CN102888395A - Method and reagent for adjusting methylation/demethylation state of nucleic acid - Google Patents

Abstract

The invention relates to a method and a reagent for adjusting the methylation/demethylation state of nucleic acid. An inventor proves that 5-methylcystein (mC) and 5-hydroxymethylcytosine (hmC) in genome deoxyribonucleic acid (DNA) can be oxidized into 5-carboxyl cytosine (caC) by Tet dioxygenase for the first time. Thymine DNA glycosylase (TDG) can specifically identify the 5caC and remove the 5caC from the genome to ensure that DNA is demethylated actively. Therefore, the methylation/demethylation effect of DNA in the genome can be adjusted, and the reagent for adjusting methylation/demethylation effect of DNA in the genome can be prepared. Through verification, the genome DNA in a cell has 5caC modification, a 5caC modification spectrum can be used for monitoring the state of the cell, and adenosine triphosphate (ATP) and analogues thereof can be used as regulators of Tet enzyme. Moreover, by Tet mutation in leukemia, the 5caC activity is reduced or the 5caC is inactivated.

Description

Regulate method and the reagent of the methylating of nucleic acid/demethylation state

Technical field

The invention belongs to biotechnology and pharmaceutical field; More specifically, the present invention relates to regulate method and the reagent of the methylating of nucleic acid/demethylation state.

Background technology

In commitment, now mechanism understanding is clear that methylating of the 5th of cytosine(Cyt) most.Cytosine methylation has participated directly in transcriptional control and genomic other regulation processes.Because methylating of cytosine(Cyt) can cause the silence of chromosomal compression and gene, so for active gene of expressing, the DNA of their promotor and promotion subregion often is in the hypomethylation horizontality.Therefore, the demethylation of DNA has also played vital role for the transcriptional activation of silencer.

Now, the demethylation of the demethylation in specific gene site and Genome Scale all has been reported.For example, the promoter region of the target gene pS2 of estrogen receptor is to have the active demethylation in the silence of gene with expressing in the working cycle.For the demethylation of Genome Scale, this phenomenon occurs in archeocyte, is considered to play an important role for wiping father and mother's methylation patterns and set up the special methylome formula of gamete in sexual cell; At after fertilization, genomic the reinventing of sperm also is accompanied by the genomic extensive demethylation in father source, and this phenomenon is important for the growth of body early embryo probably.Now, for demethylation mechanism initiatively multiple explanation is arranged, comprise that opening the C-C key directly excises methyl group from methylcystein, enzymatic reaction removes the form of methyl group with formaldehyde from 5hmC, and shears reparation approach (BER and NER) by DNA methylcystein is directly replaced.But, also be verified by biological chemistry or operating in the Mammals of heredity without any a kind of approach now.Theoretically, these approach can be that 5hmC starts by Tet oxidation 5mC.Based on the importance of 5hmC in stem cell biology and cancer, the methylolated research of in recent years Tet mediation is a focus.There has been multinomial evidence to show that the function of Tet1 can reverse the dna methylation of initial property.But how the demethylation of DNA namely is reversed into cytosine(Cyt) with methylated cytosine(Cyt) is how to realize still unknown.

Therefore, the methylating of researching DNA/demethylation mechanism found key molecule or the method for regulating the methylating of DNA/demethylation, is that those skilled in the art need further to explore, and helps fundamentally to understand modification or the variation of DNA.

Summary of the invention

The object of the present invention is to provide method and the reagent of regulating the methylating of nucleic acid/demethylation state.

In a first aspect of the present invention, a kind of method of DNA demethylation is provided, comprising:

(1) processes DNA with the Tet dioxygenase, change 5-methylcytosine among the DNA (5mC) or 5-hydroxymethyl cytosine (5hmC) into 5-carboxyl cytosine(Cyt) (5caC);

(2) DNA that obtains with thymine DNA glycosylase (TDG) treatment step (1) is with 5-carboxyl cytosine(Cyt) excision among the DNA.

(3) shear reparation approach (BER or NER) by DNA, add non-methylated cytosine(Cyt) in 5-carboxyl cytosine(Cyt) excision site.

In a preference, in the step (2):

When processing DNA with the thymine DNA glycosylase, also add GADD45A (Growth arrest and DNA-damage-inducible 45, alpha).

In a preference, described method is non-(disease) methods for the treatment of, and non-(disease) diagnostic method.

In another preference, described method is in vitro method.

In another preference, described method also comprises:

In another aspect of this invention, provide a kind of method that 5-methylcytosine among the DNA (5mC) or 5-hydroxymethyl cytosine (5hmC) is changed into 5-carboxyl cytosine(Cyt) (5caC), comprising: process DNA with the Tet dioxygenase.(preferably, described method is non-therapeutic and non-diagnostic).

In another preference, when processing DNA with the Tet dioxygenase, also comprise adding Fe ²⁺And/or 2-oxoglutaric acid; Or adding can form (as by hydrolysis) Fe ²⁺And/or the material of 2-oxoglutaric acid.

In another preference, when processing DNA with the thymine DNA glycosylase, also add GADD45A.

In another aspect of this invention, provide a kind of method with 5-carboxyl cytosine(Cyt) excision among the DNA, comprising: process DNA with thymine DNA glycosylase (TDG).Preferably, described method is non-therapeutic and non-diagnostic.

In another aspect of this invention, provide the purposes of Tet dioxygenase or its promotor, be used for changing DNA 5-methylcytosine (5mC) or 5-hydroxymethyl cytosine (5hmC) into 5-carboxyl cytosine(Cyt) (5caC); Or for the preparation of the composition that 5-methylcytosine among the DNA (5mC) or 5-hydroxymethyl cytosine (5hmC) is changed into 5-carboxyl cytosine(Cyt) (5caC).Preferably, described purposes is non-therapeutic and non-diagnostic.

In another preference, described Tet dioxygenase comprises: Tet1, Tet2 or Tet3 or their reservation catalyst structure domain and fragment or derivative (such as Tet1CD, Tet2CD or Tet3CD) with catalytic activity.

In another preference, the expression vector that promotor being of described Tet dioxygenase can recombinant expressed Tet dioxygenase.For example, the pcDNA4 carrier wherein comprises the Tet dioxygenase expression casette of (comprising: the fragment of Tet1, Tet2 or Tet3 or their reservation catalytic activity or derivative (such as Tet1CD, Tet2CD or Tet3CD)).

In another aspect of this invention, provide the purposes of the inhibitor of Tet dioxygenase, be used for inhibition DNA 5-methylcytosine (5mC) or 5-hydroxymethyl cytosine (5hmC) and change 5-carboxyl cytosine(Cyt) (5caC) into; Or for the preparation of the composition that suppresses 5-methylcytosine (5mC) among the DNA or 5-hydroxymethyl cytosine (5hmC) and change into 5-carboxyl cytosine(Cyt) (5caC).(preferably, described purposes is non-therapeutic and non-diagnostic).

In another preference, the inhibitor of described Tet dioxygenase is: the antibody of anti-Tet dioxygenase, the disturbing molecule (such as siRNA, shRNA) that disturbs the Tet dioxygenase to express.

In another aspect of this invention, provide the purposes of thymine DNA glycosylase or its promotor, be used for DNA 5-carboxyl cytosine(Cyt) is excised; Or for the preparation of the composition with 5-carboxyl cytosine(Cyt) excision among the DNA.(preferably, described purposes is non-therapeutic and non-diagnostic).

In another preference, described thymine DNA glycosylase comprises: fragment or the derivative (such as Flag-TDG) of the thymine DNA glycosylase of total length or its reservation enzymic activity.

In another preference, the expression vector that promotor being of described thymine DNA glycosylase can recombinant expressed thymine DNA glycosylase.For example, the pcDNA4 carrier wherein comprises the expression casette of thymine DNA glycosylase.

In another aspect of this invention, provide the purposes of the inhibitor of thymine DNA glycosylase, be used for suppressing the excision of DNA 5-carboxyl cytosine(Cyt); Or for the preparation of the composition that suppresses 5-carboxyl cytosine(Cyt) excision among the DNA.Preferably, described purposes is non-therapeutic and non-diagnostic.

In another preference, the inhibitor of described thymine DNA glycosylase is: the antibody of anti-thymine DNA glycosylase, the disturbing molecule (such as siRNA, shRNA) that disturbs the thymine DNA glycosylase to express.

In another preference, the disturbing molecule that described interference thymine DNA glycosylase is expressed is for the GenBank accession number: siRNA molecule or the shRNA molecule of 573-593 position or 1180-1200 position Nucleotide among the NM172552.

In another aspect of this invention, provide a kind of test kit of DNA demethylation, comprising:

Tet dioxygenase or its promotor; With

Thymine DNA glycosylase or its promotor.

In another preference, described DNA demethylation test kit also comprises: GADD45A or its promotor.

In another preference, the expression vector that promotor being of described GADD45A can recombinant expressed GADD45A.For example, the pcDNA4 carrier wherein comprises the expression casette of GADD45A.

In another aspect of this invention, provide a kind of test kit of the DNA of inhibition demethylation, comprising:

The inhibitor of Tet dioxygenase; With

The inhibitor of thymine DNA glycosylase.

In another aspect of this invention, provide a kind of method of screening the potential material of modulating DNA methylation/demethylation state, comprising:

(1) processes the system of expressing the Tet dioxygenase with candidate substances; With

(2) detect Tet dioxygenase in the described system transcribe, express or active;

Wherein, (preferably significantly improve, as improve more than 20%, better raising 50% if described candidate substances can improve; Better raising is more than 80%) the Tet dioxygenase transcribe, express or active, show that then this candidate substances is the potential material that promotes the DNA demethylation; Described candidate substances (preferably significantly reduces, as reduces more than 20% better reduction by 50% if can reduce; Better reduction is more than 80%) the Tet dioxygenase transcribe, express or active, show that then this candidate substances is the potential material that causes dna methylation.

In another aspect of this invention, provide a kind of method of screening the potential material of modulating DNA methylation/demethylation state, comprising:

(1) processes the system of expressing the thymine DNA glycosylase with candidate substances; With

(2) detect thymine DNA glycosylase in the described system transcribe, express or active;

Wherein, (preferably significantly improve, as improve more than 20%, better raising 50% if described candidate substances can improve; Better raising is more than 80%) the thymine DNA glycosylase transcribe, express or active, show that then this candidate substances is the potential material that promotes the DNA demethylation; Described candidate substances (preferably significantly reduces, as reduces more than 20% better reduction by 50% if can reduce; Better reduction is more than 80%) the thymine DNA glycosylase transcribe, express or active, show that then this candidate substances is to suppress the potential material of DNA demethylation.

In another preference, step (1) comprising: in test group, candidate substances is joined the system of expressing Tet dioxygenase or thymine DNA glycosylase; And/or

Step (2) comprising: detect the transcribing of Tet dioxygenase in the system of test group or thymine DNA glycosylase, express, activity, and with control group relatively, wherein said control group is the system of not adding expression Tet dioxygenase or the thymine DNA glycosylase of described candidate substances;

If the transcribing of Tet dioxygenase or thymine DNA glycosylase in the test group, express, activity is higher than statistically and (preferably significantly improves, as improve more than 20%, better raising 50%; Better raising is more than 80%) control group, show that then this candidate substances is the potential material that promotes the DNA demethylation; If the transcribing of Tet dioxygenase or thymine DNA glycosylase in the test group, express, activity is lower than statistically that (preferred significantly the reduction transcribed, expresses or active, as reduces more than 20% better reduction by 50%; Better reduction is more than 80%) control group, show that then this candidate substances is to suppress the potential material of DNA demethylation.

In another preference, described candidate substances includes, but is not limited to: for disturbing molecule, nucleic acid inhibitor, binding molecule (such as antibody or part), the micromolecular compound of Tet dioxygenase or thymine DNA glycosylase or the design of their encoding gene; Or the recombinant plasmid of expression Tet dioxygenase or thymine DNA glycosylase etc.

In another preference, described system is selected from: cell system (as expressing the cell of Tet dioxygenase or thymine DNA glycosylase) (or cell cultures objects system), ubcellular system, solution system, organizational framework, organ systems or animal system.

In another preference, described method also comprises: the potential material to acquisition carries out further cell experiment and/or animal experiment, further to select from candidate substances and to determine for promoting or the useful material of inhibition DNA demethylation.

In another aspect of this invention, provide a kind of method of the TET of screening dioxygenase active regulator, comprising:

(1) processes DNA with the Tet dioxygenase, do not add or add candidate substances;

(2) detect the 5caC level;

Wherein, if described candidate substances can reduce the 5caC level statistically, show that then this candidate substances is the inhibitor of TET dioxygenase; If described candidate substances can increase the 5caC level statistically, show that then this candidate substances is the promotor of TET dioxygenase.

In another preference, when processing DNA with the Tet dioxygenase, also comprise adding ATP, Fe2+ and/or 2-oxoglutaric acid; Or adding can form ATP, Fe ²⁺And/or the material of 2-oxoglutaric acid.

In another aspect of this invention, provide a kind of method of the TDG of screening active regulator, comprising:

(1) processes DNA with TDG, do not add or add candidate substances;

(2) detect the 5caC level;

Wherein, if described candidate substances can increase the 5caC level statistically, show that then this candidate substances is the inhibitor of TDG; If described candidate substances can reduce the 5caC level statistically, show that then this candidate substances is the promotor of TDG.

In another preference, when processing DNA with TDG, also comprise adding Tet dioxygenase or Gadd45a, or both add simultaneously.

In another preference, described processing DNA refers to cross DNA in the expression aftertreatment cell in cell, or at the external DNA that directly processes.

Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.

