CN110305905B - Mouse Tmem240 recombinant eukaryotic expression plasmid, lentivirus and construction method - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a mouse Tmem240 recombinant eukaryotic expression plasmid, a lentivirus and a construction method. The recombinant eukaryotic expression plasmid is obtained by inserting the SEQ ID NO.1 sequence between an XhoI site and an EcoRI site of a pEGFP-N1 vector. The lentivirus construction is to use pEGFP-T240-N1 plasmid as a template, and utilize a primer pair 1 to carry out PCR amplification to synthesize a target fragment containing APEX 2; carrying out double enzyme digestion on the vector pLVX-EGFP-N1; carrying out double enzyme digestion on the Tmem240 fragment; carrying out double enzyme digestion on the APEX 2-containing target fragment; recovering an APEX2 target fragment and a vector pLVX-EGFP-N1 of a Tmem240 fragment of an enzyme digestion product, connecting T4 ligase, transforming competent cells, and carrying out colony PCR verification; plasmid extraction and sequencing are carried out, thus obtaining pLVX-T240-APEX2-EGFP which is successfully constructed, the pLVX-T240-APEX2-EGFP, psPAX2 and pMD2.G plasmids are jointly transfected to 293Ta cells, and the pLVX-T240-APEX2-EGFP is obtained by collection.

Description

Mouse Tmem240 recombinant eukaryotic expression plasmid, lentivirus and construction method

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a mouse Tmem240 recombinant eukaryotic expression plasmid, a lentivirus and a construction method.

Background

One member of the TMEM family, TMEM240, is a protein found in the brain and cerebellum that encodes a transmembrane domain, and its intracellular localization, function and mechanism of action have not been reported so far at home and abroad. Human TMEM240 is located at 36.33 of chromosome 1, the gene sequence is 1128bp in length, contains 4 exons and codes

Protein of 172 amino acids, molecular weight 22KD. The mouse Tmem240 is located on chromosome 4, has a gene sequence with a full length of 1378bp, contains 4 exons, encodes protein with 172 amino acids, and has a molecular weight of 22KD. The human TMEM240 and murine TMEM240 protein sequences were found to be 97.69% identical using a BLAST functional query of Pubmed. By analyzing the amino acid sequence of the Tmem240 protein through TMHMM bioinformatics software and performing bioinformatics analysis, the Tmem240 is found to encode transmembrane protein containing 2 transmembrane structures and has certain hydrophobic characteristics.

As a newly discovered gene, the biological function of TMEM240 is completely unknown, and only one relevant document on Pubmed exists. The literature reports that spinocerebellar ataxia type 21, abbreviated as SCA21, is an autosomal dominant hereditary neurodegenerative disease, and the accompanying symptoms of mental retardation and serious cognitive dysfunction are characterized in progressive cerebellar ataxia, and the lesions are mainly in spinal cord and cerebellum. The document clearly reports that the autosomal dominant hereditary neurodegenerative disease SCA21 is located at 1p36.33-p36.32 at the site of the chromosome causing the disease; pathogenic mutations in the transmembrane protein gene TMEM240 (c.509c4t/p.p170l) were identified by whole exome sequencing and then confirmed by Sanger sequencing and cosegregation analysis. A novel virulence gene in the autosomal dominant SCA family, TMEM240, has various missense mutations (c.509C4T/p.P170L, c.239C4T/p.T80M, c.346C4T/p.R116C, c.445G4A/p.E149K, c.511C4T/p.R171W) and stop mutations (c.489C4G/p.Y163) in 8 different SCA21 families, the frequency of these mutations being 2% (8/368); all involved amino acids were conserved during evolution (from zebrafish to humans). This document shows that TMEM240 is a small, highly conserved transmembrane protein, highly expressed in the brain, with no homology to known proteins, capable of causing the autosomal dominant hereditary neurodegenerative disease SCA 21.

The function of the transmembrane protein coded by TMEM240 is unknown, the action mechanism is still questionable, and the expression quantity of the gene has close relation with the constructed expression plasmid. In order to further research the function of the transmembrane protein encoded by the TMEM240, an expression plasmid capable of efficiently expressing the transmembrane protein encoded by the TMEM240 needs to be constructed.

