CN108753819B - Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein - Google Patents

Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein Download PDF

Info

Publication number
CN108753819B
CN108753819B CN201810554975.7A CN201810554975A CN108753819B CN 108753819 B CN108753819 B CN 108753819B CN 201810554975 A CN201810554975 A CN 201810554975A CN 108753819 B CN108753819 B CN 108753819B
Authority
CN
China
Prior art keywords
eukaryotic expression
gdf11
expression vector
dhfr
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810554975.7A
Other languages
Chinese (zh)
Other versions
CN108753819A (en
Inventor
任哲
刘俊伟
王紫鋆
陈静怡
王一飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jinan University
Original Assignee
Jinan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jinan University filed Critical Jinan University
Priority to CN201810554975.7A priority Critical patent/CN108753819B/en
Publication of CN108753819A publication Critical patent/CN108753819A/en
Application granted granted Critical
Publication of CN108753819B publication Critical patent/CN108753819B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/495—Transforming growth factor [TGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a eukaryotic expression vector, a eukaryotic expression system, preparation methods and applications of the eukaryotic expression vector and the eukaryotic expression system, and a GDF11 protein, and relates to the technical field of molecular biology. The preparation method of the eukaryotic expression vector provided by the invention comprises the step of inserting the GDF11 gene fragment into the recombinant plasmid, the operation is simple, and the prepared eukaryotic expression vector has the effect of highly expressing the GDF11 gene. According to the eukaryotic expression system provided by the invention, the host cell is CHO, and the recombinant protein GDF11 can be stably and efficiently expressed. The preparation method of the eukaryotic expression system comprises the steps of transfecting the eukaryotic expression vector into CHO cells, culturing and screening, screening transfectants through a DHFR dihydrofolate reductase system, amplifying the GDF11 gene through feedback regulation under the condition of ensuring the cell survival rate, and improving the expression quantity of protein.