Description of drawings

The Tet2 albumen catalysis 5mC of Fig. 1, purifying and 5hmC generate new modified forms.

A, TLC experiment shows the Flag-Tet2 albumen catalysis 5mC of total length and the point " X " that the 5hmC substrate generates a unknown.The 6-8 road is the Nucleotide reference.One section polynucleotide double-stranded DNA of chemosynthesis, second cytosine(Cyt) C of its CCGG sequence are respectively not modify, methylate and modify or the methylolation modification.This double-stranded DNA is via restriction enzyme digestion, and end mark and nuclease hydrolysis produce free mononucleotide.Attention: generation simultaneous 5mC (3 road) and the weakening of 5hmC (5 road) signal of " X " point.The point on top, 3-8 road is the dAMP of 5 ' end mark, is cut by the EcoNI enzyme that the DNA substrate is incomplete to be produced.The total order of Substrate DNA is classified as: 5 '-AACAACCATAACTACCTAC ^mCGGAGGGTTGATTGTTGATGAAGTG-3 ' (SEQ ID NO:2) and 3 '-TTGTTGGTATTGGT GGATGG ^m CCTCCCAACTAACAACTACTTCAC (SEQ ID NO:3)-Biotin-5 '.

B, pass through ¹⁴The source of methyl group checking " X " point of C mark 5-methylcytosine (5mC).Utilize the CpG methyltransgerase M.SssI of bacterium, by ¹⁴The S-adenosylmethionine of C mark (SAM) provides ¹⁴The C-methyl group, thus external methylate DNA substrate produces ¹⁴The DNA substrate of C mark.Attention: detect at second ¹⁴The point of C mark and the 4th road detect ³²" X " point of P mark has similar Rf value.

C, HPLC detect a kind of new nucleosides that is produced by Flag-Tet2 catalysis 5mC and 5hmC substrate.When Tet albumen and 5mC or 5hmC substrate reactions, a new peak appears at the HPLC spectrogram, be labeled as " X ' ".This peak represented a kind of not yet certified+the nucleosides type.Cytosine(Cyt) in substrate is unmodified, when perhaps Tet albumen is the mutant of loss of catalytic activity, all do not detect " X ' " peak.

Fig. 2,5-methylcytosine (5mC) are 5-carboxyl cytosine(Cyt) (5-carboxylcytosine, 5caC) by Tet oxidation after product.

Use respectively HPLC (A) by the 5mC derivative that Flag-Tet2 catalysis produces, TLC (B) and mass spectrum (C) are analyzed, and use the 5caC standard substance as reference.

A, HPLC are to the analysis of the derivative nucleosides of 5mC in the DNA of Flag-Tet2 catalysis substrate.

B, TLC method are identified the modified outcome that Tet2 catalysis produces.The 5mC substrate is same as the used substrate of Figure 1A.5caC DNA is one section synthetic double-stranded polynucleotide, and sequence is same as Figure 1A.3 ' cytosine(Cyt) C of its EcoNI restriction enzyme site is carboxylated, as the standard reference of 5ca-dCMP.

The Mass Spectrometric Identification at C, " X ' " peak.For main mass spectra peak, show the putative structure molecular formula.

Fig. 3, Tet2 albumen form 5caC on the catalysis genomic dna in vivo.

A, the detection of expression of Flag-Tet2 albumen in the HEK293T cell.Use Flag antibody, to the Tet2 full-length proteins, catalyst structure domain segment and catalysis region mutant protein carry out respectively the detection of immunofluorescence.

5caC in the HEK293T cell genomic dna of B, HPLC detection Tet2 albumen transfection.The standard substance of various nucleosides are the 5caC of chemosynthesis, and C, 5hmC and three kinds of nucleosides of 5mC of comprising the DNA hydrolysis generation of C, 5hmC and 5mC.Arrow has marked the 5caC peak that occurs in the genomic dna behind the transfection Tet2 albumen.

C, HPLC-MS/MS method detect the 5caC in the transfected cellular genome.Used negative ion many reactions mass spectrum monitoring (MRM) mode detection three seed ions (as showing among Fig. 2 C) of 5caC parent ion and cracked rear generation thereof.Blue signal is the 5caC standard substance, and black signal is from " 5caC " peak of the HEK293T genomic dna of transfection Tet2 albumen among the B figure, and danger signal is from the cell genomic dna of the Tet2 mutant of transfection loss of catalytic activity.

5caC among Fig. 4, Glycosylase TDG identification and the shearing DNA.

It is active that A, ES nucleus extract contain the special base excision of 5caC.The activity that produces the responsive site of alkali in the nuclear extract of mouse embryo stem cell detects by the double-stranded polynucleotide that contains 5caC.The result shows is activity for different DNA substrates (substrate structure is seen Figure 14 A).Three different substrates contain respectively G/U mispairing (U), G/5hmC (5hmC) or G/5caC (5caC) in the middle of sequence.The cumulative volume of each reaction is 20 microlitres, contains the Substrate DNA of 1pmol and the nuclear extract of 40 micrograms.And the shear active that carries out 5caC in the immune ES nuclear extract of eliminating with TDG antibody (anti-TDG) reduces greatly.

B, Flag-TDG can excise 5caC from double-stranded DNA, but Flag-MBD4, Flag-UNG and GST-SMUG1 are not all right.N151A is the mutant of the loss of catalytic activity of TDG.Figure 14 B is seen in the expression of associated protein.It is active that the TDG albumen that the 6XHis of purifying merges from bacterium also has the 5caC excision.If the DNA substrate only contains 5caC at a chain, then TDG lives higher to the excisionase of 5caC.

C, coexpression TDG significantly reduces Tet2 and produces 5caC in the 293T cell.The same B of mutant TDG.

The nuclear extract disappearance 5caC base excision of the ES cell of D, Tdg knockdown is active.Prepare respectively stably express shRNA1, the nuclear extract of the clone (a and b) that two strains of shRNA2 or contrast shRNA are different, and carry out glycosidase activity test experiments (being similar to A).

Fig. 5, the 5caC functional interpretation model in the DNA demethylation.

A, use HPLC-MS/MS detect the 5caC in the TDG rejecting ES cell.Method is with Fig. 3 C.The ES genomic dna that the pink colour signal is rejected from TDG, and danger signal be TDG not by the contrast ES cell strain of knockdown, positive control (5caC standard substance) is blue signal.TDG albumen is analyzed confirmation (Figure 15) by Western in the rejecting that ES stablizes in the strain cell.Wherein abasic represents to lose the pentose of base.

The theoretical model of the DNA demethylation that B, Tet and TDG are protein mediated.Tet albumen is oxidized to 5hmC with 5mC, or is further oxidized to 5caC, and 5caC is again by TDG identification and excision; Thereby caused base excision reparation, the C that causes not methylating mixes, and realizes demethylation.

Detect the activity of modifying 5mC in the HEK293T nucleus extract of Fig. 6, transfection Tet2.

Modify the step of 5mC activity in A, the detection nuclear extract.

B, usefulness TLC method detect the activity of modifying 5mC in the HEK293T nucleus extract.On the TLC plate one ³²The unknown site of P mark is labeled as " X ".The 6-8 row are ³²The end-labelled Nucleotide standard substance of P, 2 '-Deoxyribose cytidine-5 '-phosphoric acid (dCMP), 5-methyl-2-Deoxyribose cytidine-5 '-phosphoric acid (5m-dCMP), 5-methylol-2 '-Deoxyribose cytidine-5 '-phosphoric acid (5hm-dCMP) all is to prepare by the double-stranded DNA that enzyme is cut hydrolysis, and these DNA have the nucleosides (seeing figure A) of a modification at 3 ' of EcoNI restriction enzyme site.Compound with high polarity has less Rf value, because strong compound and the polar adsorbent on the TLC plate of polarity interacts strong.

Fig. 7, coomassie brilliant blue staining detect the Tet full-length proteins with the Flag-label of purifying from the HEK293T cell.

Fig. 8, dna double oxygenase Tet1 and Tet3 equally can oxidation 5mC or 5hmC generation 5caC.

Go up most the peak (with downward arrow indication) that two HPLC collection of illustrative plates have shown 4 kinds of standard nucleosides.

Also can catalysis 5mC oxidation and generates 5caC in the C end structure territory (CD) of Fig. 9, three kinds of Tet albumen.

A, coomassie brilliant blue staining detect the Tet1 with the Flag label, Tet2 and the Tet3CD albumen of purifying from the 293T cell.

B, contain 5mC the DNA sample respectively with three kinds of Tet albumen tests after product be hydrolyzed into and carry out HPLC behind the monokaryon glycosides and analyze, be illustrated as the HPLC collection of illustrative plates of nucleosides.What the HPLC collection of illustrative plates of bottom showed is the standard nucleosides that derives among the synthetic DNA.

Figure 10, the Tet1 catalyst structure domain albumen of purifying can generate 5caC with 5mC and 5hmC oxidation from the Insect cells Sf9 cell.

A, coomassie brilliant blue staining detect Tet1CD albumen in the insect cell;

B, HPLC collection of illustrative plates show that Tet1CD generates 5caC with 5mC or 5hmC oxidation.

For the ease of purifying, this Tet1CD albumen at N end with the Flag label, the C end with 6 * histidine-tagged.

Figure 11, Tet2 generate the 5mC oxidation 5caC in vitro reactions effect depends on cofactor.

Histogram has shown the production rate of 5caC in the vitro reactions when cofactor exists or do not exist." all " represents ATP, α-ketoglutaric acid (2-OG), Fe (NH ₄) ₂(SO ₄) ₂(Fe ²⁺) and all cofactors of dithiothreitol (DTT) (DTT) all join in the reaction buffer, final concentration is respectively 1mM, 1mM, 100 μ M, 1mM.Substrate in the external oxidizing reaction is the long dna fragmentation of 101bp that includes 42 methylcysteins.Methylcystein is to mix 5 methyl cytidines by PCR.The Tet2 full-length proteins (FL) of 300ng substrate (4.5pmol contains the 5mC of 189pmol) and 4 μ g purifying is incubation reaction 1 hour (18pmol).Enzymic activity is to measure the 5caC product by HPLC to calculate (the square method of experimental procedure).In view of the needs of Tet2 enzymic activity to ATP, Tet2 enzymic activity and thymus pyrimidine-the 7-hydrolase seemingly.Methyl on thymus pyrimidine-7-lytic enzyme energy catalysis thymus pyrimidine carries out continuous oxidation reaction, produces the 5-carboxyuracil.

Figure 12, the 5caC reaction in endonuclease digestion analysis and the analysis of bisulfite sequencing.

A, HapII and MspI can not cut the DNA that contains 5caC by enzyme.One section synthetic C in the middle of the CCGG sequence is 5caC, and the 20-merDNA of C or 5hmC double-stranded (sequence information is seen B) is used to the endonuclease digestion analysis.DNA substrate warp ³²P end mark, enzyme are cut by carrying out radioautograph behind the polyacrylamide gel electrophoresis again.Report was consistent in the past, and MspI is insensitive to hmC;

B, in the bisulfite sequencing analysis, 5caC shows the reaction of C.5caC among the DNA can not cause the pcr amplification Preference.The reaction of 5hmC and 5mC is consistent." X " in original series is C, 5caC or 5hmC.

Figure 13, Tet2 full-length proteins oxidation 5mC generate 5caC and have the persistence catalytic activity.

What show among the figure is the bisulfite sequencing result of methylate DNA before and after the reaction of Tet2 full-length proteins.The substrate of analyzing in the experiment is the long zone of one section 101bp, contain 21 CpG double-core glycosides in this zone and do not have other forms of C (5 '- TAAT

TAATACGATA

ATAATA

TA

A A T

TT

AAT

T

TA AAT

TA

AT

TA

A A TTAAA

ATA

AT

TATATAA-3 ' CpG dinucleotide indicates with runic).The DNA substrate at first methylates at external methyltransgerase M.SssI by bacterium.The DNA substrate (1.5pmol) of 100ng and the reaction of the Tet2 full-length proteins (9pmol) of 2ug purifying 1 hour.That open circle shows is unmethylated C or 5caC, and that solid rim represents is 5mC or 5hmC.What every line represented is a template strand of analyzing.Because the DNA after external the methylating only has 2.6% C not methylate, so most of open circles represent in figure below is 5caC.The 5caC per-cent (64.2%) that detects among the per-cent (61.8%) that 5caC generates and the HPLC approaches.

Used DNA substrate and zymoprotein in Figure 14, the glycosidase activity test.

A, DNA substrate are by preparation after the annealing of two oligomerization nucleotide chains, wherein one with ³²The P end mark;

B, coomassie brilliant blue staining detect the Glycosylase of purifying.Glycosylase with the Flag label all is by FLAG M2 microballon purifying purification from the 293T cell.SMUG1 with the GST label is purification from intestinal bacteria (E.coli) cell.N151A is the mutant of TDG enzymic activity inactivation.

Figure 15, the expression by TDG in the reticent mouse embryo stem cell of siRNA (ES).

Surely turn the strain cell by having set up with the method for the reticent plasmid transduction of slow virus siRNA.What show among the figure is that Diagnosis of Sghistosomiasis notation (western analysis) detects the protein expression of expressing in the shRNA cell strain, and every kind of shRNA has detected the different cell of two strains.Used antibody shows on the left side in the drawings in the experiment, and α-GAPDH becomes bio tech ltd available from upper Haikang.

Figure 16, in the inducibility stem cell (iPS cell) that TDG knocks out, detect 5caC.

A, TDG knock out the evaluation of iPS cell strain.Diagram real-time quantitative PCR data presentation, Oct4 and Tet1 are activated in the reprogrammed process.All iPS cells can both form the clone with typical ES form.For every kind of Tdg genotype identification, all verified the cell strain that two strains are independently set up.Endo represents endogenous.