Disclosure of Invention

The invention provides a foundation for exploring Tmem240 functions by constructing pEGFP-Tmem240 eukaryotic expression plasmids and constructing lentiviruses over expressing Tmem240-APEX2 by utilizing the pEGFP-Tmem240 eukaryotic expression plasmids.

The first purpose of the invention is to provide a mouse Tmem240 recombinant eukaryotic expression plasmid, wherein the recombinant eukaryotic expression plasmid is obtained by inserting a sequence shown as SEQ ID NO.1 between an XhoI site and an EcoRI site of a pEGFP-N1 vector.

The second purpose of the invention is to provide a method for constructing the recombinant eukaryotic expression plasmid, which comprises the following steps:

s1, obtaining a Tmem240 target fragment: c57BL/6 mouse cerebral cortex cDNA is used as a PCR template, a primer pair 1 is designed for amplification, and gel recovery is carried out to obtain a gel recovery product Tmem240 segment; the primer pair 1 has the following sequences:

Tmem240-F：AACTCGAGACCATGTCCATGAGTGTGAAC；

Tmem240-R：AAGAATTCGGAGGTGCCGCGGGCTG；

s2, performing double enzyme digestion on the gel recovery product Tmem240 fragment and the vector pEGFP-N1 vector by using restriction endonucleases XhoI and EcoRI respectively, and recovering the enzyme digestion product Tmem240 fragment and the vector pEGFP-N1 fragment;

s3, connecting the enzyme digestion product Tmem240 fragment and the pEGFP-N1 carrier fragment by using T4DNA ligase;

s4, transforming the ligation product into escherichia coli DH5 alpha competent cells, and verifying a monoclonal colony by PCR;

s5, extracting the plasmid to obtain a mouse Tmem240 recombinant eukaryotic expression plasmid which is named as pEGFP-T240-N1.

The third objective of the present invention is to provide a lentivirus constructed from the above mouse Tmem240 recombinant eukaryotic expression plasmid.

The fourth purpose of the invention is to provide a construction method of the lentivirus, which comprises the following steps:

s1, taking pEGFP-T240-N1 plasmid as a template, and carrying out PCR amplification by using primers Tmem240-F and Tmem240-R to obtain a Tmem240 fragment; synthesizing a target fragment containing APEX2, wherein the sequence of the target fragment containing APEX2 is shown as SEQ ID NO. 4;

s2, carrying out double enzyme digestion on the vector pLVX-EGFP-N1 by using restriction enzymes XhoI and BamHI; carrying out double enzyme digestion on the obtained Tmem240 fragment by using restriction enzymes XhoI and EcoRI; carrying out double enzyme digestion on the obtained APEX 2-containing target fragment by using restriction endonucleases EcoRI and BamHI;

s3, enzyme digestion product recovery is carried out on the Tmem240 fragment, the APEX 2-containing target fragment and the vector pLVX-EGFP-N1, T4 ligase is connected with the three enzyme digestion products, then competent cell transformation is carried out on the connection products, and colony PCR verification is carried out;

s4, extracting plasmids from the transformed competent cells, sequencing, and obtaining the successfully constructed pLVX-T240-APEX2-EGFP after the sequencing is correct;

s5, virus packaging: the pLVX-T240-APEX2-EGFP, psPAX2 vector and pMD2.G plasmid were co-transfected into 293Ta cells and collected, tmem240-APEX2 lentivirus.

In order to research the subcellular localization and functions of Tmem240, brain tissue is selected as a cDNA template for Tmem240 gene cloning, pEGFP-N1 is used as a vector, pEGFP-Tmem240 eukaryotic expression plasmids are obtained by a gene cloning method, and in order to determine the subcellular localization of Tmem240 in cells, pLVX-T240-APEX2-EGFP-N1 plasmids and pLVX-EGFP-N1 plasmids are constructed, transfected into 293Ta cells and packaged into lentiviruses.

The functions and the application of the lentivirus are mainly reflected in that:

1. over-expressing the mouse Tmem240 gene in cells of primary mammals (including in vivo and in vitro primary cultures) or in cell lines of mammalian origin and obtaining the corresponding Tmem240 protein;

2. obtaining a mouse Tmem240 protein fused with an EGFP tag, which can directly reveal the position of the Tmem240 protein in a fluorescence imaging system, and can be co-precipitated by binding to an EGFP antibody or purified of the Tmem240 protein;

3. the Tmem240-APEX2 carried by the virus can be imaged by electron microscopy after DAB staining, showing intracellular localization of Tmem240 at a high resolution level.

