by digestion with Kpn1 , treatment with T4 DNA polymerase to eliminate the Kpn1 3' overhang and subsequent digestion with EcoRI)

- the ca. 700 bp his 3 promoter and coding region fragment (prepared from Gem. his 3. Eco^" by digestion with Xhol , filling of the 3' recessed end with T4 DNA polymerase, and subsequent digestion with Kpn1)

- the accepting vector is the large (ca. 8kbp) EcoRI -Kpn1 fragment from Ylp55-Sc3760. These various steps effectively replace the native EcoRI -Kpn1 fragment from Ylp55- Sc3760 by the chimeric 6x octa-his 3 promoter fragment, and generate the final reporter plasmid called Ylp55-AT/H36. The nucleotide sequence of the Ylp55-AT/H36 promoter region, presented from the EcoRI site 5' of the 6x octa fragment to the 4th nucleotide past the end of the his 3 TATA box, is as presented below. The borders of the 6 times repeated IgH enhancer fragment, the oct site and the his 3 TATA box are highlighted in bold.

5'-GAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGA T (CTGAGCAAAACACCACCTGGGTAATTTGCATTTCTAA AATAAGTCGA) _6x CTGAATCTCGAGGGGGGGCCCTCGAG CAGAAGATCATAGAAGTACGCTAGATTTAGGGAATTAATT CCTATAAAGTAA-3'

1.3 Construction of the parental yeast strain Y:AT.H36/OCT1

The screening of the library expressing hybrid proteins between the VP16 activation domain and random cDNA-encoded polypeptides requires a yeast strain containing an integrated copy of the AT/H36 his3 allele and expressing constitutively OCT1. After linearisation of Ylp55-AT/H36 with Xba1 , the AT/H36 his 3 allele is introduced into yeast strain KY320 (Chen and Struhl, 1988) by gene replacement of the his 3-D200 allele exactly as described (Scherer and Davis, 1979). The resulting Ura⁺ integrants are then grown on nonselective YPD medium before being streaked on 5-fluoroorotic acid (5-FOA) plates. This step selects against the URA 3 gene and hence for the loss of the plasmid sequence as a result of homologous recombination events between the parental and the new copies of the his 3 gene. The segregants that retain the AT/H36 his 3 allele are identified by their ability to grow in medium lacking histidine.

The final Y:AT.H36/OCT1 strain is generated by introducing pRS316/TBP5'3'-OCT1 into the segregant with the desired His⁺ phenotype using the lithium-acetate method (Becker and Guarente, 1991) and selecting for growth on plates lacking uracil.

1.4 Construction of an inducible yeast expression vector for the cDNA library

The library of hybrid proteins between the VP16 acidic activation domain and random cDNA fragments is expressed from a centromeric plasmid under control of the tightly regulated gal-his 3 hybrid promoter. This expression vector is constructed as follows. The 365 bp Gall -10 UASQ element fused to the his 3 promoter is derived from plasmid

3801 (Singer et al., 1988) by PCR, using the following forward and reverse oligonucleotide primers: forward S ' -TCTAGA GTCGAC GATCAAAAATCATCGC-3 ' reverse 5 ' -CCG GAATTC TTTGCCTTCGTTTATCTTG CC-3 ' . This step introduces an EcoRI site just upstream of the his 3 ATG initiator codon and a Sail site upstream of the Gall -10 UASQ element. The PCR reaction is carried out using as template DNA a derivative of plasmid 3801 in which the unique EcoRI restriction site located between the UASQ and the his 3 TATA box is deleted by filling the recessed 3' termini resulting from EcoRI digestion with the Klenow fragment of DNA polymerase I. The PCR product is digested with Sail and EcoRI and inserted into pUC19 for DNA sequencing. The resulting clone is called pUC19.Gal.his 3.

The VP16 acidic activation domain (amino acids 413 to 490) is amplified by PCR from plasmid pMSVP16 D1D3 (Triezenberg et al., 1988), using the following forward and reverse oligonucleotide primers: forward 5 ' -CCC GAATTC ACCATGGCCCCCCCGACCGATGTC-3 ' reverse 5 ' -CCG CATATG CCCACCGTACTCGTCAATTC- 3 ' .

This step introduces a 5' EcoRI site flanking an ATG initiator codon fused in frame to Ala-

413 of the VP16 coding region, and replaces the native VP16 TAG stop codon by a Nde1 site. After treatment with T4 DNA polymerase and subsequent cleavage with EcoRI, the

PCR product is cloned between the EcoRI and Sma1 sites of pUC19 to generate pUC19/VP16. The DNA sequence of the clone is confirmed.

A nuclear localisation sequence is subsequently fused in frame to the amino terminus of the VP16 activation domain by ligating three fragments as follows:

- a Hind3-Nde1 (Klenow filled-in) ca. 1kbp fragment including the 5' flanking region of yeast TBP coding region and sequences encoding the NLS prepared from pRS316/TBP5'3'- OCT1

- an EcoRI (Klenow filled-in)-BamH1 (from the pUC polylinker) fragment prepared from pUC19/VP16 encoding the VP16 activation domain

- the accepting vector is pRS314 (Sikorski and Hieter, 1989) cleaved with Hind3 at the polylinker site (partial digest) and BamH1. The gal-his 3 hybrid promoter prepared from pUC19.Gal.his 3 is then introduced into this intermediate construct as a Sail -EcoRI fragment between the Xhol (compatible with Sail) and EcoRI sites, hence replacing the TBP promoter region upstream of the NLS.VP16 coding sequence. The unique EcoRI site present in this plasmid (located 5' of the NLS.VP16 coding sequence) is deleted by filling the EcoRI recessed 3' termini with T4 DNA polymerase. The resulting plasmid is called PRS314/UASQ-NLS.VP16.