(/-) lacks the activity of excising 5caC in the iPS cell that B, TDG knock out.The detection method of nuclear extract enzymic activity is with Fig. 4 A.+ /+expression wild-type, f/f represents that allelic two copies all are anchored, f/-represents that the Tdg gene is heterozygosis,-/-expression Tdg homozygous mutant gene.

C, in the iPS cell that Tdg knocks out, detect 5caC by triple level Four bar mass spectrometry methods.Experimental analysis the genomic dna of extracting from the cell (pink line represents) of TDG wild-type cell (red line represents) and TDG disappearance.Synthetic 5caC nucleosides was used as with reference to (blue line represents), and 5caC can only detect in the cell strain that Tdg knocks out.Every kind of genotype (Tdg-/-, f/-and f/f) has all detected the cell strain that two strains are independently set up at least.

Figure 17, ATP play regulating effect to the 5mC oxidising process of Tet mediation.

The ATP of different concns is oxidized to 5hmC to 5mC or the impact of 5caC and fractional yield thereof is very large actually in the reaction solution.When being 0.5mM such as ATP concentration, 5caC occupies the majority in the oxidation products.When ATP concentration is low (less than 0.2mM), the 5hmC that reaction produces than 5caC for many.

TET2 in Figure 18, leukemia patient sudden change makes 5mC and 5hmC to transformation Efficiency Decreasing or the forfeiture of 5caC.

A. coomassie brilliant blue staining detects mouse Tet2 wild-type and the mutant protein of purifying from the 293T cell of transient transfection.E1231G wherein, P1280S, H1795R and R1810S correspond respectively to sudden change E1318G, P1367S, H1881R and the R1896S of TET2 among the leukaemic.

B.HPLC detection mouse Tet2 wild-type and mutant protein are transformed into the 5hmC substrate ability of 5caC.

Figure 19, GADD45A significant stimulation TDG are to the glycosidase activity of 5fC and 5caC substrate.The GADD45A albumen of 50ngGST-TDG albumen and gradient dosage in incubated at room 5 minutes, is added subsequently ³²The end-labelled 5fC of P or 5caC substrate (5 ' ³²P-GAGCGTGACXGGAGCTGAAA-3 ', X are 5fC or 5caC), place 30 ℃ of water-baths 30 minutes.After the reaction, add respectively NaOH and EDTA to final concentration be 90mM and 10mM, and interrupted the DNA substrate that forms AP site in 5 minutes in 100 ℃ of heating.With 20% polyacrylamide urea-denatured glue DNA isolation substrate and radioautograph.

Figure 20, the GADD45A DNA demethylation pathway activation by Tet-TDG mediation is by the methylate expression of reticent luciferase reporter gene of CpG.

Figure 21, GADD45A can reduce the 5caC that is crossed the Tet albumen generation of expression in the 293T cell by external source.

A. the content of several different modifying cytosine(Cyt)s in the 293T cellular genome of efficient liquid phase chromatographic analysis coexpression Tet2 albumen+GADD45A albumen or Tet2 albumen+TDG albumen, the position appears in arrow indication 5caC peak.

B. the more independent mistake of mass spectroscopy express Tet2, with the 293T cellular genome of GADD45A coexpression in the content of different modifying cytosine(Cyt).Among the figure, " num.of ... " represent to modify in per 1,000,000 cytosine(Cyt)s the number of cytosine(Cyt).

Figure 22, Tet1 enzyme, ATP, 2OG and FAS (Fe ²⁺) concentration impact that hmC/caC is generated.

Embodiment

The inventor's research proves first, no matter external or in cultured cells, the 5mC in the genomic dna and 5hmC can be oxidized to 5-carboxyl cytosine(Cyt) (5caC) by the Tet dioxygenase.Thymine DNA glycosylase (TDG) can be identified this 5caC specifically, and it is excised from genome, causes initiatively demethylation of DNA.

Term

As used herein, unless otherwise indicated, described " dna methylation " refers on the cytosine(Cyt) of DNA chain, has the modification that methylates on 5 carbon atoms (C).Dna methylation can cause the change of chromatin Structure, DNA conformation, dna stability and DNA and protein interaction mode, the change of genetic transcription (as so that gene silencing) thus controlling gene express.

As used herein, unless otherwise indicated, described " DNA demethylation " refers to remove the modification that methylates that exists on the cytosine(Cyt) of DNA chain on 5 carbon atoms (C).The DNA demethylation can promote gene transcription etc.

As used herein, described " Tet dioxygenase ", " Tet " are interchangeable applicable with " Tet albumen ", all refer to belong to albumen (comprising Tet1, Tet2, Tet3 etc.) or the protein fragments of Tet family.

DNA demethylation method

The present invention has disclosed a kind of method of DNA demethylation first, comprising: at first, process DNA with the Tet dioxygenase, change 5-methylcytosine among the DNA (5mC) or 5-hydroxymethyl cytosine (5hmC) into 5-carboxyl cytosine(Cyt) (5caC); Secondly, process the DNA that processes through the Tet dioxygenase with thymine DNA glycosylase (TDG), with 5-carboxyl cytosine(Cyt) excision among the DNA, as shown in Fig. 5 B.

The 5mC of Tet mediation and 5hmC change 5caC into and can start the initial BER path of TDG, thereby unmethylated cytosine(Cyt) is inserted into the position of 5-carboxyl cytosine(Cyt) excision among the DNA, thereby demethylation occurs DNA.

The present invention clearly proved for the first time the Tet dioxygenase can oxidation 5mC and 5hmC change 5caC into, the latter further becomes the substrate of TDG, with 5-carboxyl cytosine(Cyt) excision among the DNA, so that demethylation occurs DNA.The demethylation of DNA and gene transcription etc. are relevant, therefore, can realize by method of the present invention the regulation and control etc. of genetic transcription.For example, the TET2 protein mutation mostly occurs in leukemia patient, the enzyme biopsy of corresponding mutant protein surveyed find, these sudden changes have caused TET2 that 5mC or 5hmC are transformed into the remarkable reduction of 5caC ability or have completely lost, thereby cause the DNA demethylation not occur.This may play an important role in leukemic genesis.

Tet dioxygenase and effect thereof

The Tet dioxygenase is to be enzyme well known to those skilled in the art in a kind of prior art, and its function of in the past being known by people is that oxidation 5mC is 5hmC.And the present invention disclosed for the first time it can oxidation 5mC or 5hmC and generate 5-carboxyl cytosine(Cyt) (5caC).

In the present invention, described Tet dioxygenase can be naturally occurring, such as its can be separated or purifying from Mammals.In addition, described Tet dioxygenase also can be artificial preparation, such as coming according to the genetically engineered recombinant technology of routine Restruction Tet dioxygenase.Preferably, can adopt the Tet dioxygenase of restructuring.

The Tet dioxygenase comprises the enzyme that comes from the Tet protein family, and they all comprise the structural domain of a catalyzed oxidation, can oxidation 5mC be 5hmC, and oxidation 5mC or 5hmC and generate 5caC.For example described Tet dioxygenase comprises Tet1, Tet2, Tet3.

The Tet dioxygenase has been known in many Mammalss and has existed with conservative property highly.Therefore, be appreciated that deriving from different mammiferous Tet dioxygenases all is contained among the present invention.Preferably, they are and the sequence shown in GenBank accession number ACY38291 (Tet1), GenBank accession number NP_001035490 (Tet2), the GenBank accession number NP_898961 (Tet3), the sequence homogeny is higher than 60%, more preferably being to be higher than 70%, more preferably is to be higher than 80%, more preferably is to be higher than 85%, more preferably be to be higher than 88%, more preferably being to be higher than 90%, more preferably is to be higher than 95%, more preferably is to be higher than 98%.

Any suitable Tet dioxygenase all can be used for the present invention.Described Tet dioxygenase comprises Tet dioxygenase or its bioactive fragment (or being called active fragments) of total length.

Derivative or its bioactive fragment of the Tet dioxygenase that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form are also included among the present invention, as long as it remains with the function of wild-type Tet dioxygenase.Tet dioxygenase or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence through amino acid substitution does not affect its activity or kept the activity of its part.Suitably replacing amino acid is technology well known in the art, and described technology can be implemented at an easy rate, and guarantees not change the biological activity of gained molecule.These technology are recognized those skilled in the art, in general, basically can not change biological activity at the inessential area change single amino acids of a peptide species.See the Molecular Biology of The Gene such as Watson, the 4th edition, 1987, The Benjamin/Cummings Pub.Co.P224.

The bioactive fragment of any Tet dioxygenase can be applied among the present invention.Here, the implication of the bioactive fragment of Tet dioxygenase refers to as a peptide species, and it still can keep all or part of function of the Tet dioxygenase of total length.Generally, described bioactive fragment keeps the activity of 50% total length Tet dioxygenase at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of total length Tet dioxygenase.

The present invention also can adopt Tet dioxygenase modified or improvement, such as, can adopt the Tet dioxygenase of being modified or improveing for the effectiveness that promotes its transformation period, validity, metabolism and/or albumen.Described can be a kind of conjugate of Tet dioxygenase through the Tet dioxygenase of modifying or improve, or it can comprise substituted or artificial amino acid.Described can be to have less common ground with naturally occurring Tet dioxygenase through the Tet dioxygenase of modifying or improve, but also can bring into play the effect of catalyzed oxidation, and can not bring other detrimentally affect or toxicity.That is to say, any bioactive version that does not affect the Tet dioxygenase all can be used among the present invention.

As optimal way of the present invention, the derivative of described Tet dioxygenase or its bioactive fragment include but not limited to:

(a) albumen of the aminoacid sequence shown in the GenBank accession number NP_001035490 (Tet2);

(b) albumen of the aminoacid sequence shown in the GenBank accession number ACY38291 (Tet1);

(c) albumen of the aminoacid sequence shown in the GenBank accession number NP_898961 (Tet3);

(d) the C end protein that includes catalyst structure domain (Tet1 CD) of Tet1; Preferably its sequence is shown in 1366-2039 position among the GenBank accession number ACY38291;

(e) the C end protein that includes catalyst structure domain (Tet 2CD) of Tet2; Preferably its sequence is shown in 1042-1912 position among the GenBank accession number NP_001035490;

(f) the C end protein that includes catalyst structure domain (Tet3 CD) of Tet3; Preferably its sequence is shown in 697-1668 position among the GenBank accession number NP_898961.2.

(g) aminoacid sequence of the polypeptide that (a)-(h) is arbitrary through one or more (such as 1-20, preferably 1-15; More preferably 1-10; More preferably 1-5; 1-3 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the polypeptide of (a) polypeptide function.

In case separate the sequence that has obtained described albumen, just can obtain in large quantity this albumen with recombination method.This normally is cloned into carrier with its encoding gene, changes cell over to again, then separates obtaining from the host cell after the propagation by ordinary method.In addition, for shorter albumen, also can adopt the method for synthetic (as synthetic by Peptide synthesizer) to synthesize relevant sequence, the method for synthetic can obtain needed albumen easy and rapidly.

The present invention has also comprised the nucleic acid of separation of the bioactive fragment of the described Tet dioxygenase of encoding, and also can be its complementary strand.The dna sequence dna of the bioactive fragment of coding Tet dioxygenase can the complete sequence synthetic, and also the method for available pcr amplification obtains.After the dna sequence dna of the bioactive fragment of the described Tet dioxygenase that obtained to encode, it is connected into suitable expression vector, change again the appropriate host cell over to.By cultivating the host cell after transforming, obtain desired albumen by separation and purification at last.

The present invention has also comprised the carrier of the nucleic acid molecule of the bioactive fragment that comprises the described Tet dioxygenase of encoding.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that protein expression.Described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and namely the activity of same linear DNA sequence other parts can be regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.

In addition, the reconstitution cell that contains the bioactive fragment nucleotide sequence of the described Tet dioxygenase of encoding is also included among the present invention." host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.; For example can be Bacillus coli cells (E.coli), such as intestinal bacteria HMS174 (DE3) or BL21 (DE3).Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

New discovery based on the inventor, the invention provides the purposes of Tet dioxygenase or its bioactive fragment, include but not limited to: be used for changing DNA 5-methylcytosine (5mC) or 5-hydroxymethyl cytosine (5hmC) into 5-carboxyl cytosine(Cyt) (5caC); Or for the preparation of the composition that 5-methylcytosine among the DNA (5mC) or 5-hydroxymethyl cytosine (5hmC) is changed into 5-carboxyl cytosine(Cyt) (5caC); Or for the material that screens modulating DNA methylation/demethylation state, etc.

Thymine DNA glycosylase and effect thereof

The thymine DNA glycosylase be in a kind of prior art for enzyme well known to those skilled in the art, its function of in the past being known by people is to excise the T among the G/T and G/U mispairing and the deamination product of U and 5mC among the DNA.And having disclosed it for the first time, the present invention can excise 5-carboxyl cytosine(Cyt) among the DNA.

In the present invention, described thymine DNA glycosylase can be naturally occurring, such as its can be separated or purifying from Mammals.In addition, described thymine DNA glycosylase also can be artificial preparation, such as coming according to the genetically engineered recombinant technology of routine Restruction thymine DNA glycosylase.Preferably, can adopt the thymine DNA glycosylase of restructuring.