Drawings

FIG. 1 shows the construction of an overexpression system of Tmem240 in Neuro-2a cells, FIG. 1A shows that Tmem240-GFP eukaryotic expression plasmid is transfected into Neuro-2a cells, and the expression distribution in the cells is observed by a confocal microscope, wherein the scale bar is 8 μm; figure 1B shows Real-time PCR at mRNA level to verify successful construction of Neuro-2a cell Tmem240 overexpression system, # P <0.001 compared to GFP group; FIG. 1C shows that Western Blot verifies the successful construction of the Neuro-2a cell Tmem240 overexpression system at the protein level.

FIG. 2 shows the collection of cell samples after puromycin screening, FIG. 2A shows the original magnification times 50, and FIG. 2B shows the original magnification times 30000.

Detailed Description

The present invention is described in detail below with reference to specific examples, but it should be understood that the scope of the present invention is not limited by the specific examples. The following examples are generally conducted under conventional conditions, and the materials are commercially available as the materials, and the steps thereof will not be described in detail since they do not relate to the invention.

Example 1

Construction method of mouse Tmem240 recombinant eukaryotic expression plasmid

The mouse Tmem240 recombinant eukaryotic expression plasmid is obtained by inserting a sequence shown as SEQ ID NO.1 between an XhoI site and an EcoRI site of a pEGFP-N1 vector.

The method specifically comprises the following steps:

s1, obtaining a Tmem240 target fragment: c57BL/6 mouse cerebral cortex cDNA was used as PCR template for amplification, 25. Mu.L of total PCR system, as shown in Table 1:

PCR System of S1 in Table 1

Reaction procedure: 10min at 94 ℃, 20s at 94 ℃, 30s at 60 ℃, 1min at 72 ℃ and multiplied by 32 cycles, 10min at 72 ℃.

The amplification product was subjected to 1.5% agarose gel electrophoresis, 120V,25min, imaging with a gel apparatus, excised as a gel block containing Tmem240, recovered from the gel containing Tmem240 using a nucleic acid gel recovery kit, and stored at-20 ℃.

S2, carrying out double enzyme digestion on the Tmem240 gel recovery product and the pEGFP-N1 vector by using restriction enzymes XhoI and BamHI, wherein the enzyme digestion system is 50 mu L, and is specifically shown in Table 2:

TABLE 2 S2 restriction enzyme System

Recovering Tmem240 and the enzyme digestion product of the carrier according to the experimental steps of the Cycle-Pure Kit PCR purification Kit, measuring the concentration, and storing to-20 ℃.

S3, connecting the Tmem240 fragment and the vector by using T4DNA ligase, wherein the system is 10 mu L, and the concrete steps are shown in a table 3:

TABLE 3 S3 connection scheme

S4, transformation: taking 1.5EP, adding 50 mu L of DH5 alpha competent cells, operating on ice, otherwise reducing transformation efficiency, adding 5 mu L of the ligation product into a 1.5EP tube, gently mixing uniformly, inserting into ice for 30min, water bathing at 42 ℃ for 90s, inserting into ice again for 3min, and then not moving, adding 450 mu L of negative LB liquid culture medium into the 1.5EP tube, placing an air shaking table for 180r/min,45min,37 ℃, uniformly coating the bacterial liquid on Kana resistant bacterial solid culture medium, and placing the bacterial plate upside down in a spreading box for 12-16h.

PCR validation of monoclonal colonies: aseptically picking 4 monoclonal colonies on an overnight bacterial plate, adding 1mL of LB bacterial culture medium with corresponding resistance, taking 1 mu L of the LB bacterial culture medium as a PCR template, adding primers and enzyme to carry out PCR reaction at 37 ℃ for 3h, and continuously placing the rest on an air shaking table, wherein the PCR reaction system is 10 mu L, and is specifically shown in Table 4:

PCR System of S4 in Table 4

S5, plasmid extraction: extracting Tmem240 recombinant plasmid by using a plasmid extraction kit instruction, measuring the concentration, and sending to a company for sequencing.