The final expression vector is prepared by inserting, at the 3' end of the VP16 activation domain (Nde1 site) in PRS314/UASG-NLS.VP16, a cDNA cloning cassette comprising a 800 bp long stuffer fragment derived from the chloramphenicol acetyltransferase (CAT) gene flanked by non-palindromic Sfi1 sites and the 3' termination signals of the yeast TBP gene. This is done as follows:

Two double-stranded phosphorylated adaptors having non-palindromic Sfi1 extensions are synthesized; these adaptors are kinased and annealed and have the following sequence:

5'-TATGGAATTCCGGCCGCAC-3'

3'- ACCTTAAGGCCGGC-3¹ dsAdaptor 1 and

5*- CGGCCGCTAACTGACTAGGTAC-3^• 3'-CACGCCGGCGATTGACTGATC-3' dsAdaptor 2

dsAdaptorl provides a Nde1 5' overhang and contains an internal EcoRI site; dsAdaptor2 introduces stop codons in each translational reading frame (CGGCCGCTAACTGACTAGGTAC) and provides a 3' Kpn1 overhang. An equimolar mixture of these two adaptors is first ligated for 3 hrs to ca. 1 μg of the purified 800 bp CAT Sfi1 fragment prepared from plasmid EBO-Sfi (Steimle et al., 1993). Unligated adaptors are then eliminated by selective isopropanol precipitation with ammonium acetate (Sambrook et al., 1989), and the adaptor-ligated CAT DNA fragment is then resuspended in TE. At this point the CAT fragment is a mixture of CAT fragments having a copy of dsAdaptorl at each end, or a copy of dsAdaptor2 at each end, or dsAdaptorl at one end and dsAdaptor2 at the other end. Only this latter fragment having two different adaptors will be efficiently ligated in the subsequent ligation step which is performed by ligating together the following fragments: - the adaptor-ligated CAT fragment mentioned above, - the TBP 3' termination signals as a ca. 500bp Kpn1-BamH1 fragment. To prepare this fragment, pRS316 TBP5'3'-OCT1 is cleaved with Hind3, the 3' recessed ends are filled with T4 DNA polymerase, and the plasmid is subsequently cleaved with BamHL The resulting ca. 500bp fragment is then isolated and subcloned between the Sma1 and BamH1 sites of pUC19. It can then be excised form this new clone as the Kpn1-BamH1 fragment mentioned just above.

The accepting vector is pRS314/UASQ-NLS.VP16 cleaved with Nde1 and BamHL Restriction analysis and DNA sequencing allows to identify the final clone having the following structure: Gal-his3 promoter/NLS/VP16 activation domain/ Nde1 -EcoRI -Sfil-CAT- Sfi1 -stop3x-Kpn1/3' TBP termination signals-BamH1. This expression vector is called pRS314/UAS_G-NLS.VP16(Sfi1).

1.5 Construction of an activation domain-tagged cDNA library derived from B cell mRNA cDNA synthesis

Total RNA is isolated from the human B lymphoid cell line Namalwa (ATCC CRL 1432) using an RNA Extraction Kit from Pharmacia (product # 27-9270-01 ) and following exactly the manufacturers instructions. A total of 3 x 10°^" cells are used and ca. 4.5 mg of total RNA is obtained. The RNA is diluted in sterile 10 mM Tris pH 7.5, 1 mM EDTA (TE) to a con¬ centration of 2 mg/ml and an aliquot (0.8 ml, equivalent to ca. 1.6 mg) is used for mRNA purification using an mRNA Purification Kit from Pharmacia (product #27-9258A), following exactly the manufacturers instructions (as recommended in the manual, two successive oligo-dT columns are used). A total of ca. 75 μg polyA⁺ RNA is obtained (i.e. yield ca.

4.6 %). cDNA is synthesized using a Superscript Choice System from Life Technologies (product # 530-8090SA). To 5 μg of polyA+ RNA, 2 μl of oligodT (tube A1 ) and 1 μl of random hexamer (tube A2) are added; after 10 min at 70°C, the mixture is chilled on ice. To that tube, 0.5 μl RNAsin (Promega), 4 μl 5x first strand buffer (tube A3), 2 μl 0.1 M DTT, 1 μl dNTPs (tube A5) and 1 μl α-³²P-dATP (Amersham, diluted 1 :5; 0.666 pmole) are added. The first strand synthesis reaction is started by adding 5 μl Superscript reverse transcriptase (from the kit) and incubating the reaction for 60 min at 42°C. The reaction is then transferred on ice. To the tube the following are added sequentially: 93 μl H2O, 30 μl 5x second strand buffer (tube B1), 3 μl dNTPs (tube A5), 1 μl E. coli ligase (tube B2), 4 μl E. coli DNA polymerase (tube B3), 1 μl RNAse H (tube B4). The reaction is incubated for 2 hours at 16°C, 2 μl T4 DNA polymerase (tube B5) are added and the reaction is incubated for another 10 min at 16°C and then finally quenched on ice. 10 μl 0.5 M EDTA and 16 μl 3M NaAc are added, the reaction is extracted with phenol: chloroform (1:1), and the nucleic acids in the supernatant are precipitated by addition of 425 μl 100 % EtOH. The sample is centrifuged in a microfuge, washed with EtOH 80 %, resuspended in 75 μl TE and passed over a Sepharose 4CLB column to get rid of the small cDNAs (SizeSep column from Pharmacia; product # 27-5105-01) following exactly the manufacturers instructions. The eluate is divided in three equal aliquots (of ca. 20 μl each) and each aliquot is used for a separate ligation reaction to double-stranded Sfi1 adaptors, in each translational reading frame. The adaptors have previously been kinased and annealed and have the following sequence:

5'-AGGCCAAAG-3' 3'-GTGTCCGGTTTC-5'

5'-AGGCCAAAGC-3' 3'-GTGTCCGGTTTCG-5'

5'-AGGCCAAAGCG-3' 3'-GTGTCCGGTTTCGC-5'

Each ligation reaction contains 20 μl cDNA and 190 pmoles kinased and annealed adaptor in a final volume of 30 μl. After 15 hrs at 16°C the 3 reactions are pooled and precipitated with NH4AC and EtOH. The cDNA is collected by centrifugation, washed with 80% EtOH and resuspended in 100 μl TEN (10 mM Tris pH 7.5; 1 mM EDTA; 25 mM NaCI). The cDNA is then size-fractionated by passing over a Sephacryl column (provided in the cDNA synthesis kit), following exactly the manufacturers instructions. The different cDNA fractions are EtOH precipitated individually, and each cDNA pellet is finally resuspended in 10 μl TE.