The thymine DNA glycosylase has been known in many Mammalss and has existed with conservative property highly, for example in people and mouse, the sequence homogeny (homology) of thymine DNA glycosylase reaches 86% (identity=86%, similarity=90%).Therefore, be appreciated that deriving from different mammiferous thymine DNA glycosylases all is contained among the present invention.Preferably, they are and the sequence shown in the GenBank accession number NM 766140 (TDG), the sequence homogeny is higher than 60%, more preferably being to be higher than 70%, more preferably is to be higher than 80%, more preferably is to be higher than 85%, more preferably be to be higher than 88%, more preferably being to be higher than 90%, more preferably is to be higher than 95%, more preferably is to be higher than 98%.

Any suitable thymine DNA glycosylase all can be used for the present invention.Described thymine DNA glycosylase comprises thymine DNA glycosylase or its bioactive fragment (or being called active fragments) of total length.

Derivative or its bioactive fragment of the thymine DNA glycosylase that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form are also included among the present invention, as long as it remains with the function of wild-type thymine DNA glycosylase.Thymine DNA glycosylase or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence through amino acid substitution does not affect its activity or kept the activity of its part.Suitably replacing amino acid is technology well known in the art, and described technology can be implemented at an easy rate, and guarantees not change the biological activity of gained molecule.These technology are recognized those skilled in the art, in general, basically can not change biological activity at the inessential area change single amino acids of a peptide species.See the Molecular Biology of The Gene such as Watson, the 4th edition, 1987, The Benjamin/Cummings Pub.Co.P224.

The bioactive fragment of any thymine DNA glycosylase can be applied among the present invention.Here, the implication of the bioactive fragment of thymine DNA glycosylase refers to as a peptide species, and it still can keep all or part of function of the thymine DNA glycosylase of total length.Generally, described bioactive fragment keeps the activity of 50% total length thymine DNA glycosylase at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% activity of total length thymine DNA glycosylase.

The present invention also can adopt thymine DNA glycosylase modified or improvement, such as, can adopt the thymine DNA glycosylase of being modified or improveing for the effectiveness that promotes its transformation period, validity, metabolism and/or albumen.Described can be a kind of conjugate of thymine DNA glycosylase through the thymine DNA glycosylase of modifying or improve, or it can comprise substituted or artificial amino acid.Described can be to have less common ground with naturally occurring thymine DNA glycosylase through the thymine DNA glycosylase of modifying or improve, but also can bring into play the effect of catalyzed oxidation, and can not bring other detrimentally affect or toxicity.That is to say, any bioactive version that does not affect the thymine DNA glycosylase all can be used among the present invention.

As optimal way of the present invention, the derivative of described thymine DNA glycosylase or its bioactive fragment include but not limited to:

(i) albumen of the aminoacid sequence shown in the GenBank accession number NP_766140 (TDG);

(ii) with the aminoacid sequence of the polypeptide of (i) through one or more (such as 1-20, preferably 1-15; More preferably 1-10; More preferably 1-5; 1-3 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the polypeptide of (a) polypeptide function.

In case separate the sequence that has obtained described albumen, just can obtain in large quantity this albumen with recombination method.This normally is cloned into carrier with its encoding gene, changes cell over to again, then separates obtaining from the host cell after the propagation by ordinary method.In addition, for shorter albumen, also can adopt the method for synthetic (as synthetic by Peptide synthesizer) to synthesize relevant sequence, the method for synthetic can obtain needed albumen easy and rapidly.

The present invention has also comprised the nucleic acid of separation of the bioactive fragment of the described thymine DNA glycosylase of encoding, and also can be its complementary strand.The dna sequence dna of the bioactive fragment of coding thymine DNA glycosylase can the complete sequence synthetic, and also the method for available pcr amplification obtains.After the dna sequence dna of the bioactive fragment of the described thymine DNA glycosylase that obtained to encode, it is connected into suitable expression vector, change again the appropriate host cell over to.By cultivating the host cell after transforming, obtain desired albumen by separation and purification at last.

The present invention has also comprised the carrier of the nucleic acid molecule of the bioactive fragment that comprises the described thymine DNA glycosylase of encoding.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that protein expression.Described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and namely the activity of same linear DNA sequence other parts can be regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.

In addition, the reconstitution cell that contains the bioactive fragment nucleotide sequence of the described thymine DNA glycosylase of encoding is also included among the present invention." host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.; For example can be Bacillus coli cells (E.coli), such as intestinal bacteria HMS174 (DE3) or BL21 (DE3).Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

Based on the inventor's new discovery, the invention provides the purposes of thymine DNA glycosylase or its bioactive fragment, include but not limited to: be used for DNA 5-carboxyl cytosine(Cyt) is excised; Or for the preparation of the composition with 5-carboxyl cytosine(Cyt) excision among the DNA; Or for the material that screens modulating DNA methylation/demethylation state, etc.

GADD45A and effect thereof

In the present invention, described GADD45A can be naturally occurring, such as its can be separated or purifying from Mammals.In addition, described GADD45A also can be artificial preparation, such as coming Restruction GADD45A according to the genetically engineered recombinant technology of routine.Preferably, can adopt the GADD45A of restructuring.

GADD45A has been known in many Mammalss and has existed with conservative property highly, derives from different mammiferous GADD45A and all is contained among the present invention.Preferably, they are and the sequence shown in the GenBank accession number NP_001915, the sequence homogeny is higher than 60%, more preferably being to be higher than 70%, more preferably is to be higher than 80%, more preferably is to be higher than 85%, more preferably be to be higher than 88%, more preferably being to be higher than 90%, more preferably is to be higher than 95%, more preferably is to be higher than 98%.

Any suitable GADD45A all can be used for the present invention.Described GADD45A comprises GADD45A or its bioactive fragment (or being called active fragments) of total length.

Derivative or its bioactive fragment of the GADD45A that passes through replacement, disappearance or the interpolation of one or more amino-acid residues and form are also included among the present invention, as long as it remains with the function of wild-type GADD45A.GADD45A or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence through amino acid substitution does not affect its activity or kept the activity of its part.

The bioactive fragment of any GADD45A can be applied among the present invention.Here, the implication of the bioactive fragment of GADD45A refers to as a peptide species, and it still can keep all or part of function of the GADD45A of total length.Generally, described bioactive fragment keeps the activity of 50% total length GADD45A at least.Under preferred condition, described active fragments can keep 60%, 70%, 80%, 90%, 95%, 99% or 100% the activity of total length GADD45A.

The present invention also can adopt GADD45A modified or improvement, such as, can adopt the GADD45A that is modified or improve for the effectiveness that promotes its transformation period, validity, metabolism and/or albumen.Described can be the conjugate of a kind of GADD45A through the GADD45A that modifies or improve, or it can comprise substituted or artificial amino acid.Described have less common ground through the GADD45A that modifies or improve with naturally occurring GADD45A, but also can bring into play the effect of natural GADD45A, and can not bring other detrimentally affect or toxicity.That is to say, any bioactive version that does not affect GADD45A all can be used among the present invention.

As optimal way of the present invention, the derivative of described GADD45A or its bioactive fragment include but not limited to:

(i) albumen of the aminoacid sequence shown in the GenBank accession number NP_001915;

(ii) with the aminoacid sequence of the polypeptide of (i) through one or more (such as 1-20, preferably 1-15; More preferably 1-10; More preferably 1-5; 1-3 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the polypeptide of (a) polypeptide function.

In case separate the sequence that has obtained described albumen, just can obtain in large quantity this albumen with recombination method.This normally is cloned into carrier with its encoding gene, changes cell over to again, then separates obtaining from the host cell after the propagation by ordinary method.In addition, for shorter albumen, also can adopt the method for synthetic (as synthetic by Peptide synthesizer) to synthesize relevant sequence, the method for synthetic can obtain needed albumen easy and rapidly.

The present invention has also comprised the nucleic acid of separation of the bioactive fragment of the described GADD45A that encodes, also can be its complementary strand.The dna sequence dna of bioactive fragment of coding GADD45A can the complete sequence synthetic, and also the method for available pcr amplification obtains.After the dna sequence dna of the bioactive fragment of the described GADD45A that obtained to encode, it is connected into suitable expression vector, change again the appropriate host cell over to.By cultivating the host cell after transforming, obtain desired albumen by separation and purification at last.

The present invention has also comprised the carrier of the nucleic acid molecule of the bioactive fragment that comprises the described GADD45A that encodes.Described carrier also can comprise the expression regulation sequence that links to each other with the series of operations of described nucleic acid molecule, so that protein expression.

In addition, the reconstitution cell that contains the bioactive fragment nucleotide sequence of the described GADD45A that encodes is also included among the present invention." host cell " comprises prokaryotic cell prokaryocyte and eukaryotic cell.Prokaryotic host cell commonly used comprises intestinal bacteria, Bacillus subtilus etc.; For example can be Bacillus coli cells (E.coli), such as intestinal bacteria HMS174 (DE3) or BL21 (DE3).Eukaryotic host cell commonly used comprises yeast cell, insect cell and mammalian cell.

Based on the inventor's new discovery, the invention provides the purposes of GADD45A or its bioactive fragment, include but not limited to: be used for the activity of regulation and control TDG, promote TDG to the excision effect of 5-carboxyl cytosine(Cyt) among the DNA, etc.

Conditioning agent

As used herein, the promotor of described Tet or TDG or GADD45A has comprised stablizer, agonist, upper adjustment etc.The activity of any Tet of raising or TDG or GADD45A albumen, keep Tet or TDG or GADD45A albumen stability, promote Tet or TDG or GADD45A protein expression, prolong Tet or TDG or GADD45A albumen effective acting time, the genetic transcription that promotes Tet or TDG or GADD45A and translation and material all can be used for the present invention, as the active substance that can be used for modulating DNA methylation/demethylation state (preferably for promoting the demethylation of DNA).

As used herein, the inhibitor of described Tet or TDG or GADD45A albumen has comprised antagonist, lower adjustment, retarding agent, blocker etc.The material of transcribing and translating of the activity of any Tet of reduction or TDG or GADD45A albumen, the stability that reduces Tet or TDG or GADD45A albumen, inhibition Tet or TDG or GADD45A protein expression, minimizing Tet or TDG or GADD45A albumen effective acting time or inhibition Tet or TDG or GADD45A albumen all can be used for the present invention, as can be used for modulating DNA methylation/demethylation state active substance of (preferably for suppressing the demethylation of DNA).

Based on new discovery of the present invention and in conjunction with existing general knowledge, those skilled in the art can prepare or design agonist or the inhibitor of Tet or TDG albumen, and these agonists or inhibitor are also included among the present invention.

As optimal way of the present invention, the promotor of described Tet or TDG or GADD45A albumen includes, but is not limited to: express Tet or TDG egg or the white plasmid of GADD45A.

The promotor of described Tet or TDG or GADD45A albumen can be by expression or the active regulation and control that realize the DNA demethylation that affect Tet or TDG or GADD45A albumen or its encoding gene.

The inhibitor of described Tet or TDG or GADD45A albumen can be nucleic acid inhibitor, protein inhibitor, and antibody, part, proteolytic ferment, protein binding molecule, EDTA, it can reduce Tet or TDG protein expression or activity.As optimal way of the present invention, the inhibitor of described Tet or TDG or GADD45A albumen is based on the nucleic acid inhibitor of sequences Design of the encoding gene of Tet or TDG or GADD45A albumen, such as little disturbing molecule.It is well known by persons skilled in the art designing disturbing molecule according to specific target sequence, and the plasmid that is used at present the structure disturbing molecule can obtain by being purchased approach fully.Described disturbance RNA molecule can be transported in the cell by adopting suitable transfection reagent, or also can adopt multiple technologies known in the art to be transported in the cell.According to known albumen, it also is the technology of this area routine that screening can suppress its active antibody (monoclonal antibody or how anti-).

The inhibitor of described Tet or TDG or GADD45A albumen is by affecting Tet or TDG or GADD45A protein expression or the active regulation and control that realize dna methylation.

Test kit

Based on new discovery of the present invention, a kind of test kit (or being called medicine box) of DNA demethylation also is provided, comprising: Tet dioxygenase or its promotor; With thymine DNA glycosylase or its promotor.More preferably, also comprise in the described test kit: GADD45A or its promotor.Described test kit is integrated in reagent in the cover group, is convenient to their commercial applications.

As optimal way of the present invention, also can comprise some other reagent in the described test kit, such as reagent of quantitative or qualitative analysis dna methylation situation etc.More preferably, also can comprise working instructions in the described test kit, so that people use.

Drug screening

After the new function that gets the described Tet of cicada or TDG albumen, can screen based on this feature and regulate transcribing, expressing or active material of Tet or TDG, thereby find the material that can affect by affecting Tet or TDG dna methylation/demethylation state.

Therefore, the invention provides a kind of method of screening the potential material of modulating DNA methylation/demethylation state, comprising: process the system of expressing Tet with candidate substances; With detect Tet in the described system transcribe, express or active; Wherein, if described candidate substances can improve transcribing, expressing of Tet or activity, show that then this candidate substances is the potential material that promotes the DNA demethylation; If described candidate substances can reduce transcribing, expressing of Tet or activity, show that then this candidate substances is the potential material that causes dna methylation.

The present invention also provides a kind of method of screening the potential material of modulating DNA methylation/demethylation state, comprising: process the system of expressing TDG with candidate substances; With detect TDG in the described system transcribe, express or active; Wherein, if described candidate substances can improve transcribing, expressing of TDG or activity, show that then this candidate substances is the potential material that promotes the DNA demethylation; If described candidate substances can reduce transcribing, expressing of TDG or activity, show that then this candidate substances is to suppress the potential material of DNA demethylation.

Under prompting of the present invention, those skilled in the art all can go tentatively to select some candidate substances, as think the material of potentially useful.For example, described candidate substances includes, but is not limited to: for disturbing molecule, nucleic acid inhibitor, binding molecule (such as antibody or part), the micromolecular compound of Tet or TDG or the design of their encoding gene; Or the recombinant plasmid of expression Tet or TDG etc.