And (3) sequence alignment: the sequences were aligned using BLAST in Pubmed, the sequencing results were correct, and the recombinant plasmid was named pEGFP-T240-N1.

Recombinant plasmid stability verification experiment:

recovering Neuro-2a cells, adjusting the cells to a good state, generally in a logarithmic growth phase, inoculating the cells into a corresponding cell culture plate according to the density, enabling the cells to occupy about 90% of the area of the culture plate on the day of transfection, and placing a sterile cell slide in a pore plate if necessary; returning Opti-MEM to room temperature, and placing Lipofectamine2000, tmem240 plasmids and control plasmids on ice; taking an appropriate amount of 1.5EP tubes, dividing the tubes into two groups, marking, adding 50 mu L of room-temperature Opti-MEM into the 1.5EP tube, adding 2 mu L of Lipofectamine2000 into the first group of EP tubes, and marking; adding 1 μ g of target plasmid and control plasmid into the second group of EP tubes, labeling, and reacting at room temperature for 5min; gently mixing the plasmid and the liquid in the Lipofectamine2000 two tubes, and reacting at room temperature for 20min; the cell culture solution of the culture plate is replaced by Opti-MEM, and each well is 500 mu L; after 20min at room temperature, adding the mixed solution into a cell culture plate, uniformly mixing, and placing into a dressing box; after 4h, the liquid in the cell culture plate was replaced with 10% DMEM medium without PS, and the cells were cultured in a cell-plating chamber; plasmid transfection efficiency was observed by fluorescence microscopy after 2 d.

The distribution of expression of exogenous Tmem240 in the cells was observed by fluorescence microscopy and was found to be spotted in the cells (FIG. 1A). Tmem240-Neuro-2a stable clone cell line is screened, and the screening result is verified by using Real-time PCR (figure 1B) and Western Blot (figure 1C), which indicates that the Tmem240 overexpression system is successfully constructed.

Example 2

Construction of lentiviruses

S1, taking pEGFP-T240-N1 plasmid as a template, utilizing primers Tmem240-F and Tmem240-R to carry out PCR amplification, and synthesizing a sequence containing an APEX2 target fragment shown as SEQ ID NO. 4; the introduction sequences are shown in table 1:

the PCR system is shown in Table 5:

PCR System of S1 in Table 5

Reaction procedure: 10min at 94 ℃, 20s at 94 ℃, 30s at 60 ℃, 1min at 72 ℃ and multiplied by 30 cycles, 10min at 72 ℃.

S2, carrying out double enzyme digestion on the vector pLVX-EGFP-N1 by using restriction enzymes XhoI and BamHI; carrying out double enzyme digestion on the obtained Tmem240 fragment by using restriction enzymes XhoI and EcoRI; the obtained APEX2 fragment was subjected to double digestion using restriction enzymes EcoRI and BamHI. The reaction conditions are as follows: storing at 37 deg.C, 2h,65 deg.C, 20min and-20 deg.C. The enzyme digestion system is 50. Mu.L, and is specifically shown in Table 6:

enzyme digestion System of Table 6 S2

S3, enzyme digestion product recovery is carried out on the Tmem240 fragment, the APEX 2-containing target fragment and the vector pLVX-EGFP-N1, T4 ligase is used for connecting three enzyme digestion products, then competent cell transformation is carried out on the connecting products, colony PCR verification is carried out, and the connecting system is shown in a table 7:

connection system of table 7 S3

And (3) transformation: taking 1.5EP, adding 50 mu L of DH5 alpha competent cells, operating on ice, otherwise reducing the transformation efficiency, adding 5 mu L of a ligation product into a 1.5EP tube, softly and uniformly mixing, inserting into ice for 30min, carrying out water bath at 42 ℃ for 90s, inserting into ice again for 3min, adding 450 mu L of a negative LB liquid culture medium into the 1.5EP tube, placing an air shaking table at 180r/min,45min,37 ℃, uniformly coating the bacteria liquid on an AMP-resistant bacteria solid culture medium, inverting the bacteria plate, and placing the bacteria plate in a dressing box for 12-16h.

And S4, plasmid extraction and sequencing are carried out, a sequencing sequence is input into Blast in Pubmed for comparison, and sequencing is carried out correctly to obtain successfully constructed pLVX-T240-APEX2-EGFP.