Preparation of the vector for library construction

13 μg of the pRS314/UASQ-NLS.VP16(Sfi1) vector are digested for ca. 14 hr with ca. 30 u.

Sfi1 under mineral oil. The reaction is then precipitated with NH4AC and EtOH, the DNA is collected by centrifugation and resuspended in 200 μl TE. The cut vector is deposited on 2 sucrose gradients prepared (as described by Kieffer, 1991) in SW41 centrifuge tubes. The gradients are centrifuged for 16 hrs at 30000 rpm in a SW41 rotor. The lower band (vector) is collected, the EtBr is removed by 1-Butanol extraction, the sample is diluted with 1 vol. H2O and the DNA is precipitated with isopropanol after adjusting the NaCI concentration to 0.2 M (final) and adding 12mg linear polyacrylamide as carrier. The vector DNA is collected by centrifugation and resuspended in TE at a concentration of ca. 50 ng/μλ. cDNA ligation and E. coli transformation

Ligation reactions are set up with 50 ng vector (prepared as above) and varying amounts of size-fractionated, Sfi1 adaptors-ligated cDNA in 20 μl reactions containing 50 mM Tris pH 7.6, 10 mM MgCI , 1 mM ATP, 5% (w/v) PEG 8000, 1 mM DTT and 20 u T4 DNA ligase (N. E. Biolabs). After ligation for 12 hrs at 16°C, the DNA is phenol and phenol-CHCl3 extracted and then EtOH precipitated after addition of NaAc. (0.3 M final concentration) and 1.5mg yeast RNA as carrier. The DNA is collected by centrifugation, the pellet is washed extensively with 80% EtOH and then resuspended in 4 μl TE. 1 μl of each ligation is then used for el ectropo ration of ElectroMax DH10B electrocompetent bacteria (Life Technologies product # 530-8290 SA) following exactly the manufacturers instructions. On the basis of the number of transformants obtained the optimal cDNA:vector ratio is determined and additional ligation reactions are set up and subsequently processed as described.

cDNA library amplification

The products corresponding to several electroporations as described above are pooled (corresponding to a total number of ca. 8 x 10⁶ individual transformants) and plated onto LB/agar plates containing 100 μg/ml ampicillin at a density of 50 000 colony forming units (cfus)/132 mm plate. After overnight growth at 37°C, the colonies are washed from the plates with LB medium and pooled. An aliquot corresponding to ca. half of the sample is frozen away for future reamplification, and the rest is used for plasmid DNA preparation using a Magic Maxiprep Kit from Promega (product # A7270). The resulting DNA is then used for the yeast screening.

Screening of the VP16.cDNA fusion library

The library of fusion proteins is introduced into the yeast screening strain Y:AT.H36/OCT1 according to Schiestl and Gietz (1989), with the following modifications: an overnight culture, grown to 1x10⁷ cells/ml in glucose minimal medium lacking uracil to maintain selection for the plasmid expressing OCT1, is diluted to 2x10⁶ cells/ml in fresh YPAD medium and regrown to 1x10⁷ cells/ml. Cells from a 50ml culture are resuspended in 500 μl TE/LiAc buffer and directly mixed with 20 μg cDNA library plasmid DNA and 500 μg human polyA" RNA. After 30 min incubation at 30°C with agitation, the cell suspension is dispensed equally in five eppendorf tubes. The subsequent steps are done exactly according to the published protocol. After heat shock, the cells are pooled and incubated for 1 hour at 30°C in 500 ml of YPAD with agitation. The complexity of the library (2x10⁶ independent double transformants) is estimated by plating an aliquot of the culture on glucose minimal plates lacking uracil and tryptophan. Transformants are recovered by centrifugation, inoculated into 500ml of glucose minimal medium lacking uracil and tryptophan to select for double transformants, and incubated for 16 hr at 30°C, at which time the culture consists of approximately 25% Trp⁺/Ura⁺ cells. An aliquot of the culture (7x10⁸ cells representing 1.7x10⁸ transformants) is harvested by centrifugation, resuspended in 50ml YP medium supplemented with galactose, and incubated for 5 hr at 30°C with constant agitation. This step, during which the cells do not divide, is required to induce the expression of the hybrid protein library. After centrifugation, the cells are resuspended in 5ml TE/LiAc buffer, and the transformants plated on galactose synthetic medium lacking histidine and containing 10mM AT; approximately 2x10⁷ cells (5x10°^* double transformants) are plated on each of 20 plates.

After 10 days incubation at 30°C, 20 to 30 aminotriazole resistant colonies are observed on each plate. Fifty five of them are grown on synthetic medium lacking tryptophan but containing uracil before being plated on medium containing 5-fluoroorotic acid (5-FOA), a drug that selects against cells expressing OCT1 from the URA 3 plasmid (Sikorski and Boeke, Guide to Yeast Genetics and Molecular Biology, in Methods in Enzymology vol. 194, pp 302-318, 1991). The resulting Ura7Trp⁺ segregants are then tested for growth on AT- containing medium. Only six of the transformants loose their ability to grow on AT when their OCT1 plasmid is cured; this suggests that these clones require both Oct1 and the cDNA library plasmid for growth. This phenotype is confirmed more directly by rescuing the VP16.cDNA containing piasmids from 5-FOA resistant colonies according to Robzyk and Kassir (1992), and reintroducing them individually into the parental Y:AT.H36 yeast strain in presence or absence of the OCT1 expressing vector. Growth on 10 mM AT-containing medium is observed only in the presence of the Oct-1 plasmid. This definitively confirms that both Oct-1 and the cDNA library plasmid-encoded protein are required for growth and therefore genetically defines an interaction between these two proteins. Partial sequence analysis and restriction mapping of the cDNA inserts reveals that four of them represent three independent clones derived from the same mRNA corresponding to a novel gene which we call OBF-1 (Oct Binding Factor 1 ). One clone referred to as pRS314/UNVP16/clone9 has been deposited with the DSM under accession no. 9200.