When screening, in order to be easier to observe expression or the active change of Tet or TDG, also control group can be set, described control group can be not add the expression Tet of described candidate substances or the system of TDG.

As optimal way of the present invention, described method also comprises: the potential material that obtains is carried out further cell experiment and/or animal experiment, with further selection and definite for the real useful material of modulating DNA methylation/demethylation state.

On the other hand, the present invention also provides the potential material that can be used for modulating DNA methylation/demethylation that adopts described screening method to obtain.The material that these preliminary screening go out can consist of a screening storehouse.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is write according to method or condition such as the J. Pehanorm Brooker etc. of routine usually, molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that better implementation method described in the literary composition and material only present a demonstration.

I. materials and methods

5hmC and 5caC oligonucleotide

The 5hmC oligonucleotide is synthetic in Invitrogen company (Shanghai).The method synthetic (Q.Dai, C.He, Org Lett 13,3446 (Jul 1,2011)) of 5caC oligonucleotide by having delivered.

The DNA substrate

The long dna fragmentation of 101bp that contains 21 methylcysteins: 5 '-TAAT ^mCGTAATA ^mCGATA ^mCGATAATA ^mCG ^mCGTA ^mCGA ^mCGA ^mCGT ^mCGTT ^mCGAAT ^mCGT ^mCGTA ^mCGAAT ^mCGTA ^mCGAT ^mCGTA ^mCGA ^mCGATTAAA ^mCGATA ^mCGAT ^mCGTATATAA-3 ' (dna sequence dna is seen SEQ ID NO:1), wherein ^mC is methylcystein.

Tet2 and mutant thereof

The sequence of the Tet2 of used wild-type in the embodiment of the invention (mouse source) such as GenBank accession number NP_001035490.

(HxD is positioned at conservative Fe in the amino-acid residue sudden change of core catalytic site ²⁺Combining site) Tet2 enzyme: for the Tet2 of wild-type at the 1295th H → Y, the Tet2 mutant after 1297 D → A sudden changes.This mutant loss of catalytic activity.

The sequence of the homologous protein Tet1 of Tet2 is shown in GenBank accession number ACY38291.

The sequence of the homologous protein Tet3 of Tet2 is shown in GenBank accession number NP_898961.

The sequence of the C end protein that includes catalyst structure domain (Tet1 CD) of Tet1 is shown in 1366-2039 position among the GenBank accession number ACY38291.

The sequence of the C end protein that includes catalyst structure domain (Tet2 CD) of Tet2 is shown in 1042-1912 position among the GenBank accession number NP_001035490.

The sequence of the C end protein (Tet3CD) that includes catalyst structure domain of Tet3 is shown in 697-1668 position among the GenBank accession number NP_898961.

From the sequence of the C end protein that contains the Tet1 catalyst structure domain of purifying the Sf9 insect cell as: among the GenBank accession number ACY38291 shown in the 1366-2039 position.

The sequence of GADD45A gene is shown in the GenBank accession number NP_001915.

The TDG protein expression of restructuring, and glycosidase activity detects

The encoding sequence of used TDG albumen is shown in GenBank accession number NP_766140 among the embodiment.

N151A is the mutant of TDG enzymic activity inactivation: in the albumen shown in the GenBank accession number NP_766140 the 151st sport A by N and obtain.

The coding gene sequence of construction of expression vector: TDG is inserted into the pcDNA4-Flag carrier shown in GenBank accession number NP_766140, insertion point is BamHI, XhoI.

Expression vector transforms the 293T cell, expresses the TDG albumen of acquisition restructuring or recombinant expressed enzymic activity mutant N151A, and recombinant protein is with Flag label (N holds with the Flag label).

The preparation of Flag-MBD4: the similar preparation purifying of method Flag-TDG method, the MBD4 protein sequence is referring to shown in the GenBank accession number AAC68878.

The preparation of Flag-UNG2: method is such as preparation purifying Flag-TDG method, and the UNG2 protein sequence is referring to shown in the GenBank accession number NP_001035781.

The preparation of GST-SUMG1: PCR method amplification SUMG1 encoding sequence is inserted into BamHI, the XhoI site of pGEX-4T carrier after BamHI, XhoI enzyme are cut.PGEX-4T-SMUG1 is transformed BL21 (DE3), and express with the IPTG inducible protein.With reference to the product description of GE healthcare Gluthione Sepharose 4B purifying GST-SMUG1; The SUMG1 protein sequence is referring to shown in the GenBank accession number AAL86910.

The method of the TDG albumen that purifying 6XHis merges from bacterium: with BamHI, the XhoI site of TDG encoding sequence from subclone on the pcDNA4-Flag carrier to the pET28a carrier.With pET28-TDG Plasmid Transformation expression strain BL21 (DE3), induce the TDG protein expression of 6XHis fusion with IPTG.According to the specification sheets of Qiagen company Ni-NTA medium purification His-TDG albumen.

The expression plasmid of Tet2 CD, TDG, GADD45A makes up

The coding gene sequence of the C end protein that includes catalyst structure domain (Tet2 CD) of Tet2 CD expression plasmid: Tet2 is shown in 1042-1912 position among the GenBank accession number NP_001035490, be inserted into the pcDNA4-Flag carrier, insertion point is BamHI and NotI.

The total length coding gene sequence of Tet2 expression plasmid: Tet2 is inserted into the pCAG-Flag carrier as shown in GenBank accession number NP_001035490, insertion point is BamHI and NotI.

The coding gene sequence of TDG:TDG is inserted into the pcDNA4-Flag carrier as shown in GenBank accession number NP_766140, insertion point is BamHI, XhoI.

TDG mutant expression plasmid: N151A is the mutant of TDG enzymic activity inactivation, its coding gene sequence is as shown in GenBank accession number NP_766140, but by PCR method with in the proteins encoded of correspondence the 151st sport A by N, then the mutant code gene order is inserted the pcDNA4-Flag carrier, insertion point is BamHI, XhoI.

The GADD45A expression plasmid: the GADD45A coding gene sequence is as shown in GenBank accession number NP_001915, is inserted into the pcDNA4-Flag carrier, and insertion point is BamHI, XhoI.

GADD45A mutant expression plasmid: G39A is the mutant of GADD45A, its coding gene sequence is as shown in GenBank accession number NP_001915, but by PCR method with in the proteins encoded of correspondence the 39th sport A by G, then the mutant code gene order is inserted the pcDNA4-Flag carrier, insertion point is HindIII, XbaI.

The acquisition of the external methylated luciferase reporter gene carrier of M.SssI

Preparation method: (carrier framework does not contain the CG site with the luciferase reporter gene carrier, but promoter region contains the CG site) (G Barreto et al., Nature445,671 (Feb8,2007) use the M.SssI enzyme in vitro reactions, the M.SssI enzyme is only to the C in CG site modifications that methylate, so can obtain the methylated luciferase reporter gene carrier of promoter region.

Expression of recombinant proteins and purifying

In order to express the recombinant protein with the Flag label, the encoding gene of albumen or protein fragments or protein mutant is cloned into the (remodeling method: two complementary DNA oligo of composite coding Flag label of revising, 5 '-AGCTTATGGACTACAAAGACGATGACGACAAGG-3 ' (SEQ ID NO:4) and 5 ' GATCCCTTGTCGTCATCGTCTTTGTAGTCCATA-3 ' (SEQ ID NO:5), after the annealing, be inserted into pcDNA4 carrier (Invitrogen, Cat.No.V1020-20)) BamHI of pcDNA4 carrier (Invitrogen), in the XhoI site, obtain the pcDNA4-Flag carrier.Expression plasmid is transfected in the HEK 293T cell by polymine (polyethylenimine, PEI, Sigma).After the transfection 40 hours, results and lysing cell.Lysate is 50mM Tris, pH7.4, and 500mM NaCl, 1%NP40,1X is without proteinase inhibitor (Roche) and the 1mM PMSF of EDTA.Recombinant protein adopts to specifications purifying of FLAG M2 Affi-Gel (Sigma).Recombinant protein under the last wash-out in 4 ℃ of dialysis 4 hours, then is stored in-20 ℃ in dialyzate (20mM HEPES, pH7.4,50mM NaCl, 50% glycerine).The quality of recombinant protein is by running SDS-PAGE glue, coomassie brilliant blue staining and identified by the immuning hybridization that Flag antibody (Sigma) detects then.

The mouse Tet1 (Tet1 CD) that contains catalyst structure domain from expressed in insect cells and purifying by before the method for description carry out (M.Tahiliani et al., Science324,930 (May 15,2009)).

Make up the mouse ES cells strain of Tdg knockdown

Make up the slow virus plasmid (J.Moffat et al., Cell 124,1283 (Mar 24,2006)) of being expressed by U6 promoters driven Tdg shRNA according to the method for having delivered.Lentiviral vectors pLKO.1 is through transforming, and its puromycin resistance gene is replaced by conventional EGFP gene.Two siRNA target sequences correspond respectively to 573-593 position and the 1180-1200 position Nucleotide of mouse Tdg gene (GenBank accession number: NM 172552).The DNA polynucleotide that contain each siRNA sequence insert AgeI and the EcoRI site of transforming carrier after annealing.(derive from 129Sv/Pas (mouse species is available from German Max-Plank Institute of Biophysical Chemistry), infection multiplicity is 60 to packaged virus infection MPI-II ES cell.The ES clone of picking and a plurality of expression EGFP that increase.Identify and select to lack the ES clone of TDG with Western blotting.

Make up the iPS cell strain of TDG disappearance

The structure of Tdg targeting vector such as P.Liu, N.A.Jenkins, N.G.Copeland, Genome Res13,476 (Mar, 2003) are described.The method that electricity consumption turns imports to C57BL/6 ES cell with targeting vector and carries out homologous recombination.In positive ES cell clone, comprise the genome area of 7 exons of the 3rd exon to the by the grappling of LoxP site.The iPS clone that knocks out in order to set up Tdg is at first separated embryo fibroblasts from the E13.5 days embryos that the C57BL/6-ICR of the two grapplings of Tdg mixes the mouse of background, uses subsequently Oct4, and Sox2 and the Klf4 factor are carried out the generation that reprogrammed is induced the iPS cell.Transient expression Cre excision Tdg is anchored the zone in the iPS cell, thereby produces the iPS cell that Tdg knocks out.

External DNA oxidizing reaction

The basic method (S.Kriaucionis, N.Heintz, Science324,929 (May 15,2009)) of describing in the past that adopts of vitro enzyme reaction.Concise and to the point process is: contain the PCR fragment of 5mC or hmC and nuclear extract or Tet albumen in reaction solution in 37 ℃ of reactions 40 minutes, the composition of reaction solution is 50mMHEPES, pH8.0,50mM NaCl, 2mM xitix (ascorbic acid), 1mM2-oxoglutarate (OG), 100 μ M Fe (NH ₄) ₂(SO ₄) ₂, 1mM ATP, and 1mM DTT.Then Substrate DNA is processed with Proteinase K, and phenol/chloroform extracting operates precipitation to specifications with DNAmate (TaKaRa).

Thin-layer chromatography (thin layer chromatography, TLC) is analyzed the 5mC derivative

After the Tet enzyme reaction, biotin labeled DNA substrate 37 ℃ of digestion 1 hour, is then used phenol/chloroform extracting and purifying, DNAmate (TaKaRa) precipitation with EcoNI.The DNA substrate of digestion uses calf intestinal alkaline phosphatase (calfintestinal alkaline phosphatase, CIAP, TaKaRa) to process after 1 hour, again purifying.Then the DNA oligonucleotide uses T4 polymerized nucleoside kinases (TaKaRa) end mark.Reaction solution contain 10 μ Ci's [γ- ³²P] ATP, in 37 ℃ of reactions 1 hour.The fragment that mark is good and streptavidin Sepharose High Performance beads (GE Healthcare) were in room temperature reaction 1 minute.After washing with the TE damping fluid, in conjunction with dna fragmentation with s1 nuclease (TaKaRa) in 23 ℃ of digestion reactions 15 minutes.The digestion product point of 1 microlitre is on Mierocrystalline cellulose TLC plate (Sigma).Moving phase is isopropylformic acid: water: ammoniacal liquor (66:20:2).The TLC plate shields detection, FujiFilm Fluorescent Image Analyzer FLA-3000 scanning analysis with phosphorus.

HPLC analyzing DNA nucleosides hydrolyzate

Contain the DNA substrate of the 5hmC of 20ng at least or 5caC after thermally denature, spending the night at least 1 hour or 37 ℃ in 50 ℃ of reactions with the nuclease P 1 (Sigma) of 0.1U, (reaction system 18 μ l comprise 20mM NaOAc, pH5.3,0.2mM ZnSO ₄).Add afterwards the 10X CIAP damping fluid of 2.1 μ l and the CIAP (TaKaRa) of 0.9 μ l, in 37 ℃ of reactions at least 2 hours or spend the night.Reaction product is analyzed at Agilent1200 HPLC instrument, and chromatographic column is the AQ-C18 post of 5-μ m particle, 25cm x4.6mm.Moving phase is 10mM KH ₂PO ₄, pH3.7, operation 1ml/min, 280nm detects.5hmC nucleosides standard substance are taken off the phosphoric acid preparation of 5hmdCTP (Bioline) by CIAP (TaKaRa).2-desoxycytidine and 5-methyl 2-desoxycytidine are available from Sigma.