Description

Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein
Technical Field
The invention relates to the technical field of molecular biology, in particular to a eukaryotic expression vector, a eukaryotic expression system, preparation methods and applications of the eukaryotic expression vector and the eukaryotic expression system, and a GDF11 protein.
Background
Growth differentiation factor 11 (GDF 11), also known as bone morphogenetic protein 11(BMP11), belongs to the transforming growth factor-beta (TGF- β) superfamily and was first reported in 1999 as a new biological differentiation factor.
GDF11 has been identified as a newly discovered growth differentiation factor, and its specific biological function is not yet perfect, and needs further research by researchers, but it can be determined that it plays an important role in the development of the embryo of an organism. For example, GDF11 has been identified to play an important role in the development of the anterior/posterior spinal axis, bone, skeletal muscle, nervous system, digestive glands, and urogenital system. In addition, studies show that GDF11 can significantly improve skeletal muscle and myocardial aging and has significant anti-aging effect, although the anti-aging effect of GDF11 is still controversial, further studies are needed.
On the other hand, TGF- β family members and their receptors play a major regulatory role in cancer. According to the analysis of a human protein Atlas database, GDF11 is highly expressed in breast cancer, colon cancer, liver cancer and pancreatic cancer, and a colorectal cancer patient with high GDF11 expression shows high frequency of lymph node metastasis and low survival rate, so that the deeper research and the clarification of the mechanism and the function of GDF11 in the cancer are valuable.
At present, GDF11 is mainly used in the basic research fields of biology, medicine and the like, and although there is commercial human-derived GDF11, the cost for basic research is too high due to its high price. Therefore, it is important to develop an expression vector that can express GDF11 efficiently and at a controlled cost.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide a eukaryotic expression vector, so as to alleviate the technical problems that human-derived GDF11 is expensive in price and too high in cost for basic research in the prior art.
The second purpose of the invention is to provide the preparation method of the eukaryotic expression vector, the method is simple and convenient to operate, the production efficiency can be effectively improved, and the prepared eukaryotic expression vector has the effect of highly expressing the GDF11 gene.
The third purpose of the invention is to provide a eukaryotic expression system for stably and efficiently expressing the recombinant protein GDF11, which can stably and efficiently express the recombinant protein GDF 11.
The fourth purpose of the invention is to provide the preparation method of the eukaryotic expression system, the method is simple and convenient to operate, the production efficiency can be effectively improved, and the prepared eukaryotic expression system has the effect of highly expressing the GDF11 protein.
The fifth purpose of the invention is to provide the GDF11 protein expressed by the eukaryotic expression system or the eukaryotic expression system prepared by the preparation method, wherein the GDF11 protein has high purity and good activity.
The sixth objective of the present invention is to provide a method for purifying the GDF11 protein, which has the advantages of simple operation, wide universality and high purity of the purified GDF11 protein.
The seventh purpose of the invention is to provide the application of the eukaryotic expression vector or the eukaryotic expression system in basic research of biological medicines.
The invention provides a eukaryotic expression vector, which highly expresses a GDF11 gene, wherein the GDF11 gene has a nucleotide sequence shown as SEQ ID NO. 1.