Several overlapping restriction fragments from one of the rescued human OBF-1 cDNA clones (pRS314/UNVP16/clone9) are subcloned in pUC19 or Bluescript and their DNA sequence is determined. Analysis of the sequence obtained (SEQ ID No.1) shows that OBF-1 is an entirely novel gene, with no homology to any sequence present in the GenEMBL database (searches done with several different programs such as FASTA, tFASTA or the BLAST series of programs).

Example 2: Murine OBF-1

By homology hybridisation the mouse homologue of OBF-1 is also isolated from a cDNA library prepared from the mouse B cell line S194. As a probe, the ca. 2 kbp Sfi cDNA insert present in human clone pRS314/UNVP16/clone 9, DSM accession number 9200) is used. The hybridisation is performed at 67°C for 16 hours in a solution containing 6 x SSC (20 x SSC is: 3 M NaCI, 0.3 M trisodium citrate), 5 x Denhardt's (100 x Denhardt's is 2 % (w/v) bovine serum albumin, 2 % (w/v) Ficoll 400, 2 % (w/v) polyvinylpyrollidone), 0.5 % SDS (sodium dodecyl sulfate) and 0.1 mg/ml denatured salmon sperm DNA. The filters are then washed as follows: 2 x 5 min at room temperature in 2 x SSC, 0.1 % SDS, 3 x 30 min at 60°C in 2 x SSC, 0.1 % SDS; 2 x 30 min at 60°C in 1 x SSC, 0.1 % SDS. Several clones are isolated and confirmed by secondary and tertiary screenings under the same conditions. The nucleotide sequence of the mouse OBF-1 cDNA (SEQ ID No. 3) is determined after progressive deletions are generated from either end of the cDNA subcloned in Bluescript IIKS+.

The OBF-1 cDNA can also be isolated from another species (e.g. rat) by using a PCR- based strategy. Degenerate primers (because of the genetic code degeneracy) can be designed on the basis of the presented sequence allowing to amplify a DNA fragment corresponding to part of the OBF-1 cDNA (the "quality" or "efficacy" of these primers can be evaluated by performing test reactions with the mouse or the human clone). With such primers available, it is then possible to attempt the amplification of the corresponding DNA fragment from the species of interest, by using cDNA derived from B cells (or any other OBF-1 expressing cells) from that species (an already prepared cDNA library is also suitable for that purpose). The amplified DNA fragment can then be subcloned in a standard vector and its nucleotide sequence determined. Once the correct fragment is obtained (on the basis of the sequence similarity with the presented mouse or human OBF- 1 sequence), it can then be used to rescreen cDNA libraries from the species of interest in order to isolate a complete OBF-1 clone from that species.

The conceptually translated sequences commencing at the first ATG of both OBF-1 clones (human and mouse) produce 256 amino acid OBF-1 proteins (SEQ ID Nos. 2 and 4) which do not contain any known protein motif (such as a leucine zipper, a homeodomain, etc.). Except for its richness in proline residues (39 residues in the human clone, 41 in the mouse clone) OBF-1 does not show any obvious feature. Known transcription factors, such as CTF-1 , have been shown to be rich in proline residues and to contain proline-rich activation domains (Mermod et al., 1989). Thus it is possible that some of the proline residues of OBF- 1 might serve a similar function.

Example 3: Pattern of expression of the OBF-1 gene

Northern blot analysis of RNAs from various sources, either organ (polyA⁺ RNAs) or cell lines (total RNAs), shows that OBF-1 expression is highly restricted. In the expressing cells or organs a major RNA species is detected ca. 3.0 to 3.2 kb in size. Analysis with a radiolabelled probe derived from hOBF-1 (the ca. 2 kb Sfi1 cDNA insert present in pRS314/UNVP16/clone 9) shows strong expression in spleen and peripheral blood leukocytes, weak expression in thymus and small intestine and no detectable expression in prostate, testis, ovary and colon (polyA⁺ RNAs). Analysis of total RNA derived from various human cell lines shows strong expression in Namalwa and BJA-B (B cell lines), weak expression in Molt3 and Hut78 (T cell lines) and in HepG2 (hepatocytes), and no detectable expression in the following cells: K562 (myeloid leukemia), U937 (monocyte/macrophage), 293T (fibroblast), HeLa (cervix carcinoma, epithelial), MCF-7 (mammary carcinoma). Furthermore, analysis of total RNA from several mouse B cell lines with the mouse OBF-1 probe gives the following pattern: intermediate to high expression in J558L, MPC11 and S194 B cell lines and weak expression in 70Z/3, 40E-1 , 18-81 and 220- 8 pre-B cell lines. ln conclusion the expression of the OBF-1 gene is highly cell-specific, being expressed mostly in cells of lymphoid origin. In addition the gene appears to be developmentally regulated, as several pre-B cell lines show significantly lower levels of expression than the mature B cell lines tested.

Example 4: Interaction between OBF-1 and Oct factors

The yeast assay genetically identifies an interaction between Oct-1 and OBF-1. To directly demonstrate at the biochemical level this interaction, the hOBF-1 cDNA was recloned in pEVRF, a CMV enhancer-based expression vector suitable for expression of cDNAs in mammalian cells (Matthias et al., 1989) giving rise to plasmid pEV-OBF. The pEV-OBF-1 construct was made by ligating together the three DNA fragments indicated below: a Sma Ho Sfi I fragment from pEVRFO (Matthias etal., 1989); this fragment contains the ampicillin resistance gene, prokaryotic origin of replication and CMV eukaryotic promoter/enhancer sequences as well as an ATG translation initiation codon in an optimised context; an Eco Rl (filled in) to Hind III OBF-1 cDNA fragment from plasmid pRS314/UNVP16/clone 9; this fragment is derived from the complete OBF-1 cDNA clone (the Eco Rl site is derived from the vector and the Hind III site is within the 3' untranslated region of the OBF-1 cDNA) and includes the 5' leader sequences present in the sequence shown as Seq ID No: 1 ; and a Hind III to Sfi I fragment from plasmid p3S/2-457 (Mϋller-lmmergluck et al., 1990): this fragment contains splice and polyadenylation signals derived from the rabbit β- globin gene (the fragment is normally found in pEVRF vectors and was derived from p3S/2- 457 simply because of the presence of a convenient Hind III restriction site).