The mass spectrum experiment

In order to identify the product that is generated with external oxidation in vivo by Tet albumen, the inventor uses automatic collection module (Agilent Technologies) to collect the purpose peak after through the HPLC experiment.Through after the desalination, the component of collection is used the H of 20 microlitres ₂O/ACN (1:1) is resuspended.Get 5 microlitre samples and use LTQ-Orbitrap Velos mass spectrograph (Thermo Scientific) to detect, negative ion mode (1.3kV) has been used in experiment.The experiment tolerance range is 0.4-0.7ppm.

The HPLC-ESI-MS/MS of 5caC detects the multiple-reaction monitoring pattern (MRM mode) of having used triple quadrupole bar mass spectrograph (Agilent 6410QQQ).The signal of MRM pattern is three characteristic daughter ions (three kinds of nuclear-cytoplasmic ratios are converted to 270 → 110,270 → 154,270 → 227) of 110,154 and 227 from 5caC parent ion (nuclear-cytoplasmic ratio is 270) and the nuclear-cytoplasmic ratio of colliding cracked generation thereof.Judge that the standard that 5caC occurs is to occur simultaneously through three kinds of conversions behind the reverse post of HPLC.

Interior cytosine(Cyt) 5 methyl groups of CpG dinucleotide ¹⁴The C mark

Add in the 200 μ l reaction systems 5 μ g 101-bp PCR dna fragmentation (see above face described, concrete dna sequence dna is as follows: 5 '-TAATCGTAATACGATACGATAATACGCGTACGACGACGTCGTTCGAATCGTCGTAC GAATCGTACGATCGTACGACGATTAAACGATACGATCGTATATAA-3 ' (SEQ ID NO:6)), the M.SssI CpG methyltransgerase of 20 units and 8 μ l S-[methyl- ¹⁴C]-the adenosyl-L-methionine(Met) ( ¹⁴C-SAM, 1.48-2.22GBq/mmol, PerkinElmer), in 37 ℃ of reactions 2 hours.DNA is dissolved in 40 μ l H with phenol/chloroform extracting and purifying, ethanol precipitation ₂Among the O.

The base excision is analyzed

According to the method for having delivered and slightly modified, detect a plurality of Glycosylases to the excision of the base of different double-stranded DNA substrates active (Neddermann P.JBC, 1993,268:21218-21224).Substrate DNA contains the cytosine(Cyt) in single G/U mispairing or its MspI site through chemically modified.With PNK (T4 PNK) and [γ- ³²P]-ATP carries out end mark to the polynucleotide of a modification (5 '-GAGCGTGACMGGAGCTGAAA-3 ', M=U, 5hmC or 5caC).Anneal with equimolar complementary G chain (there is the G mispairing in this chain in the corresponding site of M, other site complementary) or the polynucleotide that contain corresponding modification the (5hmC or 5caC modify) subsequently.During reaction, 40nM Glycosylase or 40 μ g nuclear extracts and 10nMDNA substrate were hatched 30 minutes at 30 ℃.Reaction buffer is 25mM HEPES, pH7.8,0.5mM EDTA, 0.5mM DTT, 0.5mg/ml BSA.For the abasic site in the dna double chain (AP site) being transformed into the breach of strand, in reaction system, adding respectively NaOH and EDTA to final concentration 90mM and 10mM, and added 5 minutes at 100 ℃.Carry out the separation of product with the poly-propionic acid amide glue of 20% sex change subsequently.Behind the electrophoresis, carry out radioactive automatic developing.

TDG glycosidase activity detection method is with above-mentioned base excision analytical procedure.

5caC is in the detection of the HEK293T of transfection Tet2 cellular genome

The structure of the expression plasmid of Flag-Tet albumen or protein fragments (or structural domain): the encoding sequence of Tet2, Tet1, Tet3 or their fragment or varient is inserted in the AscI/NotI site of pCAG (m) carrier through transforming.

Use Linpofectamine Reagent 2000 (Invitrogen) with the expression plasmid transfection of Flag-Tet2 to HEK 293T cell.After 48 hours, collect cell and use the method for phenol/chloroform to extract genomic dna.Then use the RNA in the RNase A/T1 digested genomic dna to pollute (per 100 micrograms of DNA are used 50 microgram RNase A and 1000U RNase T1).DNA uses 70% ethanol precipitation and uses the dissolving of TE damping fluid.Subsequently, use nuclease P1 hydrolysis DNA spend the night (per 100 micrograms of DNA are used 1U).At last, use CIAP enzyme (TAKARA) to digest Nucleotide 5 ' end phosphoric acid and generate nucleosides.Sample concentration to the 20-30 microlitre, is carried out HPLC-MS/MS and detected.

The bisulfite sequencing analysis

Ultimate principle: the cytosine(Cyt) of single stranded DNA can be transformed into uridylic by the hydrosulphite deaminize, and 5-methylcytosine then can not be modified, and still remains 5-methylcytosine.Specific gene group zone design primer for after bisulf iotate-treated can increase it by PCR, and uridylic becomes thymus pyrimidine after the amplification.

Concrete grammar :～200ng genomic dna is with inserting immediately cooling in the ice 100 ℃ of sex change behind the restriction enzyme fragmentation after 10 minutes, adds 2M NaOH and is 0.3M and places the strand states that kept DNA in 15 minutes at 50 ℃ to final concentration.The 2%low melting point agarose (Sangon) of 2 times of volumes is joined rapid mixing in the dna solution.10 μ l DNA/agarose mixtures are added drop-wise to place in the mineral oil of precooling and on ice and formed bead in 20 minutes.After agarose bead solidifies, add 500 μ l bisulfite solution (2.5M sodium bisulfite (Sigma S-9000), 10mM hydroquinone, pH5.0) also carefully rocking centrifuge tube makes agarose bead be immersed in bisulfite solution(lower floor liquid phase) in, under the lucifuge condition, processed 4～12 hours in 50～55 ℃.Subsequently, remove all solution as far as possible, and clean bead three times with 1ml1 * TE, each 10 minutes; 500 μ l0.2M NaOH process bead twice, each 15 minutes; Use again at last 1ml1 * TE to clean bead three times, each 10 minutes.After being disposed, bead can be in 1 * TE to deposit several weeks in 4 ℃ stand-by.Use the primer for goal gene group zone to carry out regular-PCR or nest-type PRC amplification.The PCR product connects among the pBluscript II SK (+) behind test kit (Takara DNA fragments purification Kit) purifying.Connect product approximately long 300～400 clones on the LB culture medium flat plate, get 10～15 positive colonies and transfer to Shanghai Bo Ya biotech company and carry out the order-checking of Insert Fragment.

The nuclear method for extracting

With at least 10 ⁸Cell is resuspended in the HEPES with the isopyknic hypotonic buffer liquid of cell precipitation Buffer A(10mM, pH7.9,10mM KCl, 1.5mM MgCl ₂, 0.5mM DTT) in, homogenate 10-15 time placed in the cell homogenates device that is transferred to precooling after 20 minutes (Wheaton, Cat.No.432-1270) on ice.4 ℃, centrifugal 20 seconds of 12,000g.Abandon supernatant, precipitation is resuspended in high osmotic buffer Buffer B (20mM HEPES, pH7.9,420mM NaCl, 1.5mM MgCl ₂, 0.2mM EDTA, 0.5mM DTT, 25%glycerol) in, place on ice and examined with lysing cell in 60 minutes.4 ℃, centrifugal 10 minutes of 16,000g.The collection supernatant is also dialysed to storage buffer Buffer C(20mM HEPES, pH7.9,100mM KCl, 1.5mM MgCl ₂, 0.2mM EDTA, 0.5mM DTT, 20%glycerol) in.The Bradford method is measured protein concentration, and is frozen in-80 degree refrigerators after the packing.

II. embodiment

Embodiment 1, in the nuclear extract of the mammalian cell of transfection Tet2, detect the modification activities of 5mC and 5hmC

Having been reported the Tet dioxygenase, to make the 5mC hydroxylating be 5hmC (M.Tahiliani et al., Science 324, but the unclear modification activities that whether in the nuclear extract of mammalian cell, has for 5mC and/or 5hmC 930 (May 15,2009)).Because whether this modification activities exists and have uncertainty, select an appropriate method most important to the success that detects.

Use radio isotope ³²Then the modified nucleotide of P end mark behind digestion with restriction enzyme use thin-layer chromatography (thin layer chromatography, TLC) analysis, is a kind of very responsive method.But the modification of base may hinder restriction endonuclease digestion.In order to address this problem, the inventor has utilized a kind of characteristics of restriction enzyme EcoNI, and namely it can identify the two ends that separated by 5 any Nucleotide respectively the sequence of 3 fixed nucleotides (5 ' CCTNN/NNNAGG3 ', any Nucleotide of N=).If the new Nucleotide that produces after 5mC modifies is positioned at the position of the 3rd N, then can not hinder EcoNI digestion; If this position remains 5mC, then EcoNI can not digest.In addition, considering inevitably can pollute in any nuclear extract has DNA, and the inventor will be contained the DNA biotin labeling of 5mC, and like this, Substrate DNA just can be by streptavidin pearl purifying.

By such as the operating process among Fig. 6 A, in nuclear extract (NE) reaction with the HEK293 cell (expression plasmid of transfection expression Flag-Tet2 in the cell) of 5mC DNA substrate and transfection Tet2 (with the Flag label), cut and radio isotope through restriction enzyme EcoNI enzyme ³²Behind the P mark, can detect an extra point (Nucleotide of this end evaluation is denoted as " X ", Fig. 6 B) with TLC.The mobile distance of this point is less than all other Nucleotide, and its amount is suitable with the amount of 5mC minimizing.(the substrate sequence is with Fig. 6 A with the DNA substrate that contains 5hmC, only become methylolated cytosine(Cyt) (hmC) in position, centre methylated cytosine(Cyt) (mC)) do also can detect a same similar point (Fig. 6 B) after the reaction, but when doing reaction with the DNA substrate (the substrate sequence is with Fig. 6 A, and only methylated cytosine(Cyt) (mC) position becomes cytosine(Cyt) (C) in the centre) that only contains C, do not detect this point.Utilize same detection method, when doing reaction with mouse ES cells nuclear extract or the nuclear extract component that contains the endogenous Tet2 of same amount, do not detect any extra point.

These results suggest, the nucleus extract of transfection Tet2 have the especially activity with 5mC and 5hmC generation " X ".

The modification of 5mC and 5hmC is by the catalysis of Tet dioxygenase among embodiment 2, the DNA

Since the Tet dioxygenase can catalyzed oxidation 5mC become 5hmC, Nucleotide " X " point that inventor's conjecture is identified at the end that the TLC plate detects may be by with the interactional protein of Tet2 or the catalysis of Tet2 own.In order to check this conjecture, the inventor dyes total length Tet2 (being the expression plasmid of transfection expression Flag-Tet2) with the Flag label at the 293T transit cell, and purifying Tet2 albumen is used for detecting the modification activities that whether has the DNA that contains 5mC.TLC analyzes demonstration, contain the Tet2 albumen test of the DNA substrate of 5mC or 5hmC and purifying after, all detect and produced " X " point (Figure 1A).

In order to determine that " X " point on the TLC plate is to derive from 5mC, the inventor has done an isotopic tracing experiment.Utilize the special bacterium methyltransgerase M.SssI of CpG and [ ¹⁴The C methyl] S-adenosylmethionine, the inventor has carried out isotopic labeling with the methyl group of 5mC in the DNA substrate, carries out analyzing such as the TLC of embodiment 1.As a result, on the TLC plate, can see there is one ¹⁴The point of C with ³²" X " point of P mark has the same mobility, confirms that " X " point of that the unknown derives from 5mC (Figure 1B).

The 5mC derivative that produces under the Tet2 effect also can be detected by high performance liquid chromatography (high performance liquid chromatographic, HPLC).The Tet2 of wild-type can change the 5mC more than 90% or 5hmC into a kind of new nucleosides (X ' peak) (Fig. 1 C).Yet (HxD is positioned at conservative Fe in the sudden change of the amino-acid residue of core catalytic site ²⁺Combining site) Tet2 enzyme (the recombinant expressed Fig. 7 of opinion) then can not produce X ' peak.

Adopt similar method, the inventor has detected the in addition activity of two homologous proteins (the recombinant expressed Fig. 7 of opinion) of Tet2.The result shows that Tet1 and Tet3 have activity, but Tet1 is than Tet3 activity stronger (Fig. 8).The C end protein (Tet1CD) that includes catalyst structure domain also has obvious activity (Fig. 9).In addition, the C end protein that contains catalyst structure domain of purifying also has the activity (Figure 10) of obvious conversion 5mC from the Sf9 insect cell.

Obviously, these results confirm that the Tet enzyme has the function that conversion 5mC and 5hmC generate another kind of dna modification base in itself.

Embodiment 3, Tet dioxygenase catalysis 5mC and 5hmC change 5-carboxyl cytosine(Cyt) into

The DNA substrate (with the substrate among the embodiment 1) that contains 5mC or 5hmC with the Tet effect after, detect emerging peak at HPLC, but this peak only adds two cofactors, i.e. Fe that the enzyme of all dioxygenase families all needs when reaction ²⁺And just produce (Figure 11) during 2-oxoglutaric acid (2-oxoglutarate, 2-OG), present the dependency of these two cofactors, in conjunction with what keep on the cytosine(Cyt) ¹⁴The methyl group of C mark (Figure 1B) points out new modification to derive from the oxidation of the 5-methyl group of 5mC.And ATP concentration is 0,0.1,0.3,0.5, during 1mM, the step by step oxidation meeting that 5caC presents dose-dependently ground rising (Figure 17) 5mC forms 5hmC, 5-aldehyde radical cytosine(Cyt) (5-formylcytosine, 5fC) and 5-carboxyl cytosine(Cyt) (5-carboxylcytosine, 5caC).The inventor sees significantly, and the 5mC Unknown Derivatives that is produced by Tet2 catalysis that detects on the HPLC has identical retention time (Fig. 2 A) with the 5caC standard substance of chemosynthesis.In addition, " X " point that is produced by Tet catalysis that detects at TLC with ³²The mobility of the 5caC Nucleotide standard substance of P mark is consistent, and this is further for identifying that the 5mC Unknown Derivatives provides believable evidence (Fig. 2 B).