The invention also provides a preparation method of the eukaryotic expression vector, which comprises the following steps:
providing pcDNA3.1+-KSH-DHFR recombinant plasmid, inserting GDF11 gene fragment into the pcDNA3.1+-multiple cloning sites of KSH-DHFR recombinant plasmid to obtain said eukaryotic expression vector.
Further, the KSH-DHFR fragment obtained by amplification with the DHFR fragment and the KKS fragment as templates and the KKSDR and the DHFR-R as primers and pcDNA3.1+Plasmid connection, transformation, screening positive bacteria, and extracting to obtain pcDNA3.1+-a KSH-DHFR recombinant plasmid;
wherein the KKS has a nucleotide sequence shown as SEQ ID NO. 2;
the KKSDR has a nucleotide sequence shown as SEQ ID NO.3, and the DHFR-R has a nucleotide sequence shown as SEQ ID NO. 4.
Preferably, the DHFR fragment is obtained by amplification by taking cDNA of the human adipose-derived stem cell as a template and DHFR-F, DHFR-R as a primer;
wherein the DHFR-F has a nucleotide sequence shown as SEQ ID NO. 5.
Further, the Sequence of the GDF11 gene NCBI Reference Sequence: NM-005811 is used as a template, GDF11-F and GDF11-R are used as primers, and the GDF11 gene segment is obtained by amplification;
wherein the GDF11-F has a nucleotide sequence shown in SEQ ID NO. 6;
the GDF11-R has a nucleotide sequence shown as SEQ ID NO. 7.
Further, the GDF11 gene fragment was inserted into the pcDNA3.1+Connecting, transforming and screening the multiple cloning sites of the KSH-DHFR recombinant plasmid to obtain the eukaryotic expression vector.
The invention also provides a eukaryotic expression system for stably and efficiently expressing the recombinant protein GDF11, wherein the host cell is a mammalian cell CHO.
The invention also provides a preparation method of the eukaryotic expression system, the eukaryotic expression vector or the eukaryotic expression vector prepared by the preparation method is transfected into CHO cells, and the eukaryotic expression system is obtained by culturing and screening until the cell survival rate reaches more than 95%;
preferably, the screening is performed using CD OptiCHOTM medium.
The invention also provides GDF11 protein expressed by the eukaryotic expression system or the eukaryotic expression system prepared by the preparation method;
preferably, the GDF11 protein is provided with a His tag.
The invention also provides a purification method of the GDF11 protein, which comprises the steps of purifying a CHO cell culture medium transfected with the eukaryotic expression vector by a nickel column to obtain a purified GDF11 protein;
preferably, after passing the CHO cell culture medium transfected with the eukaryotic expression vector through a nickel column, the CHO cell culture medium is eluted with PBS containing 50mM imidazole to baseline equilibrium, and then eluted with PBS containing 300mM imidazole, and a band is evident at 30kd, and the CHO cell culture medium is purified to obtain the GDF11 protein.
In addition, the invention also provides the application of the eukaryotic expression vector or the eukaryotic expression system for stably and efficiently expressing the recombinant protein GDF11 in basic research of biomedicine.
The eukaryotic expression vector provided by the invention can highly express GDF11 gene with a nucleotide sequence shown in SEQ ID NO. 1. The preparation method of the eukaryotic expression vector provided by the invention comprises the step of inserting the GDF11 gene fragment into pcDNA3.1+The method is simple and convenient to operate, can effectively improve the production efficiency, and the prepared eukaryotic expression vector has the effect of highly expressing the GDF11 gene. According to the eukaryotic expression system for stably and efficiently expressing the recombinant protein GDF11, the host cell is mammalian cell CHO, and the recombinant protein GDF11 can be stably and efficiently expressed. The preparation method of the eukaryotic expression system comprises the steps of transfecting the eukaryotic expression vector into CHO cells, culturing and screening until the cell survival rate reaches more than 95%, screening transfectants through a DHFR dihydrofolate reductase system, amplifying the GDF11 gene through feedback regulation under the condition of ensuring the cell survival rate, and improving the expression quantity of proteins.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1A is a diagram showing the PCR result of DHFR fragment PCR-amplified using cDNA of human adipose-derived stem cells as a template, according to example 1 of the present invention;