The pEV-OBF-1 plasmid leads to the expression, in eukaryotic cells, of the OBF-1 protein with translation starting at the ATG derived from the pEVRF vector.

The pEV-OBF-1 plasmid was then transiently transfected, alone or in combination with an Oct-2 expression vector (OEV1 +, Mϋller et al, 1988), into 293T cells, a highly transfectable human fibroblastic cell line. After 2 days nuclear extracts were prepared from the transfected cells and used in an electrophoretic mobility shift assay (EMSA, also called gel retardation or gel shift assay; Rezvin, 1989) done with a labelled DNA probe containing an octamer site derived from the intron heavy chain enhancer (similar to a monomer of the oct site present in plasmid Ylp55-AT/H36). While the control extract gave rise to only one shift due to the endogenous Oct-1 protein, the extract from OBF-1 transfected cells gave rise to 2 shifts; the Oct-1 shift, and a second shift of lower mobility (a so-called supershift higher up in the gel) due to the complex between endogenous Oct-1 and transfected OBF-1. Similarly, the extracts from cells cotransfected with OBF-1 and Oct-2 gave rise to yet additional shifts due to either Oct-2 alone or to the complex between Oct-2 and OBF-1. A control reaction was performed with an extract from 293T cells that had been cotransfected with expression vectors for OBF-1 and PU.1 , a transcription factor from the Ets family. In that case, with the appropriate DNA probe containing a PU.1 binding site, only a single complex due to PU.1 was observed, indicating that OBF-1 does not interact with PU.1. This result biochemically demonstrates that OBF-1 can interact specifically with both Oct-1 and Oct-2, and that it does not interact with a transcription factor from a different family, PU.1. Furthermore the OBF-1 / Oct-2 interaction was also demonstrated in the yeast assay using a yeast strain expressing the Oct-2 protein.

Additional transfections have been similarly performed with expression vectors expressing only the POU domain of Oct-1 , Oct-2 or Oct-6, another Oct factor of the POU family. The results obtained showed that the POU domain of either Oct-1 or Oct-2 is sufficient for interaction with OBF-1: by contrast, the POU domain of Oct-6 does not interact detectably with OBF-1. This suggests that OBF-1 is a cofactor specific for Oct-1 and Oct-2, but not for other Oct family members. OBF-1 does not appear to bind to DNA by itself.

Example 5: OBF-1 based transactivated expression system

To assay whether OBF-1 can directly influence transcription, as would be expected from a coactivator, a transactivated mammalian expression system was designed. In this system, an expression plasmid encoding a desired polypeptide, in this case a reporter polypeptide, is cotransfected with a second plasmid directing expression of OBF-1 (pEV-OBF) or with an empty expression vector as a control, and the resulting activity from the reporter is measured after 2 to 3 days. The expression plasmid used contains a promoter with an octamer motif (derived from the intron heavy chain enhancer) controlling transcription of the luciferase gene (this reporter is based on the pGL2-enhancer plasmid from Promega and the promoter is identical to the promoter present in the OCTA(1 ) plasmid described by Mϋller et al., 1988). The result obtained shows that OBF-1 activates transcription from this plasmid ca. 10 fold (through the endogenous Oct-1 protein). Additional transactivation experiments done in HeLa cells and with other reporter piasmids confirm the initial results. As expected, activation by OBF-1 is dependent of the integrity of the oct site present in the promoter of the reporter plasmid.

Thus, although no transcription activation domain is clearly evident from the conceptually translated OBF-1 protein sequence, it appears that OBF-1 is a strong transcription activator, perhaps defining a novel class of such proteins. It is perhaps the first cell-specific coactivator to be isolated.

Deposition Data

On May 9, 1994 plasmid pRS314/UNVP16 clone9 was deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Mascheroder Weg 1b, D- 38124 Braunschweig, under accession no. 9200.

References

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. &

Struhl, K. eds. (1990) Current Protocols in Molecular Biology, John Wiley & Sons, Inc.

Becker and Guarente, Guide to Yeast Genetics and Molecular Biology, in Methods in

Enzymology vol. 194, pp 182-187, 1991

Chen, W. & Struhl, K. (1988) PNAS 85, 2691-2695

Chien, C.-T., Bartel, P. L, Stemglanz, R. & Fields, S. (1991) PNAS 88, 9578-9582

Corcoran, L M., Karvelas, M., Nossal, G. J. V., Ye, Z.-S., Jacks, T. & Baltimore, D. (1993)

Genes Dev. 7, 570-582

Cormack, B. P., Strubin, M., Ponticelli, A. S. & Struhl, K. (1991) Cell 65, 341-348

Dalton, S. & Treisman, R. (1992) Cell 68, 597-612

Dreyfus, M., Doyen, N. & Rougeon, F. (1987) EMBO J. 6, 1685-1690

Ephrussi, A., Church, G. M., Tonegawa, S. & Gilbert, W. (1985) Science 227, 134-140

Gerster, T., Matthias, P., Thali, M., Jiricny, J. & Schaffner, W. (1987) EMBO J. 6, 1323-1330

Guthrie, C. & Fink, G. R. eds. (1991) Guide to Yeast Genetics and Molecular Biology, in

Methods in Enzymology, vol. 194

Harbury, & Struhl, K. (1989), Mol. Cell. Biol. 9, 5298-5304

Herr, W., Sturm, R. A., Clerc, R. G., Corcoran, L. M., Baltimore, D., Shaφ, P. A., Ingraham,

H. A., Rosenfeld, M. G., Finney, M., Ruvkun, G. & Horvitz, H. R. (1988) Genes Dev. 2,

1513-1516

Johnson, D. G., Carayannopoulos, L, Capra, J. D., Tucker, P. W. & Hanke, J. H. (1990)

Mol. Cell. Biol. 10, 982-990

Kieffer, B. I. (1991) Gene 109, 115-119

LaBella, F., Sive, H. L, Roeder, R. G. & Heintz, N. (1988) Genes Dev. 2, 32-39

LeBowitz, J. H., Kobayashi, T., Staudt, L M., Baltimore, D. & Shaφ, P. A. (1988) Genes