In order further to identify unknown modified nucleoside positively, the inventor has collected the X ' peak on the HPLC, then carries out high-resolution mass spectroscopy.Under the negative electricity pattern, mass spectrometric detection to a mass-to-charge ratio (m/z) is 270.0731 peaks, with the deviation at the single isotopic ion peak that derives from 5caC (m/z:270.0726) 1.8ppm (Fig. 2 C, on) only.The fragment ion pattern of total fragment ion pattern and standard substance 5-carboxyl cytidine fit like a glove (Fig. 2 C, lower).In a word, these results confirm that 5mC and 5hmC among the Tet2 dioxygenase catalyzed oxidation DNA change 5-carboxyl cytosine(Cyt) into.

In order to study the enzyme reaction characteristic of Tet2, the inventor has carried out the bisulfite sequencing analysis to methylated DNA behind external hydroxylation reaction.5caC is after the bisulfite reaction the same with the performance of unmethylated cytosine(Cyt) (Figure 12 B).It is continuous catalysis oxidation 5mC site that 5caC clearly points out Tet2 in reacted Distribution Pattern (Figure 13).

Embodiment 4, Tet2 catalysis in the mammalian cell of transfection forms 5caC

The inventor then in the mammalian cell of cultivating transfection Tet albumen detect its whether can oxidoreductase gene group DNA on 5mC be 5caC.With the catalyst structure domain (Tet2 CD) of the Tet2 (Tet2FL) of total length and its C end respectively transfection HEK 293T cell, and utilize its institute with the method that the Flag label uses immunofluorescence and Western to hybridize the protein expression situation to be carried out verifying (Fig. 3 A).HPLC analyzes demonstration, after Tet is transfected in the 293T cell, except the peak that 5hmC occurs, a new peak also occurred in the genomic dna, and this peak has identical retention time (Fig. 3 B) with 5caC in HPLC analyzes.And for transfection the cell of mutant Tet2 of catalyst structure domain, this peak does not appear in its genome.

In order to determine whether this peak is 5caC, it is 270 parent ion, the three kinds of characteristic daughter ions (nuclear-cytoplasmic ratio is respectively 110,154 and 227) after cracked that the inventor uses the mass spectrometric multiple-reaction monitoring pattern of triple quadrupole bar (MRM mode) to detect nuclear-cytoplasmic ratio.Carried out the Mass Spectrometric Identification experiment under the experiment condition of setting, undoubtedly, this peak is 5caC (Fig. 3 C) in the cell genomic dna of transfection Tet2 albumen.The inventor has also carried out identical experiment to Tet1 albumen, finds that Tet1 albumen also has the activity that oxidation generates 5caC.

Embodiment 5, DNA Glycosylase TDG identification and excision 5-carboxyl cytosine(Cyt)

In the mouse embryo stem cell of high expression level Tet and neurocyte, do not detect 5-carboxyl cytosine(Cyt) (M.Tahiliani et al., Science 324,930 (May 15,2009)).From the another one aspect, 5-carboxyl cytosine(Cyt) chemically is being stable, under physiological condition, can not spontaneous decarboxylation become cytosine(Cyt).This proposes a kind of possibility, and namely in mammalian cell, 5-carboxyl cytosine(Cyt) is in case produce and will be removed from genomic dna on one's own initiative.So the inventor sets about detecting in the nuclear extract of mammalian cell whether contain the activity of excising 5caC.The inventor carries out the Glycosylase enzyme activity determination with the double-stranded DNA that contains 5caC as substrate.The result shows, can detect the special glycosidase activity of 5caC in the nuclear extract of mouse ES cells.Be that the 5caC substrate of 20 Nucleotide (20mer) is hatched and produced the shearing product (Fig. 4 A) that length is 9 Nucleotide (9mer) with nuclear extract and length, this is the site that produces a dealkalize base by removing the 5caC base, and heat treated DNA chain has produced and broken to form in basic solution.Ironically, ES nuclear extract and 5hmC substrate are hatched and can not be removed the 5hmC base.The inventor wonders which Glycosylase has mediated the excision of caC.Think that through repeatedly studying the inventor TDG (thymine-DNA glycosylase) most possibly mediates the caC excision, because this enzyme is necessary for fetal development, and can remove the thymus pyrimidine and the uridylic (T.Lindahl that are produced through deamination by 5-methylcytosine and cytosine(Cyt), R.D.Wood, Science286,1897 (Dec3,1999)).Therefore, the inventor has carried out the glycosidase activity detection with the TDG albumen (Figure 14 B) of restructuring.The result shows can shear 5caC really, but can not shear 5hmC.MBD4 is the Glycosylase (D.Cortazar et al., Nature 470,419 (Feb 17,2011)) that another one can remove uridylic corresponding to guanine or thymus pyrimidine, and it does not have shear active to 5caC.Similarly, Glycosylase UNG (uracil-DNA glycosylase) and SMUG1 (single-strand-selective monofunctional uracil DNA glycosylase 1) can remove uridylic and 5-hydroxyl uridylic (B.Hendrich from DNA, U.Hardeland, H.H.Ng, J.Jiricny, A.Bird, Nature 401,301 (Sep 16,1999); H.E.Krokan, R.Standal, G.Slupphaug, Biochem J325 (Pt1), 1 (Jul1,1997)), but do not show 5caC excision active (Fig. 4 B).The 5caC excision of TDG is active further to be verified in the HEK293T of transfection cell.External source is crossed and is expressed the 5caC that wild-type TDG can remove the Tet2 generation of coexpression, but the TDG of loss of catalytic activity sudden change does not then have this effect (Fig. 4 C).

Consistent with the above results is that the nuclear extract of the ES cell of Tdg knockdown lacks 5caC excision active (Fig. 4 D).In addition, the disappearance (Fig. 4 A, lane3) that TDG (ES+anti-TDG) causes 5caC excision activity is rejected in immunity from the ES nuclear extract.These results suggest TDG has the activity of the oxidation products 5caC of 5mC among distinctive identification and the excision DNA.

The rejecting of TDG has caused the accumulation of 5caC in the genome in embodiment 6, the mouse ES cells

The inventor in vivo with the cell of transfection in proof TDG can excise 5caC from genomic dna.On this basis, if further whether research rejecting TDG can cause endogenous 5caC accumulation in the ES cell.In order to confirm this point, the inventor utilizes the technology of siRNA to set up the stable cell line of Tdg knockdown, and definite TDG protein expression level is compared really obviously reduction (Figure 15) with the control cells strain.The result of mass spectrometric detection shows, can clearly detect the signal of 5caC in the stable cell line of TDG knockdown, and can't be clear that (Fig. 5 A) in the control cells strain.

Similar, the iPS cell that uses Tdg to knock out fully, the inventor also detects the accumulation (Figure 16) of 5caC.The result quantitative from mass spectrum can calculate, and in Tdg knockdown and the iPS cell that knocks out, the content of 5caC is 9000/ genome; And infer according to the inventor's experimental precision, the content of 5caC will be lower than 1000/ genome in the wild-type cell.These data all illustrate, 5caC exists under the endogenous state of cell, and just its content is lower than the detection bottom line; After the base excision repair pathways of TDG mediation is blocked, thereby cause the accumulation of 5caC clearly to detect.

TET2 in embodiment 7, leukemia patient sudden change makes 5mC and 5hmC to transformation Efficiency Decreasing or the forfeiture of 5caC

The inventor adopts coomassie brilliant blue staining to detect mouse Tet2 wild-type and the mutant protein of purifying from the 293T cell of transient transfection.Such as Figure 18 A, E1231G wherein, P1280S, H1795R and R1810S correspond respectively to sudden change E1318G, P1367S, H1881R and the R1896S of TET2 among the leukaemic.

Adopt HPLC to detect the ability that mouse Tet2 wild-type and mutant protein are transformed into the 5hmC substrate 5caC, as a result TET2 sudden change makes 5mC and 5hmC to transformation Efficiency Decreasing or the forfeiture of 5caC, such as Figure 18 B.

Embodiment 8, screening method

(1) the Tet dioxygenase is the screening on basis

The as previously mentioned recombinant vectors of construction expression Tet2 dioxygenase, and conversion 293T cell, acquisition can be expressed the restructuring 293T cell of Tet2 dioxygenase.Arrange following two groups:

Test group: with the above-mentioned restructuring 293T cell of candidate substances processing;

Control group: without the above-mentioned restructuring 293T cell of candidate substances processing.

Detect the expression amount of Tet2 dioxygenase in test group and the control group, if compare with control group, the expression amount of Tet2 dioxygenase significantly increases (as increasing more than 30%) in the test group, illustrates that then this candidate substances is the potential material that can promote the DNA demethylation.

(2) TDG is the screening on basis

The as previously mentioned recombinant vectors of construction expression TDG, and conversion 293T cell, acquisition can be expressed the restructuring 293T cell of TDG.Arrange following two groups:

Test group: with the above-mentioned restructuring 293T cell of candidate substances processing;

Control group: without the above-mentioned restructuring 293T cell of candidate substances processing.

Detect the expression amount of TDG in test group and the control group, if compare with control group, the expression amount of TDG significantly increases (as increasing more than 30%) in the test group, illustrates that then this candidate substances is the potential material that can promote the DNA demethylation.If compare with control group, the expression amount of TDG significantly reduces (as reducing more than 30%) in the test group, illustrates that then this candidate substances is the potential material that can suppress the DNA demethylation.

, found that as candidate substances with aforementioned shRNA for mouse Tdg gene 573-593 position, its expression amount that can reduce TDG is more than 30%, and therefore, it is the material that can suppress the DNA demethylation.

(3) 5caC is the screening on basis

Test group: with the cell or tissue of candidate substances processing;

Control group: without the cell or tissue of candidate substances processing.

Detect the content of (preferred nuclear extract) 5caC in test group and cellular control unit or the tissue, if compare with control group, the content of 5caC significantly increases or descends in the test group (has statistical significance, as descend 20%), illustrate that then this candidate substances is potential can regulate DNA demethylation or methylated material.Described cell or tissue can animal normal cell or tissue, also can be the cell or tissue under the morbid state.

Embodiment 9, GADD45A pass through the DNA active demethylation of the active Tet-TDG of the participation mediation of regulation and control TDG

(671 (Feb8,2007) promptings GADD45A albumen is by participating in DNA demethylation pathway activation by the methylate expression of reticent luciferase reporter gene of CpG for G Barreto et al., Nature445 in the research of Niehrs etc.And the research of Bellacosa etc. (S Cortellino et al., Cell 146,67 (July 8,2011)) shows that TDG albumen and Gadd45 albumen and AID albumen form mixture.On this basis, the inventor infers that GADD45A participates in the DNA active demethylation approach of Tet-TDG mediation by the activity of regulating and control TDG.

At first, the inventor respectively from intestinal bacteria purifying the TDG albumen that merges of GST (preparation of GST-TDG: PCR method amplification TDG encoding sequence is inserted into BamHI, the XhoI site of pGEX-4T carrier after BamHI, XhoI enzyme are cut.PGEX-4T-TDG is transformed BL21 (DE3), and express with the IPTG inducible protein.With reference to the product description of GE healthcare Gluthione Sepharose4B purifying GST-TDG; The TDG protein sequence is referring to shown in the GenBank accession number NP_766140) (preparation of GST-GADD45A: PCR method amplification GADD45A encoding sequence is inserted into BamHI, the XhoI site of pGEX-4T carrier after BglII, XhoI enzyme are cut with GADD45A albumen.PGEX-4T-GADD45A is transformed BL21 (DE3), and express with the IPTG inducible protein.With reference to the product description of GE healthcare Gluthione Sepharose 4B purifying GST-TDG; The GADD45A protein sequence is referring to shown in the GenBank accession number NP_001915), and analyze GADD45A to the impact of TDG glycosidase activity.

Result such as Figure 19,50ng GST-TDG albumen can only Partial Resection 2nmol 5fC or the 5caC substrate in the modification cytosine(Cyt), its efficient is about 10%.Along with the gradually increase of GADD45A albumen add-on, TDG also strengthens gradually to the glycosidase activity of 5fC and 5caC substrate.When the GADD45A add-on reached 1 μ g, TDG had reached more than 90% the excision efficient of 5fC and 5caC.

Inventor's further experiment will be expressed expression plasmid and the external methylated luciferase reporter gene carrier of M.SssI of Tet2CD, TDG (or its mutant (mut)), GADD45A (or its mutant (mut)) and be pressed the array mode transfection 293T cell (ATCC) shown in Figure 20.Approximately measured the uciferase activity of each transfection group after the transfection in 48 hours.Among Figure 20 as seen, express simultaneously Tet2CD, TDG and GADD45A albumen and can significantly promote the reactivating of reticent luciferase reporter gene that methylate by CpG, and the mutant of GADD45A and TDG is to all obviously decline of activation capability of luciferin gene, especially the mutant of TDG can significantly suppress the transcriptional activation ability of GADD45A mediation, this may be that the TDG mutant of forfeiture glycosidase activity has kept ability in conjunction with 5caC, thereby with the 5caC site that endogenous TDG protein competition Tet2CD produces, play the effect of Dominant Negative.This results suggest, GADD45A activates by the expression of the luciferase reporter gene of dna methylation silence by the activity of regulation and control TDG.