FIG. 1B is a diagram showing the results of PCR amplification of a KSH-DHFR fragment using a KKS fragment and a DHFR fragment as templates, provided in example 1 of the present invention;
FIG. 1C shows a schematic diagram of a probe containing pcDNA3.1 provided in example 1 of the present invention+-results of PCR identification of DH 5. alpha. competent bacterial colonies of KSH-DHFR plasmid;
FIG. 1D shows a schematic representation of a DNA construct containing pcDNA3.1 according to example 1 of the present invention+-result diagram of double restriction enzyme identification of KSH-DHFR plasmid;
FIG. 2A is a block diagram of the GDF11 gene Sequence NCBI Reference Sequence provided in example 2 of the present invention: NM-005811 is a PCR result graph of GDF11 fragment amplified by template PCR;
FIG. 2B is a schematic diagram of a probe containing pcDNA3.1 provided in example 2 of the present invention+-results of PCR identification of DH 5. alpha. competent bacterial colonies of KSH-DHFR-GDF11 plasmid;
FIG. 2C shows a schematic representation of a DNA construct containing pcDNA3.1 according to example 2 of the present invention+-results of double restriction enzyme identification of KSH-DHFR-GDF11 plasmid;
FIG. 3A is a graph showing the results of identification of a CHO cell transfectant provided in example 3 of the present invention;
FIG. 3B is a diagram showing the results of the expression and purification of GDF11 protein provided in example 3 of the present invention;
FIG. 4 is a graph showing the results of the inhibition of alkaline phosphatase activity in MC3T3-E1 by GDF11 protein provided in example 4 of the present invention.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The experimental procedures in the following examples are conventional unless otherwise specified.
Unless otherwise indicated, the cells, drugs and reagents used in the examples of the present invention are all available from normal and readily available sources:
the information on the primers used in the examples is shown in Table 1.
TABLE 1 sequences
Figure BDA0001680142860000061
Example 1pcDNA3.1+Construction of-KSH-DHFR recombinant plasmid
This example provides a method for constructing pcDNA3.1+-KSH-DHA method of FR recombinant plasmid comprising the steps of:
(a) the DHFR fragment was PCR-amplified using DHFR-F, DHFR-R as a primer (the sequence is shown in Table 1) and cDNA from human adipose-derived stem cells as a template (the result is shown in FIG. 1A, where M is DL1000maker), and the DHFR fragment (583bp) was recovered from the gel.
(b) And performing PCR amplification on the KSH-DHFR fragment by using KKSDR and DHFR-R (sequences are shown in Table 1) as primers and using the KKS fragment and the DHFR fragment as templates (the result is shown in figure 1B, wherein M is DL1000maker), and recovering the KSH-DHFR fragment (685bp) by glue.
(c) The KSH-DHFR fragment was cleaved with restriction enzymes (HindIII, BamH I) and extracted pcDNA3.1+Plasmid, OMEGAGEL Extraction Kit gel recovery, T4 ligase 16 deg.C, overnight ligation, construction of pcDNA3.1+-KSH-DHFR plasmid. Transformation was carried out and the plasmid was transferred into E.coli DH 5. alpha. competent bacteria preserved in this laboratory by heat shock in a water bath at 42 ℃ for 90 seconds.