Dev. 2, 1227-1237

Luo, Y., Fujii, H., Gerster, T. & Roeder, R. G. (1992) Cell 71 , 231-241

Matthias, P., Mϋller, M. M., Schreiber, E., Rusconi, S. & Schaffner, W. (1989) NAR 17, 6418

Mermod, N., ONeill, E. A., Kelly, T. J. & Tjian, R. (1989) Cell 58, 741-753

Mϋller, M. M., Ruppert, S., Schaffner, W. & Matthias, P. (1988) Nature 336, 544-551

Mϋller-lmmergluck, M. M., Schaffner, W. and Matthias, P. (1990) EMBO J. 9, 1625-34

Peterson, M. G. & Baichwal, V. R. (1993) TIBTECH 11 , 11-18

Pierani, A., Heguy, A., Fujii, H. & Roeder, R. G. (1990) Mol. Cell. Biol. 10, 6204-6215

Revzin, A. (1989) Biotechniques 7, 346-355 Robzyk, K & Kassir, Y. (1992) NAR 20, 3790

Sambrook, J., Fritsch, E. & Maniatis, T. eds. (1989) Molecular Cloning: A Laboratory

Manual, Cold Spring Harbor Laboratory Press, New York

Schόler, H. R., Hatzopoulos, A. K., Balling, R., Suzuki, N. & Gruss, P. (1989) EMBO J. 8,

2543-2550

Scherer, S. & Davis, R. W. (1979) PNAS 76, 4951-4956

Schiestl, R. H. & Gietz, R. D. (1989) Current Genetics 16, 339-346

Sikorski, R. S. & Hieter, P. (1989) Genetics 122, 19-27

Singer, V., Wobbe, R. C. & Struhl, K. (1990) Genes Dev. 4, 636-645

Staudt, L M., Clerc, R. G., Singh, H., LeBowitz, J. H., Shaφ, P. A. & Baltimore, D. (1988)

Science241 , 577-580

Staudt, L. M. & Lenardo, M. J. (1991 ) Annual Rev. Immunol. 9, 373-398

Steimle, V., Often, L. A., Zufferey, M. & Mach, B. (1993) Cell 75, 135-146

Struhl, K. (1983) Cold Spring Harbor Symposia on Quantitative Biology vol. XLVIl, pp.901-

904

Sturm, R. A., Das, G. & Herr, W. (1988) Genes Dev. 2, 1582-1599

Triezenberg, S. J., Kingston, R. C. & McKnight, S. L. (1988) Genes Dev. 2, 718-729

Van Dijk, M. A., Voorhoeve, P. M. & Murre, C. (1993) PNAS 90, 6061-6065

Yanisch-Perron, O, Vieira, J. & Messing, J. (1985) Gene 33, 103-119

Wirth, T., Staudt, L M. & Baltimore, D. (1987) Nature 329, 174-178

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: CIBA-GEIGY AG

(B) STREET: Klybeckstr. 141

(C) CITY: Basel

(E) COUNTRY: SCHWEIZ

(F) POSTAL CODE (ZIP): 4002

(G) TELEPHONE: +41 61 69 11 11 (H) TELEFAX: + 41 61 696 79 76 (I) TELEX: 962 991

(ii) TITLE OF INVENTION: Factor Interacting With Nuclear Protein

(iii) NUMBER OF SEQUENCES: 4

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 909 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 97..864

(D) OTHER INFORMATION: /product= "human OBF-1"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GCGGTGGCTC CACTGGAGGA AAACACACCC CGGTCTCACA TTAAAGAAGC CAAACTGTCG 60

GCTTCAAAGA GAAAAGGCAA CATCCTGTCA CAGGCC ATG CTC TGG CAA AAA CCC 114

Met Leu Trp Gin Lys Pro 1 5

ACA GCT CCG GAG CAA GCC CCA GCC CCG GCC CGG CCA TAC CAG GGC GTC 162 Thr Ala Pro Glu Gin Ala Pro Ala Pro Ala Arg Pro Tyr Gin Gly Val 10 15 20

CGT GTG AAG GAG CCA GTG AAG GAA CTG CTG AGG AGG AAG CGA GGC CAC 210 Arg Val Lys Glu Pro Val Lys Glu Leu Leu Arg Arg Lys Arg Gly His 25 30 35

GCC AGC AGT GGG GCA GCA CCT GCA CCT ACG GCG GTG GTG CTG CCC CAT 258 Ala Ser Ser Gly Ala Ala Pro Ala Pro Thr Ala Val Val Leu Pro His 40 45 50

CAG CCC CTG GCG ACC TAC ACC ACA GTG GGT CCT TCC TGC CTG GAC ATG 306 Gin Pro Leu Ala Thr Tyr Thr Thr Val Gly Pro Ser Cys Leu Asp Met 55 60 65 70

GAA GGT TCT GTG TCT GCA GTG ACA GAG GAG GCT GCC CTG TGT GCC GGC 354 Glu Gly Ser Val Ser Ala Val Thr Glu Glu Ala Ala Leu Cys Ala Gly

75 80 85

TGG CTC TCC CAG CCC ACC CCG GCC ACC CTG CAG CCC CTG GCC CCA TGG 402 Trp Leu Ser Gin Pro Thr Pro Ala Thr Leu Gin Pro Leu Ala Pro Trp 90 95 100

ACA CCT TAC ACC GAG TAT GTG CCC CAT GAA GCT GTC AGC TGC CCC TAC 450 Thr Pro Tyr Thr Glu Tyr Val Pro His Glu Ala Val Ser Cys Pro Tyr 105 110 115

TCA GCT GAC ATG TAT GTG CAG CCC GTG TGC CCC AGC TAC ACG GTG GTG 498 Ser Ala Asp Met Tyr Val Gin Pro Val Cys Pro Ser Tyr Thr Val Val 120 125 130

GGG CCC TCC TCA GTG TTG ACC TAT GCC TCT CCG CCA CTC ATC ACC AAT 546 Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser Pro Pro Leu lie Thr Asn 135 140 145 150