S5, virus packaging: recovering 293Ta cells, adjusting the state to logarithmic growth phase according to 1X 10 ⁶ And inoculating each cell into a 6-well plate, wherein the cell coverage rate reaches about 90% on the day of transfection.

3h before transfection, the culture was changed to fresh 10% DMEM without diabody, opti-MEM was returned to room temperature, and Lipofectamine2000, plasmid, was placed on ice; taking 2 1.5EP tubes as A and B, the configuration system is shown in Table 8:

table 8 S5 culture solution preparation System

Standing for 5min at room temperature; mixing the liquid in the tube A and the tube B with a 1mL gun, avoiding using strength, and standing for 20min; the cell culture solution for replacing the cell culture plate is Opti-MEM,216.8 mu L/hole; after 20min, adding the mixed solution into a cell culture plate, uniformly mixing, and continuously culturing for 4h; after 4h, the culture solution in the cell culture plate is changed into fresh 10-percent DMEM culture solution without double antibody, and the culture is continued; transfection efficiency was observed by 72h fluorescence microscopy.

And (3) virus collection: and (3) observing the virus infection efficiency after three days of transfection, collecting the supernatant in a centrifugal tube, centrifuging at 4000r/min,15min and 4 ℃, extracting the supernatant, passing through a 0.4-micron filter membrane, adding a lentivirus concentrated solution, inverting and uniformly mixing every 20-30min according to the proportion of adding 3mL of concentrated solution to every 10mL of filtrate for 4 times, standing at 4 ℃,12-16h, centrifuging at 3000r/min,45min and 4 ℃ the next day, discarding the supernatant, paying attention to sucking, adding a DMEM stock solution, adjusting the infection efficiency of each virus time, uniformly mixing on ice, subpackaging in an EP tube, quickly freezing by liquid nitrogen, and storing at-80 ℃.

pLVX-T240-APEX2-EGFP lentivirus infects Neuro-2a cells

1) Neuro-2a cells are inoculated in the pore plate and the cell culture bottle for culture for 2d;

2) Adding pLVX-T240-APEX2-EGFP into Neuro-2a culture solution according to the proportion that MOI =5, replacing the culture solution without virus for 24h, continuing culturing, and observing the cell state;

3) Observing the transfection efficiency by a fluorescence microscope for 72 h;

4) Cell samples were collected after puromycin screening (FIG. 2A, original magnification × 50), and intracellular morphology of Tmem240 was observed under a transmission electron microscope after DAB staining as a multi-layer globular structure (FIG. 2B, original magnification × 30000).

Sequence listing

<110> Harbin university of medicine

<120> mouse Tmem240 recombinant eukaryotic expression plasmid, lentivirus and construction method