(d) After connection and transformation, selecting single clone for culture and carrying out colony PCR identification and double enzyme digestion identification. The colony PCR identification shows that 1 and 2 bacteria have obvious bands of KSH-DHFR fragments at about 700bp (the result is shown in FIG. 1C, wherein M is DL1000 marker). Then reserving No.2 bacteria and extracting plasmid to carry out double digestion identification, wherein a band which is larger than 5000bp appears in the agarose nucleic acid electrophoresis result and is pcDNA3.1+In the plasmid, a 700bp band is a KSH-DHFR fragment (the result is shown in FIG. 1D, wherein M is DL5000 marker). As a result, pcDNA3.1 was successfully constructed in this example+-KSH-DHFR plasmid, and finally confirmed again by sequencing.
Example 2pcDNA3.1+Construction of-KSH-DHFR-GDF 11 recombinant plasmid
This example provides a method for constructing eukaryotic expression vector pcDNA3.1+-KSH-DHFR-GDF11, comprising the steps of:
(A) GDF11-F, GDF11-R is used as a primer (the Sequence is shown in the table 1), and the Sequence NCBI Reference Sequence of the GDF11 gene: NM-005811 was template PCR amplified GDF11 fragment (results are shown in FIG. 2A, where M is DL1000maker), and GDF11 fragment (330bp) was recovered from OMEGAGEL Extraction Kit.
(B) The pcDNA3.1 is digested with restriction enzymes (BamHI, XhoI)+-KSH-DHFR plasmid and GDF11 fragment, recovering gel, connecting with T4 ligase at 16 deg.C overnight, and constructing pcDNA3.1+-KSH-DHFR-GDF11 plasmid, and transformation the plasmid was transferred into DH5 alpha competent bacteria by heat shock in a water bath at 42 ℃ for 90 s.
(C) After connection and transformation, selecting single clone for culture and carrying out colony PCR identification and double enzyme digestion identification. A significant band around 300bp is shown in colony PCR as a GDF11 fragment (the result is shown in FIG. 2B, wherein M is DL1000 marker). Extracting plasmid, double enzyme digestion identification, agarose nucleic acid electrophoresis result shows that a band greater than 5000bp is pcDNA3.1+In the KSH-DHFR plasmid, a 300bp band is a GDF11 fragment (the result is shown in FIG. 2C, wherein M is DL5000 marker). The results show that pcDNA3.1 is successfully constructed+KSH-DHFR-GDF11 plasmid, which is the eukaryotic expression vector provided by the invention. And confirmed again by sequencing.
The eukaryotic expression vector can highly express GDF11 gene, and GDF11 gene sequence is as follows (SEQ ID NO. 1):
TTGGGGTAAACAGATGGCTGGCACTAGAGGCACAGTCGAGGCTGATCAGCGGGTTTAAACTCAATGGTGATGGTGATGATGACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTTCGAAGGGCCCTCTAGACTCGAGTTAAGAGCAGCCACAGCGATCCACCACCATGCCAGGGATCTTGCCGTAGATAATCTGCTGCTTGTCATTGAAGTAGAGCATGTTGATTGGGGACATCTTGGTGGGGGTACAACAGGGCCCAGCAGAGCCTCTTGGATTGGCCTGCTGCACCAAATGGGTATGCGGATATTTTTGCATGAACATGTACTCGCACTGGCCGGAGCAGTAGTTGGCCTTGTAGCGCTTAGGTGCGATGATCCAGTCCCAGCCGAAAGCCTCAAAGTCCACTGTGAGGGGATATCGGCAGCAGCGGGACTCGCTTGAGTGCTCGTCGCAGTCCAGACCCAGGTTACCACCAATCTGTTCTCTGTGAGCCTCAATGATATCGTTATCCTCCATGTCCAAATCTTCAGGGGTCTGATCAGCTTGAATTCTAATACCGTCGTACAAGAATCTTAAGGAGTCCATTTCCTTACCCTGTCTTTTAGCGAACGCTTCCATCAGCCTTCTTAAAGGAGTGGTCTTTTTGATCTTGAAGAAGATCTCTGAAGATCCATCGGACACCTTTAAATTGATGTGAGTCTCAGGCTTGACTTCTGGCTTGACCTCTGGCTTAGCTTCTTGATTGACTTCTGAGTCCGACATGCCGGATCCATCATTCTTCTCATATACTTCAAATTTGTACTTAATGCCTTTCTCCTCCTGGACATCAGAGAGAACACCTGGGTATTCTGGCAGAAGTTTATATTTCTCCAAATCAATTTCTGGAAAAAACGTGTCACTTTCAAAGTCTTGCATGATCCTTGTCACAAATAGTTTAAGATGGGCCTGGGTGATTCATGCTTCCTTATAAACAGAACTGCCACCACTATTCCAGACCATGTCTACTTTATTTGCTAATTCT
example 3 transfection and selection of Stable transfectants and expression purification of GDF11 protein
pcDNA3.1 is prepared by electric conversion method+the-KSH-DHFR-GDF 11 plasmid was stably transfected into CHO cells, and pcDNA3.1 was added to each 400. mu.l of cells in the electroporation cuvette+30 μ g of KSH-DHFR-GDF11 plasmid, electrotransfer instrument program: and (3) performing electric rotation for 2 times at 500V for 500 mu s, and then transferring to ice for incubation for 5-10 min. After the electrotransformation is completed, culturing for 48h, further using a CD OptiCHOTM culture medium to perform transfectant screening through a DHFR dihydrofolate reductase system, calculating the cell survival