In order to study GADD45A to the effect of the 5caC that produces in the body, the plasmid that the inventor will express GADD45A enters the 293T cell with the plasmid corotation of expressing Tet2, and with the content of different modifying cytosine(Cyt) in the genomic dna of efficient liquid phase chromatographic analysis corotation 293T cell.TDG is as the known Glycosylase that can excise the 5caC base, enter the 293T cell with the Tet2 corotation after, can remove the 5caC that Tet2 albumen produces fully.And in the 293T cell behind GADD45A and the Tet corotation, the content that HPLC detects 5caC significantly reduces, such as Figure 21 A.

Simultaneously genomic dna is carried out the mass spectrum quantitative analysis, behind data presentation GADD45A and the Tet2 corotation, 5fC and 5caC all have obvious reduction, but 5mC and 5caC content are then unaffected, such as Figure 21 B.

Embodiment 10, Tet1 enzyme, ATP, 2OG and FAS (Fe ²⁺) concentration impact that hmC/caC is generated

Experimental procedure:

1. every hole adds 50 μ l Avidin solution and (adds 40 μ l Avidin liquid storage (2.5mg/ml, Sigma, A9275) (100mM NaHCO in the 10ml coating buffer in 96 orifice plates ₃, pH9.6, final concentration are 10 μ g/ml)).Seal 96 orifice plates, 4 ℃ are spent the night or room temperature 1-2 hour;

2. vitro enzyme reaction (the every pipe of cumulative volume 20 μ l): reaction solution contains 50mM HEPES, pH8,50mM NaCl, the 5ng vitamin H is end-labelled to contain the DNA (sequence is without specificity, but do not contain the C of unmodified, and is synthetic by regular-PCR) of 5mC, 2mM Ascorbic Acid, 0,0.04,0.2 or 1mM 2OG (Sigma, K1128), 0,0.004,0.02,0.1 or 100 μ M FAS (Fe ²⁺), 0,0.04,0.2 or 1mM ATP and 1mM DTT, add 0,150,300 or 600ng Tet1 enzyme, 37 ℃ of reactions 40 minutes;

3. every pore added the 10%SDS of 1/10 volume after reaction finished, and making final concentration is 1%, mixing, and room temperature was placed 5 minutes, added TE to cumulative volume 80 μ l;

4. (500mM NaCl, 1mM EDTA in1 * TBST) clean coated 96 orifice plates 3 times (each 3 minutes) of Avidin with lavation buffer solution;

5.DNA in conjunction with: shift the liquid in the 3rd step of 40 microlitres in a hole of 96 orifice plates, but each sample is established at least 1 multiple hole, room temperature jolting 5 minutes;

6. wash plate once with lavation buffer solution, 2 minutes;

7.DNA sex change: every hole adds the HCl 70 μ l of 2M, room temperature 2 minutes;

8. abandon supernatant, add 100 μ l100mM Tris.HCl, pH8.0, room temperature 2 minutes is washed once with TBST again;

9. sealing: add 3%BSA-TBST, every hole 60 μ l, room temperature jolting 30 minutes;

10. abandon supernatant, add mC, hmC or the every hole 40 μ l of caC antibody (Anti-mC is commercialization mouse source antibody, and Anti-hmC or caC are rabbit source antibody) diluent, room temperature jolting 30 minutes;

11. abandon supernatant, TBST washes plate 2 times, each 3 minutes;

12. add the anti-every hole 40 μ l of (being commercialization antibody) diluent of the IgG of anti-mouse or rabbit, room temperature jolting 30 minutes;

13. abandon supernatant, TBST washes plate 3 times, each 4 minutes;

14. add the every hole 40 μ l of ECL reaction solution, exposure tests.

Result such as Figure 22, outside dezymotizing among the figure, the reaction solution component is (unless concentration marks especially): 50mM HEPES, pH8.0,50mM NaCl, 1mM ATP, 2mM ascorbic acid, 1mM 2-oxoglutarate (2OG), 100 μ M Fe (NH ₄) ₂(SO ₄) ₂(FAS), and 1mM DTT, substrate is the double-stranded (sequence: 5 '-TTGATGGATATGGTGGAATTCGATAACGACCCTACCGGAGGAACGAACGATCACAT ACACATCACTT-3 ' (SEQ ID NO:7) of 67bpDNA that contains mC; All C are caC; 5 ' end of the complementary strand of this sequence is with biotin labeling), reaction was hatched 40 minutes at 37 ° of C.The amount that signal stronger (gray scale is higher) expression generates among the figure is more.Note in each group, along with the amount increase of corresponding adding reaction composition, substrate mC is corresponding can be reduced, and is accompanied by the corresponding increase of product caC.HmC is as intermediate product, and variation tendency is not obvious.The result of the experimental result of Tet2 enzyme and Tet1 enzyme is similar, and the catalytic activity of Tet3 enzyme is more herein than Tet1 or Tet2 obvious weak (not showing).

The amount of signal stronger (gray scale is higher) expression Tet1 enzyme, ATP, 2OG or FAS is more.In each group, along with the minimizing of substrate mC, the corresponding increase of product caC.HmC is as intermediate product, and variation tendency is not obvious.

Discuss

Known TDG can excise 5mC among the DNA or the deamination product of 5mC, but whether these functions are relevant not clear with the demethylation of DNA.And the deamination that does not at present also have compellent evidence to show to have which kind of enzyme can mediate specifically 5mC produces the thymus pyrimidine mispairing, TDG does not have glycosidase activity (S.C.Wu, Y.Zhang, the Nat Rev Mol Cell Biol 11 for 5mC yet, 607 (Sep, 2010); D.Cortazar et al., Nature470,419 (Feb 17,2011)).Excision or deamination at 5mC all also lack under the background of experimental evidence, the present invention clearly proved the Tet dioxygenase can oxidation 5mC and 5hmC change 5caC into, the latter further becomes the substrate of TDG.Thereby the 5mC of Tet mediation and 5hmC change 5caC into and can start the initial BER path of TDG.This a series of reaction finally can cause the demethylation of DNA, because unmethylated cytosine(Cyt) has been inserted into the genome area (Fig. 5 B) of repairing.

The albumen distributional analysis of genome range shows that Tet1 relative rich in the ES cell combines in unmethylated promoter site (G.Ficz et al., Nature, (Apr3,2011) of enlivening that contain more CpG; W.A.Pastor et al., Nature, (May8,2011); C.X.Song et al., Nat Biotechnol29,68 (Jan, 2011); H.Wu et al., Genes Dev25,679 (Apr1,2011)), but most Tet1 binding site does not contain 5hmC (K.Williams et al., Nature, (Apr13,2011); Y.Xuet al., Mol Cell, (Apr20,2011); H.Wu et al., Nature, (Mar30,2011)).Whether phenomenons of these upper contradictions in surface perhaps can be explained like this: at the promoter site that enlivens of Tet1 combination, sporadic 5mC becomes 5caC by the Tet1 oxidation, the latter further removes by the BER path of TDG mediation, thereby has avoided wrong methylating.In this case, 5mC very likely can't detect enlivening promoter site, because they just are temporarily stored in the small portion cell is short-and-medium.Same, at many Tet1 binding sites, 5hmC content is not high, because they are converted into 5caC very soon, is removed in cell.

The 5hmC rather than the 5caC that in ES cell and neurone, have maintenance level, this true prompting oxidation 5hmC is rate-limiting step in the demethylation process to 5caC; And prompting is except as the intermediate in the dna methylation process, and 5hmC also has the function of genome mark.

All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (21)

1. the method for a DNA demethylation comprises:

(1) processes DNA with the Tet dioxygenase, change 5-methylcytosine among the DNA or 5-hydroxymethyl cytosine into 5-carboxyl cytosine(Cyt);

(2) DNA that obtains with thymine DNA glycosylase treatment step (1) is with 5-carboxyl cytosine(Cyt) excision among the DNA.

(3) shear the reparation approach by DNA, add non-methylated cytosine(Cyt) in 5-carboxyl cytosine(Cyt) excision site.

2. the method for claim 1 is characterized in that, in the step (2):

When processing DNA with the thymine DNA glycosylase, also add GADD45A.

3. a method that 5-methylcytosine among the DNA or 5-hydroxymethyl cytosine is changed into 5-carboxyl cytosine(Cyt) comprises: process DNA with the Tet dioxygenase.

4. method as claimed in claim 3 is characterized in that, when processing DNA with the Tet dioxygenase, also comprises adding ATP, Fe ²⁺And/or 2-oxoglutaric acid; Or adding can form ATP, Fe ²⁺And/or the material of 2-oxoglutaric acid.

5. the method with 5-carboxyl cytosine(Cyt) excision among the DNA comprises: process DNA with the thymine DNA glycosylase.

6. method as claimed in claim 5 is characterized in that, when processing DNA with the thymine DNA glycosylase, also adds GADD45A.

7.Tet the purposes of dioxygenase or its promotor is used for changing DNA 5-methylcytosine or 5-hydroxymethyl cytosine into 5-carboxyl cytosine(Cyt); Or for the preparation of the composition that 5-methylcytosine among the DNA or 5-hydroxymethyl cytosine is changed into 5-carboxyl cytosine(Cyt).

8.Tet the purposes of the inhibitor of dioxygenase is used for suppressing the DNA 5-methylcytosine or 5-hydroxymethyl cytosine changes 5-carboxyl cytosine(Cyt) into; Or for the preparation of the composition that suppresses 5-methylcytosine among the DNA or 5-hydroxymethyl cytosine and change into 5-carboxyl cytosine(Cyt).

9. the purposes of thymine DNA glycosylase or its promotor is used for DNA 5-carboxyl cytosine(Cyt) is excised; Or for the preparation of the composition with 5-carboxyl cytosine(Cyt) excision among the DNA.

10. the purposes of the inhibitor of thymine DNA glycosylase is used for suppressing the excision of DNA 5-carboxyl cytosine(Cyt); Or for the preparation of the composition that suppresses 5-carboxyl cytosine(Cyt) excision among the DNA.

11. the test kit of a DNA demethylation, comprising:

Tet dioxygenase or its promotor; With

Thymine DNA glycosylase or its promotor.

12. test kit as claimed in claim 11 is characterized in that, also comprises: GADD45A or its promotor.

13. a test kit that suppresses the DNA demethylation, comprising:

The inhibitor of Tet dioxygenase; With

The inhibitor of thymine DNA glycosylase.

14. a method of screening the potential material of modulating DNA methylation/demethylation state comprises:

(1) processes the system of expressing the Tet dioxygenase with candidate substances; With

(2) detect Tet dioxygenase in the described system transcribe, express or active;

Wherein, if described candidate substances can improve transcribing, expressing of Tet dioxygenase or activity, show that then this candidate substances is the potential material that promotes the DNA demethylation; If described candidate substances can reduce transcribing, expressing of Tet dioxygenase or activity, show that then this candidate substances is the potential material that causes dna methylation.

15. a method of screening the potential material of modulating DNA methylation/demethylation state comprises:

(1) processes the system of expressing the thymine DNA glycosylase with candidate substances; With

(2) detect thymine DNA glycosylase in the described system transcribe, express or active;

Wherein, if described candidate substances can improve transcribing, expressing of thymine DNA glycosylase or activity, show that then this candidate substances is the potential material that promotes the DNA demethylation; If described candidate substances can reduce transcribing, expressing of thymine DNA glycosylase or activity, show that then this candidate substances is to suppress the potential material of DNA demethylation.

16. such as the described method of claims 14 or 15, it is characterized in that, step (1) comprising: in test group, candidate substances is joined the system of expressing Tet dioxygenase or thymine DNA glycosylase; And/or

Step (2) comprising: detect the transcribing of Tet dioxygenase in the system of test group or thymine DNA glycosylase, express, activity, and with control group relatively, wherein said control group is the system of not adding expression Tet dioxygenase or the thymine DNA glycosylase of described candidate substances;

If the transcribing of Tet dioxygenase or thymine DNA glycosylase in the test group, express, activity is higher than control group statistically, shows that then this candidate substances is the potential material that promotes the DNA demethylation; If the transcribing of Tet dioxygenase or thymine DNA glycosylase in the test group, express, activity is lower than control group statistically, shows that then this candidate substances is to suppress the potential material of DNA demethylation.

17. a method of screening TET dioxygenase active regulator comprises:

(1) processes DNA with the Tet dioxygenase, do not add or add candidate substances;

(2) detect the 5caC level;

Wherein, if described candidate substances can reduce the 5caC level statistically, show that then this candidate substances is the inhibitor of TET dioxygenase; If described candidate substances can increase the 5caC level statistically, show that then this candidate substances is the promotor of TET dioxygenase.

18. method as claimed in claim 17 is characterized in that, when processing DNA with the Tet dioxygenase, also comprises adding ATP, Fe2+ and/or 2-oxoglutaric acid; Or adding can form ATP, Fe ²⁺And/or the material of 2-oxoglutaric acid.

19. a method of screening the TDG active regulator comprises:

(1) processes DNA with TDG, do not add or add candidate substances;

(2) detect the 5caC level;

Wherein, if described candidate substances can increase the 5caC level statistically, show that then this candidate substances is the inhibitor of TDG; If described candidate substances can reduce the 5caC level statistically, show that then this candidate substances is the promotor of TDG.

20. method as claimed in claim 19 is characterized in that, when processing DNA with TDG, also comprise adding Tet dioxygenase or Gadd45a, or both adds simultaneously.

21. method as claimed in claim 4 is characterized in that described processing DNA refers to cross DNA in the expression aftertreatment cell in cell, or at the external DNA that directly processes.

Images