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 519

<212> DNA

<213> Artificial sequence

<400> 1

atgtccatga gtgcgaacac catgatcttc atgattctgg gggcgtcgat cgtgatggcc 60

atcgcgtgct tgatggacat gaacgcgctg ctggaccgat tccataacta catcctcccg 120

cacctgcggg gcgaggaccg cgtctgccac tgcaactgtg gccggcacca catccactac 180

gtgatcccat acgacgggga ccagtcggtg gtggacgcct ctgagaacta ctttgtgaca 240

gacaatgtga ccaagcagga gatcgacctt atgctgggcc tgctgctggg tttctgcatc 300

agttggttcc tggtgtggat ggacggcgtt ctgcactgcg ctgtacgcgc ctggagggct 360

ggtcggcgct atgatggctc gtggacctgg ctgcccaagc tgtgcagcct gcgggagctg 420

ggccggcggc cacacaggcc cttcgaggag cctacgggga acatggtgca cgtgaagcag 480

aagctctacc acaacggcca ccccagcccg cggcacctc 519

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence

<400> 2

aactcgagac catgtccatg agtgtgaac 29

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence

<400> 3

aagaattcgg aggtgccgcg ggctg 25

<210> 4

<211> 775

<212> DNA

<213> Artificial sequence

<400> 4

tttgaattcg ctcgggcgga aagtcttacc caactgtgag tgctgattac caggacgccg 60

ttgagaaggc gaagaagaag ctcagaggct tcatcgctga gaagagatgc gctcctctaa 120

tgctccgttt ggcattccac tctgctggaa cctttgacaa gggcacgaag accggtggac 180

ccttcggaac catcaagcac cctgccgaac tggctcacag cgctaacaac ggtcttgaca 240

tcgctgttag gcttttggag ccactcaagg cggagttccc tattttgagc tacgccgatt 300

tctaccagtt ggctggcgtt gttgccgttg aggtcacggg tggacctaag gttccattcc 360

accctggaag agaggacaag cctgagccac caccagaggg tcgcttgccc gatcccacta 420

agggttctga ccatttgaga gatgtgtttg gcaaagctat ggggcttact gaccaagata 480

tcgttgctct atctgggggt cacactattg gagctgcaca caaggagcgt tctggatttg 540

agggtccctg gacctctaat cctcttattt tcgacaactc atacttcacg gagttgttga 600

gtggtgagaa ggaaggtctc cttcagctac cttctgacaa ggctcttttg tctgaccctg 660

tattccgccc tctcgttgac aaatatgcag cggacgaaga tgccttcttt gctgattacg 720

ctgaggctca ccaaaagctt tccgagcttg ggtttgctga tgcctcggat ccttt 775

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence

<400> 5

ggttaattaa tagttattaa tagtaatc 28

Claims (2)

1. The mouse Tmem240 lentivirus is characterized in that the construction method of the lentivirus comprises the following steps:

s1, taking pEGFP-T240-N1 plasmid as a template, and carrying out PCR amplification by using primers Tmem240-F and Tmem240-R to obtain a Tmem240 fragment; and synthesizing a target fragment containing the APEX2, wherein the sequence of the target fragment containing the APEX2 is shown as SEQ ID NO. 4; the pEGFP-T240-N1 plasmid is obtained by inserting a sequence shown as SEQ ID NO.1 between an XhoI site and an EcoRI site of a pEGFP-N1 vector;

s2, carrying out double enzyme digestion on the vector pLVX-EGFP-N1 by using restriction enzymes XhoI and BamHI; carrying out double enzyme digestion on the obtained Tmem240 fragment by using restriction enzymes XhoI and EcoRI; carrying out double enzyme digestion on the obtained APEX 2-containing target fragment by using restriction endonucleases EcoRI and BamHI;

s3, enzyme digestion product recovery is carried out on the Tmem240 fragment, the APEX 2-containing target fragment and the vector pLVX-EGFP-N1, T4 ligase is connected with the three enzyme digestion products, competent cell transformation is carried out on the connection products, and colony PCR verification is carried out;

s4, extracting plasmids from the transformed competent cells, sequencing, and obtaining the successfully constructed pLVX-T240-APEX2-EGFP after the sequencing is correct;

s5, virus packaging: the pLVX-T240-APEX2-EGFP, the psPAX2 vector and the pMD2.G plasmid are transfected to 293Ta cells together and collected to obtain the Tmem240-APEX2 lentivirus.

2. The mouse Tmem240 lentivirus of claim 1, wherein the construction of the pEGFP-T240-N1 plasmid comprises the steps of:

s1, obtaining a Tmem240 target fragment: c57BL/6 mouse cerebral cortex cDNA is used as a PCR template, a primer pair 1 is designed for amplification, and gel recovery is carried out to obtain a gel recovery product Tmem240 segment; the primer pair 1 has the following sequences:

Tmem240-F：AACTCGAGACCATGTCCATGAGTGTGAAC；

Tmem240-R：AAGAATTCGGAGGTGCCGCGGGCTG；

s2, carrying out double enzyme digestion on the Tmem240 fragment and the pEGFP-N1 vector which are gel recovery products by using restriction enzymes XhoI and EcoRI respectively, and recovering the Tmem240 fragment and the pEGFP-N1 vector fragment which are enzyme digestion products;

s3, connecting the Tmem240 fragment of the enzyme digestion product and the pEGFP-N1 carrier fragment by using T4DNA ligase;

s4, transforming the ligation product into escherichia coli DH5 alpha competent cells, and verifying a monoclonal colony by PCR;

s5, extracting the plasmid to obtain a mouse Tmem240 recombinant eukaryotic expression plasmid which is named as pEGFP-T240-N1.

Images