rate by trypan blue staining in the screening process, extracting cell RNA to perform reverse transcription until the screening is completed and the survival rate of target cells reaches more than 95%, and determining that the coding gene of GDF11 is integrated into the CHO cell genome by gene level identification (the result is shown in figure 3A, wherein M is DL1000 marker). Then directly adopting a nickel column protein purification method, filtering the culture medium supernatant once by using filter paper, and filtering by using a Ni2+ column. The GDF11 protein expressed by CHO cells has His tag, and will be hung on Ni2+ column. Then, the protein was eluted with 50mM imidazole in PBS (pH 8.0) to baseline equilibrium, and then eluted with 300mM imidazole in PBS (pH 8.0), and the 300mM imidazole eluate showed a band around 30kd, and the purified target protein (the result is shown in FIG. 3B, wherein M is protein maker) was determined by BCA method, and the protein concentration was 125. mu.g/ml by BCA method, followed by activity determination.
Example 4GDF11 protein Activity identification
The standard is as follows: GDF11 can inhibit alkaline phosphatase activity of MC3T3-E1 cells in osteogenic differentiation process, and laying P8 generation MC3T3-E1 cells in 24-pore plate to obtain osteogenic differentiation medium group and osteogenic differentiation medium + GDF11 (concentration gradient). The medium was changed every 3 days, and the alkaline phosphatase activity was measured after 7 days of culture. As shown in the figure, GDF11 can significantly inhibit the activity of alkaline phosphatase in MC3T3-E1 cells, and EC50 of the cell is calculated to be 90.84ng/ml (the result is shown in figure 4). The results demonstrate that active GDF11 protein was obtained.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> river-south university
<120> eukaryotic expression vector, eukaryotic expression system, preparation method and application of eukaryotic expression vector and eukaryotic expression system, and GDF11 protein
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 1039
<212> DNA
<213> Homo sapiens
<400> 1
ttggggtaaa cagatggctg gcactagagg cacagtcgag gctgatcagc gggtttaaac 60
tcaatggtga tggtgatgat gaccggtacg cgtagaatcg agaccgagga gagggttagg 120
gataggctta ccttcgaagg gccctctaga ctcgagttaa gagcagccac agcgatccac 180
caccatgcca gggatcttgc cgtagataat ctgctgcttg tcattgaagt agagcatgtt 240
gattggggac atcttggtgg gggtacaaca gggcccagca gagcctcttg gattggcctg 300
ctgcaccaaa tgggtatgcg gatatttttg catgaacatg tactcgcact ggccggagca 360
gtagttggcc ttgtagcgct taggtgcgat gatccagtcc cagccgaaag cctcaaagtc 420
cactgtgagg ggatatcggc agcagcggga ctcgcttgag tgctcgtcgc agtccagacc 480
caggttacca ccaatctgtt ctctgtgagc ctcaatgata tcgttatcct ccatgtccaa 540
atcttcaggg gtctgatcag cttgaattct aataccgtcg tacaagaatc ttaaggagtc 600
catttcctta ccctgtcttt tagcgaacgc ttccatcagc cttcttaaag gagtggtctt 660
tttgatcttg aagaagatct ctgaagatcc atcggacacc tttaaattga tgtgagtctc 720
aggcttgact tctggcttga cctctggctt agcttcttga ttgacttctg agtccgacat 780
gccggatcca tcattcttct catatacttc aaatttgtac ttaatgcctt tctcctcctg 840
gacatcagag agaacacctg ggtattctgg cagaagttta tatttctcca aatcaatttc 900
tggaaaaaac gtgtcacttt caaagtcttg catgatcctt gtcacaaata gtttaagatg 960
ggcctgggtg attcatgctt ccttataaac agaactgcca ccactattcc agaccatgtc 1020
tactttattt gctaattct 1039
<210> 2
<211> 111
<212> DNA
<213> Artificial sequence
<400> 2
gccgccacca tgggcgtcct gctgactcag agaaccctgc tgtcactggt cctggcactg 60
ctgtttcctt caatggcaag tatgcatcat catcatcatc atgttggttc g 111
<210> 3
<211> 31
<212> DNA
<213> Artificial sequence
<400> 3
tataagcttg ccgccaccat gggcgtcctg c 31
<210> 4
<211> 39
<212> DNA
<213> Artificial sequence
<400> 4
ccgacatgcc ggatccatca ttcttctcat atacttcaa 39
<210> 5
<211> 36
<212> DNA
<213> Artificial sequence
<400> 5
catcatcatg ttggttcgct aaactgcatc gtcgct 36
<210> 6
<211> 34
<212> DNA
<213> Artificial sequence
<400> 6
taaggatccg gcatgtcgga ctcagaagtc aatc 34
<210> 7
<211> 36
<212> DNA
<213> Artificial sequence
<400> 7
tcatctagat taagagcagc cacagcgatc caccac 36