GTC ACG ACA AGA AGC TCC GCC ACG CCC GCA GTG GGG CCC CCG CTG GAG 594 Val Thr Thr Arg Ser Ser Ala Thr Pro Ala Val Gly Pro Pro Leu Glu 155 160 165

GGC CCA GAG CAC CAG GCA CCC CTC ACC TAT TTC CCG TGG CCT CAG CCC 642 Gly Pro Glu His Gin Ala Pro Leu Thr Tyr Phe Pro Trp Pro Gin Pro 170 175 180

CTT TCC ACA CTA CCC ACC TCC ACC CTG CAG TAC CAG CCT CCG GCC CCA 690 Leu Ser Thr Leu Pro Thr Ser Thr Leu Gin Tyr Gin Pro Pro Ala Pro 185 190 195

GCC CTA CCT GGG CCC CAG TTT GTC CAG CTC CCC ATC TCT ATC CCA GAG 738 Ala Leu Pro Gly Pro Gin Phe Val Gin Leu Pro lie Ser lie Pro Glu 200 205 210

CCA GTC CTT CAG GAC ATG GAA GAC CCC AGA AGA GCC GCC AGC TCG TTG 786 Pro Val Leu Gin Asp Met Glu Asp Pro Arg Arg Ala Ala Ser Ser Leu 215 220 225 230

ACC ATC GAC AAG CTG CTT TTG GAG GAA GAG GAT AGC GAC GCC TAT GCG 834 Thr lie Asp Lys Leu Leu Leu Glu Glu Glu Asp Ser Asp Ala Tyr Ala 235 240 245 CTT AAC CAC ACT CTC TCT GTG GAA GGC TTT TAGGCGTGGC TCCCACCTGA 884 Leu Asn His Thr Leu Ser Val Glu Gly Phe 250 255

GTCCTGTTCC CTGAAACTGG GATTT 909

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 256 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Leu Trp Gin Lys Pro Thr Ala Pro Glu Gin Ala Pro Ala Pro Ala 1 5 10 15

Arg Pro Tyr Gin Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu 20 25 30

Arg Arg Lys Arg Gly His Ala Ser Ser Gly Ala Ala Pro Ala Pro Thr 35 40 45

Ala Val Val Leu Pro His Gin Pro Leu Ala Thr Tyr Thr Thr Val Gly 50 55 60

Pro Ser Cys Leu Asp Met Glu Gly Ser Val Ser Ala Val Thr Glu Glu 65 70 75 80

Ala Ala Leu Cys Ala Gly Trp Leu Ser Gin Pro Thr Pro Ala Thr Leu

85 90 95

Gin Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Pro His Glu 100 105 110 Ala Val Ser Cys Pro Tyr Ser Ala Asp Met Tyr Val Gin Pro Val Cys 115 120 125

Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser 130 135 140

Pro Pro Leu lie Thr Asn Val Thr Thr Arg Ser Ser Ala Thr Pro Ala 145 150 155 160

Val Gly Pro Pro Leu Glu Gly Pro Glu His Gin Ala Pro Leu Thr Tyr 165 170 175

Phe Pro Trp Pro Gin Pro Leu Ser Thr Leu Pro Thr Ser Thr Leu Gin 180 185 190

Tyr Gin Pro Pro Ala Pro Ala Leu Pro Gly Pro Gin Phe Val Gin Leu 195 200 205

Pro lie Ser lie Pro Glu Pro Val Leu Gin Asp Met Glu Asp Pro Arg 210 215 220

Arg Ala Ala Ser Ser Leu Thr lie Asp Lys Leu Leu Leu Glu Glu Glu 225 230 235 240

Asp Ser Asp Ala Tyr Ala Leu Asn His Thr Leu Ser Val Glu Gly Phe

245 250 255

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1150 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA [ix ) FEATURE :

(A) NAME/KEY: CDS

(B) LOCATION: 178..945

(D) OTHER INFORMATION: /product= "murine OBF-1"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CCTGAGGTAG GAGGATGTGA TGACGTGGCC CCTCTCAGCG GGAACTCGGG CCTTTAAAAA 60

GCTGAAGAAA CAGCCTCAGA GTAAACGGTG GTTCCACGGG AGGAAAGCAC GCCCAGTCAC 120

ATTAAAGAAG CCAAACTGTC TGCTTCAAAG AGAAAAGGCA ACATCCTGTC ACAAGCC 177

ATG CTC TGG CAA AAA TCC ACA GCT CCA GAG CAA GCT CCT GCC CCA CCA 225 Met Leu Trp Gin Lys Ser Thr Ala Pro Glu Gin Ala Pro Ala Pro Pro 1 5 10 15

AGG CCA TAC CAG GGT GTT CGA GTC AAG GAG CCA GTG AAG GAG CTA CTG 273 Arg Pro Tyr Gin Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu 20 25 30

AGA AGA AAG CGT GGC CAT ACC AGC GTT GGG GCA GCT GGG CCA CCG ACC 321 Arg Arg Lys Arg Gly His Thr Ser Val Gly Ala Ala Gly Pro Pro Thr 35 40 45

GCG GTG GTA CTG CCC CAC CAG CCC CTG GCC ACC TAC AGC ACT GTG GGT 369 Ala Val Val Leu Pro His Gin Pro Leu Ala Thr Tyr Ser Thr Val Gly 50 55 60

CCT TCC TGC CTT GAC ATG GAG GTT TCT GCT TCC ACA GTG ACA GAG GAG 417 Pro Ser Cys Leu Asp Met Glu Val Ser Ala Ser Thr Val Thr Glu Glu 65 70 75 80

GGA ACA TTA TGT GCT GGC TGG CTC TCC CAA CCT GCC CCG GCC ACT CTT 465 Gly Thr Leu Cys Ala Gly Trp Leu Ser Gin Pro Ala Pro Ala Thr Leu

85 90 95 CAG CCA TTG GCT CCA TGG ACA CCC TAC ACG GAG TAT GTG TCC CAT GAA 513 Gin Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Ser His Glu 100 105 110

GCT GTC AGC TGC CCC TAC TCC ACT GAC ATG TAC GTG CAG CCT GTG TGC 561 Ala Val Ser Cys Pro Tyr Ser Thr Asp Met Tyr Val Gin Pro Val Cys 115 120 125

CCC AGC TAC ACA GTG GTG GGA CCC TCC TCG GTG TTG ACC TAT GCT TCT 609 Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser 130 135 140

CCA CCA CTC ATC ACT AAT GTC ACG CCA AGA AGC ACT GCT ACA CCC GCG 657 Pro Pro Leu lie Thr Asn Val Thr Pro Arg Ser Thr Ala Thr Pro Ala 145 150 155 160

GTG GGG CCC CAG CTG GAG GGT CCC GAG CAC CAG GCG CCC CTC ACT TAT 705 Val Gly Pro Gin Leu Glu Gly Pro Glu His Gin Ala Pro Leu Thr Tyr 165 170 175

TTC CCG TGG CCT CAG CCC CTT TCC ACA CTG CCC ACC TCC AGC CTG CAG 753 Phe Pro Trp Pro Gin Pro Leu Ser Thr Leu Pro Thr Ser Ser Leu Gin 180 185 190

TAT CAA CCT CCT GCC CCA ACC CTG TCT GGG CCC CAG TTT GTC CAG CTC 801 Tyr Gin Pro Pro Ala Pro Thr Leu Ser Gly Pro Gin Phe Val Gin Leu 195 200 205

CCC ATC TCT ATC CCA GAG CCA GTC CTT CAG GAC ATG GAT GAC CCC AGA 849 Pro lie Ser lie Pro Glu Pro Val Leu Gin Asp Met Asp Asp Pro Arg 210 215 220

AGG GCC ATC AGC TCC CTG ACC ATT GAC AAG CTG CTT CTG GAG GAA GAG 897 Arg Ala lie Ser Ser Leu Thr lie Asp Lys Leu Leu Leu Glu Glu Glu 225 230 235 240

GAA AGC AAC ACG TAC GAG CTC AAC CAC ACC CTC TCC GTG GAG GGC TTT 945 Glu Ser Asn Thr Tyr Glu Leu Asn His Thr Leu Ser Val Glu Gly Phe 245 250 255

TAGGGCTGGC TTGCATCTAA CAGATGTTTC ACCCATAGCT GAGATTTTAA AAGTGTTCAA 1005

TAGAGCCCAG ACTTCTGTTT GAAGTAGCTA TTTCACAGGC TTCCTTTCTT CCTAAAGCTA 1065

AATTGTATCC CTTCTTTCTC CCTTCTTCCT TCCCTCGCTT CCTTCCTTCC CCCACTGCCA 1125

TCTTGCTTAT TTCTTATTTC TCCTT 1150

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 256 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Met Leu Trp Gin Lys Ser Thr Ala Pro Glu Gin Ala Pro Ala Pro Pro 1 5 10 15

Arg Pro Tyr Gin Gly Val Arg Val Lys Glu Pro Val Lys Glu Leu Leu 20 25 30

Arg Arg Lys Arg Gly His Thr Ser Val Gly Ala Ala Gly Pro Pro Thr 35 40 45

Ala Val Val Leu Pro His Gin Pro Leu Ala Thr Tyr Ser Thr Val Gly 50 55 60

Pro Ser Cys Leu Asp Met Glu Val Ser Ala Ser Thr Val Thr Glu Glu 65 70 75 80

Gly Thr Leu Cys Ala Gly Trp Leu Ser Gin Pro Ala Pro Ala Thr Leu 85 90 95

Gin Pro Leu Ala Pro Trp Thr Pro Tyr Thr Glu Tyr Val Ser His Glu 100 105 110

Ala Val Ser Cys Pro Tyr Ser Thr Asp Met Tyr Val Gin Pro Val Cys 115 120 125

Pro Ser Tyr Thr Val Val Gly Pro Ser Ser Val Leu Thr Tyr Ala Ser 130 135 140

Pro Pro Leu lie Thr Asn Val Thr Pro Arg Ser Thr Ala Thr Pro Ala 145 150 155 160

Val Gly Pro Gin Leu Glu Gly Pro Glu His Gin Ala Pro Leu Thr Tyr 165 170 175

Phe Pro Trp Pro Gin Pro Leu Ser Thr Leu Pro Thr Ser Ser Leu Gin 180 185 190

Tyr Gin Pro Pro Ala Pro Thr Leu Ser Gly Pro Gin Phe Val Gin Leu 195 200 205

Pro lie Ser lie Pro Glu Pro Val Leu Gin Asp Met Asp Asp Pro Arg 210 215 220

Arg Ala lie Ser Ser Leu Thr lie Asp Lys Leu Leu Leu Glu Glu Glu 225 230 235 240

Glu Ser Asn Thr Tyr Glu Leu Asn His Thr Leu Ser Val Glu Gly Phe 245 250 255

Claims

12. Nucleic acid according to claim 1 which codes for a mammalian, particularly human protein.

13. Nucleic acid according to claim 1 which encodes a protein having substantially the same amino acid sequence as set forth in SEQ ID No. 2.

14. DNA according to claim 11 having substantially the same nucleotide sequence as set forth in SEQ ID No. 1.

15. Nucleic acid according to claim 1 which encodes a protein having substantially the same amino acid sequence as set forth in SEQ ID No. 4.

16. DNA according to claim 11 having substantially the same nucleotide sequence as set forth in SEQ ID No. 3.

17. Nucleic acid according to claim 1 wherein the nucleotides of said nucleic acid hybridize to substantially the entire coding region of the DNA set forth in SEQ ID Nos. 2 or 4, respectively.

18. Nucleic acid according to claim 1 which is a mRNA.

19. Vector according to claim 3 which is plasmid pRS314/UNVP16/clone9 deposited with the DSM under accession number 9200.

20. Host cell expressing a nucleic acid of claim 1.

21. A method comprising culturing the host cell of claim 20 to express a protein according to claim 5 and recovering the protein from the host cell.

22. Composition of claim 6 wherein the protein is functionally active.

23. Composition according to claim 6 wherein the protein is antigenically active.