Claims (10)

1. A eukaryotic expression vector is characterized in that the eukaryotic expression vector highly expresses a GDF11 gene, and the eukaryotic expression vector has a nucleotide sequence shown as SEQ ID NO. 1.
2. The method of producing a eukaryotic expression vector according to claim 1, comprising:
providing pcDNA3.1+-KSH-DHFR recombinant plasmid, inserting GDF11 gene fragment into the pcDNA3.1+-multiple cloning sites of a KSH-DHFR recombinant plasmid, to obtain said eukaryotic expression vector;
the KSH-DHFR fragment obtained by amplification with the DHFR fragment and the KKS fragment as templates and the KKSDR and the DHFR-R as primers and pcDNA3.1+Plasmid connection, transformation, screening positive bacteria, and extracting to obtain pcDNA3.1+-a KSH-DHFR recombinant plasmid;
wherein the KKS has a nucleotide sequence shown as SEQ ID NO. 2;
the KKSDR has a nucleotide sequence shown as SEQ ID NO.3, and the DHFR-R has a nucleotide sequence shown as SEQ ID NO. 4.
3. The method according to claim 2, wherein the DHFR fragment is obtained by amplification using cDNA of human adipose-derived stem cells as a template and DHFR-F, DHFR-R as a primer;
wherein the DHFR-F has a nucleotide sequence shown as SEQ ID NO. 5.
4. The method according to claim 2, wherein the GDF11 gene Sequence NCBI Reference Sequence: NM-005811 is used as a template, GDF11-F and GDF11-R are used as primers, and the GDF11 gene segment is obtained by amplification;
wherein the GDF11-F has a nucleotide sequence shown in SEQ ID NO. 6;
the GDF11-R has a nucleotide sequence shown in SEQ ID NO. 7.
5. The method of claim 4, wherein the GDF11 gene fragment is inserted into the pcDNA3.1+Connecting, transforming and screening the multiple cloning sites of the KSH-DHFR recombinant plasmid to obtain the eukaryotic expression vector.
6. A eukaryotic expression system for stably and efficiently expressing recombinant protein GDF11 is characterized in that a host cell is a mammalian cell CHO;
the preparation method of the eukaryotic expression system comprises the following steps: transfecting the eukaryotic expression vector of claim 1 or the eukaryotic expression vector prepared by the preparation method of any one of claims 2 to 5 into CHO cells, culturing and screening until the cell viability reaches more than 95%, thereby obtaining the eukaryotic expression system.
7. The eukaryotic expression system of claim 6, wherein the screening is performed using CD OptiCHOTM medium.
8. A GDF11 protein expressed by the eukaryotic expression system of claim 6;
the GDF11 protein is provided with a His tag.
9. The method for purifying GDF11 protein according to claim 8, wherein the purified GDF11 protein is obtained by purifying a CHO cell culture medium transfected with the eukaryotic expression vector using a nickel column.
10. The method for purifying GDF11 protein according to claim 9, wherein the purified GDF11 protein is obtained by passing CHO cell culture medium transfected with the eukaryotic expression vector through a nickel column, eluting with PBS containing 50mM imidazole to baseline equilibrium, eluting with PBS containing 300mM imidazole, and showing a distinct band at 30 kd.
CN201810554975.7A 2018-05-31 2018-05-31 Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein Active CN108753819B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810554975.7A CN108753819B (en) 2018-05-31 2018-05-31 Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810554975.7A CN108753819B (en) 2018-05-31 2018-05-31 Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein

Publications (2)

Publication Number Publication Date
CN108753819A CN108753819A (en) 2018-11-06
CN108753819B true CN108753819B (en) 2022-05-20

Family

ID=64001961

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810554975.7A Active CN108753819B (en) 2018-05-31 2018-05-31 Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein

Country Status (1)

Country Link
CN (1) CN108753819B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109503706A (en) * 2018-11-21 2019-03-22 重庆市畜牧科学院 Soluble CD105 albumen eukaryotic expression and purification process

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101605899A (en) * 2006-10-16 2009-12-16 韩美药品工业株式会社 Be used for the novel vector and the express cell system of mass production recombinant protein and use it to produce the method for recombinant protein
CN107011430A (en) * 2017-04-07 2017-08-04 哈尔滨医科大学 A kind of growth and differentiation factor 11 of the truncation with biological activity and preparation method thereof
CN107828719A (en) * 2017-09-14 2018-03-23 暨南大学 Applications of the GDF11 in fat mesenchymal stem cell Osteoblast Differentiation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101605899A (en) * 2006-10-16 2009-12-16 韩美药品工业株式会社 Be used for the novel vector and the express cell system of mass production recombinant protein and use it to produce the method for recombinant protein
CN107011430A (en) * 2017-04-07 2017-08-04 哈尔滨医科大学 A kind of growth and differentiation factor 11 of the truncation with biological activity and preparation method thereof
CN107828719A (en) * 2017-09-14 2018-03-23 暨南大学 Applications of the GDF11 in fat mesenchymal stem cell Osteoblast Differentiation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NCBI Reference Sequence: NM_005811.4;GenBank;《GenBank》;20180416;全文 *
截短型人骨保护素在CHO-DHFR~-细胞中的表达及活性测定;阚伯红等;《细胞与分子免疫学杂志》;20091118(第11期);摘要 *
重组人骨形态发生蛋白2在CHO细胞中的表达、鉴定及活性分析;张道永等;《生物工程学报》;20061130(第06期);全文 *

Also Published As

Publication number Publication date
CN108753819A (en) 2018-11-06

Similar Documents

Publication Publication Date Title
CN104946656B (en) A kind of people source basic fibroblast growth factor, tobacco chloroplast expression vector and production method
CN110747230B (en) Method for promoting bovine skeletal muscle satellite cell myogenic differentiation
CN108753819B (en) Eukaryotic expression vector, eukaryotic expression system, preparation methods and applications of eukaryotic expression vector and eukaryotic expression system and GDF11 protein
JP2002540782A (en) Human mesenchymal DNAs and expression products
CN114990093A (en) Protein sequence MINI RFX-CAS13D with small amino acid sequence
CN110305905B (en) Mouse Tmem240 recombinant eukaryotic expression plasmid, lentivirus and construction method
CN113336839A (en) Method for expressing human fibroblast growth factor 21 through wheat germ cell-free protein synthesis system
CN106868006B (en) E2F1 protein bindable DNA fragment and application thereof in E2F1 activity detection
CN110946877A (en) Stem cell biological product for treating liver cirrhosis and preparation method and application thereof
CN114106124B (en) Garlic AsNAC1 transcription factor gene capable of increasing alliin content and application thereof
CN117660474B (en) Application of pear transcription factor PbrMYB and PbrACO2 gene promoter interaction in regulation of fruit citric acid isomerization
CN110777166B (en) Construction and application of bovine KLF3 gene eukaryotic overexpression vector
CN113637675B (en) Production method, nucleotide sequence, expression vector and expression system of human serum albumin
CN113480666B (en) CA153 fusion protein and preparation method thereof, and CA153 detection quality control product or calibrator
CN114195876B (en) Truncated protein of fibronectin 1 and application thereof
CN110863009B (en) Construction and application of bovine KCNJ12 gene eukaryotic overexpression vector
CN117586379B (en) Preparation method and application of recombinant fibronectin
CN109384838B (en) Triple transcription factor and application thereof in mammalian protein expression system
CN118006686A (en) Exogenous expression plasmid of full-length mouse RYR1 gene, construction method and application thereof
CN113025637A (en) Bacterial origin anti-tumor PNPase gene and preparation method and application thereof
CN118638868A (en) Adenosine transporter ENT1 over-expression plasmid, construction method and application
CN117143905A (en) Application of pear transcription factor PbrZIP 15 and PbrXylA1 gene promoter interaction in regulation of accumulation of soluble sugar in fruits
CN116926034A (en) Recombinant creatine kinase isozyme, and preparation method and application thereof
CN118667859A (en) Prokaryotic expression vector of human MTHFD L protein, construction method and application
CN117660474A (en) Application of pear transcription factor PbrMYB65 and PbrACO2 gene promoter interaction in regulation of fruit citric acid isomerization

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant