CN115772502B - MDCK cell strain with deletion of sialyltransferase gene, construction method and application - Google Patents

Abstract

The invention provides a MDCK cell strain with a sialyltransferase gene deletion, a construction method and application thereof. Compared with the original MDCK cells and the constructed MDCK-st3gal2KO cells, the MDCK-st3gal1KO cells and the MDCK-st3gal KO cells constructed by the CRISPR-Cas9 gene editing method can improve the sensitivity to human influenza viruses.

Description

MDCK cell strain with deletion of sialyltransferase gene, construction method and application

Technical Field

The invention relates to the technical field of cells, in particular to an MDCK cell strain with partial sialyltransferase gene deletion, a construction method and application thereof.

Background

At present, MDCK cells are widely used for separating, culturing and purifying various respiratory enteroviruses. MDCK cells are passaged cells from normal canine kidney and are isolated from kidney tissue of the koxaban dogs by Madin and Darby. MDCK cells can form tightly connected proteins when cultured on a culture plate, can form a compact single cell layer, and simultaneously have the characteristic of contact inhibition.

However, natural MDCK cells have relatively low sensitivity to respiratory enteroviruses and require engineering studies.

Disclosure of Invention

Based on the above, it is necessary to provide a MDCK cell strain with partial sialyltransferase gene deletion, and a construction method and application thereof, which can significantly improve the sensitivity to respiratory enteroviruses such as human influenza viruses.

The invention adopts the following technical scheme:

the invention firstly relates to a strain sialyltransferase gene knockout MDCK-st3galKO cell strain. In particular to a MDCK cell strain with a deletion of a sialyltransferase gene st3gal1, and the preservation number is C2022178.

The construction method of the MDCK cell strain with the deletion of the sialyltransferase gene st3gal1 adopts a CRISPRCas 9-based gene editing system to knock out the sialyltransferase gene st3gal1 in the MDCK cell, and the target sequence is as follows: GCCCGTACCAGGACTCTCGG.

In some of these embodiments, the crna vector plasmid employed by the crispcas 9 gene editing system is pX330 with a gRNA backbone, cas9 expression sequences, NLS nuclear localization sequences, and an anti-ampicillin gene, and the homology arm vector plasmid selects pY75 with multiple adjacent common cleavage sites, loxp fragments, and puromycin resistance genes.

In some of these embodiments, the gRNA sequence of the targeted knockout gene st3gal1 is shown in SEQ ID NO.1 and SEQ ID NO. 2. The 5' homologous arm sequence is shown as SEQ ID NO. 5; the 3' homology arm sequence is shown as SEQ ID NO. 6.

In some of these embodiments, puromycin screening conditions employed in the construction process are: the concentration of puromycin solution is 6 mug/mL; and/or the electrical transfer process conditions are: single pulse, pulse voltage 110v, pulse width 25ms.

The invention also provides an MDCK cell strain with deletion of both sialyltransferase genes st3gal 1 and st3gal 2, and the preservation number is C2022131.

The MDCK cell strain with the st3gal gene deletion is preserved in China center for type culture collection (China center for type culture Collection) at 5.16 of 2022, and eight paths of No. 299 university of Wuhan in Wuchang district of Wuhan, hubei province, post code 430072 and telephone 027-68752319.

The invention also provides a construction method of MDCK cell strains deleted by both sialyltransferase genes st3gal 1 and st3gal 2, which comprises the following steps: obtaining MDCK cell strains deleted in sialyltransferase gene st3gal 1; shearing puro sequences by using a Cre-loxP system; the CRISPR Cas9 gene editing system was further used to knock out the sialyltransferase gene st3gal 2 in MDCK cells.

In some of these embodiments, the gRNA sequence of the targeted knockout gene st3gal 2 is shown in SEQ ID NO.7 and SEQ ID NO. 8; the 5' homologous arm sequence is shown as SEQ ID NO. 11; the 3' homology arm sequence is shown as SEQ ID NO. 12.

The invention also provides the application of the MDCK cell strain with the deletion of the sialyltransferase gene st3gal1 or the MDCK cell strain with the deletion of both the sialyltransferase genes st3gal1 and st3gal2 in the culture of influenza viruses.

Compared with the prior art, the invention has the beneficial technical effects that:

the invention successfully obtains the MDCK-st3gal1KO cell strain and the MDCK-st3gal 3 KO cell strain with the st3gal1 and st3gal2 genes knocked out by the CRISPR-Cas9 gene editing method, and the sensitivity of the MDCK-st3gal1KO cell strain and the MDCK-st3gal KO cell strain to human influenza virus is obviously enhanced through verification.

Drawings

FIG. 1 is a map of plasmid pX330 as a gRNA vector.

FIG. 2 is a map of the homology arm vector plasmid pY 75.

FIG. 3 is a sequencing diagram of the PCR products of the gRNA plasmid of example 1.

FIG. 4 is a diagram showing the PCR nucleic acid electrophoresis verification during construction of the homology arm vector plasmid in example 1; lanes 1, 2, 3, and 4 represent the gRNA25 'homology arm, the gRNA23' homology arm, the gRNA15 'homology arm, and the gRNA23' homology arm, respectively.

FIG. 5 is a schematic representation of 5' homology arm cleavage ligation in example 1.

FIG. 6 is a diagram showing the cleavage assay of pY75+5' homology arm plasmid in example 1; wherein, the graph a shows the bacterial liquid PCR result, wherein, the released 1500bp band is positive, and the released 500bp band is negative; panel b shows the result of plasmid restriction enzyme verification, wherein the homology arm band releasing 1000bp is positive.

FIGS. 7, 8 and 9 are each a 5 'homology arm sequencing alignment plot of the pY75+5' homology arm plasmid of example 1.

FIG. 10 is a schematic representation of 3' homology arm cleavage ligation in example 1.

FIG. 11 is a diagram showing the cleavage verification of pY75+5'+3' homology arm plasmid in example 1; wherein, the graph a shows the bacterial liquid PCR result, wherein the band of 1300bp is released positively, the band of about 250bp is negative, and the graph b shows the enzyme digestion verification result, wherein the band of 1000bp of homology arm is released positively.

FIGS. 12, 13 and 14 are all 3' homology arm sequencing alignments of pY75+5' +3' homology arm plasmids of example 1.

FIG. 15 is a statistical chart of cell viability for 5-7 days in the puromycin cell killing experiment of example 1.

FIG. 16 is a graph showing the state of cell growth at the sixth day at different puromycin concentrations in example 1.

FIG. 17 is a graph showing the growth of cells under different electrotransfection conditions in example 1.

FIG. 18 is a flow chart of limiting dilution screening in example 1.

FIG. 19 is a full length PCR verification of the genome of example 1.

FIG. 20 is a diagram showing the verification of genome-localized PCR in example 1.

FIGS. 21, 22 and 23 are alignment diagrams of positional PCR product sequencing in example 1.

FIG. 24 is a graph showing the growth of MDCK-st3gal1KO cells in example 1.

FIG. 25 is a graph showing the results of Q-PCR of MDCK cells and MDCK-st3gal1KO cells in example 1.

FIG. 26 is a sequencing diagram of the PCR products of the gRNA plasmid of example 2.

FIG. 27 is a diagram showing the result of PCR nucleic acid electrophoresis of 5' -homologous arm joining bacteria in example 2.

FIGS. 28 and 29 are diagrams of the pY75+5' homology arm sequence alignment in example 2.

FIG. 30 is a diagram showing the result of PCR nucleic acid electrophoresis of 3' -homologous arm joining bacteria in example 2.

FIGS. 31, 32 and 33 are graphs of the sequence alignment of pY75+5'+3' homology arms in example 2.

FIG. 34 is a map of genomic mapping PCR validation in example 2; wherein, 1, C4 sample, primer 1 (5' -Puro); 2. c4-like, primer 2 (5' -Puro); 3. e8-like, primer 1 (5' -Puro); 4. e8-sample, primer 2 (5 ' -Puro) 5, F5-sample, primer 1 (5 ' -Puro) 6, F5-sample, primer 2 (5 ' -Puro).

FIGS. 35 and 36 are graphs showing the sequencing alignment of the genomic PCR products of the cells of example 2.

FIG. 37 is a graph showing the growth of MDCK-st3gal2KO cells in example 2.

FIG. 38 is a graph showing the results of full length PCR verification of the genome of the cells in example 3.

FIG. 39 is a graph showing the results of cell genome-localized PCR assay in example 3; wherein, the numbers 1-4 and 5-8 are respectively the 5 'and 3' positioning PCR results of four cell samples A3, A10, C7 and G2, wherein the 5 'positioning PCR positive band is 1288bp, and the 3' positioning PCR positive band is 1340bp.

FIG. 40 is a graph showing the results of Q-PCR in example 3.

FIG. 41 is a graph showing the growth of MDCK-st3galKO in example 3.

FIG. 42 is a statistical chart of the hemagglutination experiments of MDCK cells deleted in three genes in example 4.

FIG. 43 shows the results of a flow pattern of the binding of cytosolic lectin to biotin of three cells MDCK, MDCK-st3gal1KO and MDCK-st3gal KO in example 5; wherein, the upper and lower images are respectively the average fluorescence intensity flow type result of alpha-2, 3 sialic acid+MAL-II+PE labeled avidin (red) and the average fluorescence intensity flow type result of alpha-2, 6 sialic acid+SNP-FITC (green fluorescence), and the MDCK cells, the MDCK-st3gal1KO cells P92, P97, P102, P107 and the MDCK-st3galKO cells P101 are respectively from left to right.

FIG. 44 is a statistical plot of the average fluorescence intensity results for sialic acid expression in three different generations of MDCK, MDCK-st3gal1KO, MDCK-st3gal KO cells of example 5; wherein a represents the average fluorescence intensity of α -2, 3-sialic acid+MAL-II+PE labeled avidin (red), b represents the comparison of the average fluorescence intensity of α -2, 6-sialic acid+SNP-FITC (green fluorescence), the two horizontal axes represent 1 (MDCK P72), 2 (MDCK-st 3gal1KO P92), 3 (MDCK-st 3gal1KO P97), 4 (MDCK-st 3gal1KO P102), 5 (MDCK-st 3gal1KO P107), 3 (MDCK-st 3gal KO P101) P <0.05, P <0.01, < P <0.001, < P < 0.0001), and no significant difference ns exists between the different generations of MDCK-st3gal1 cells, respectively.

FIG. 45 is a diagram showing the difference in genome sequencing in the examples.

FIG. 46 is a volcanic diagram of a transcription set differential gene in an embodiment.

FIG. 47 is a functional enrichment analysis of transcription group GO in the examples.

FIG. 48 is a transcription set KEGG functional enrichment assay in the examples.

FIG. 49 is a comparison of the expression differences of the transcription sets on st3gal1 and st3gal2 in the examples.

Detailed Description

The present invention will be described in further detail with reference to specific examples so as to more clearly understand the present invention by those skilled in the art.

The following examples are given for illustration of the invention only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art without creative efforts are within the protection scope of the present invention based on the specific embodiments of the present invention.

In the examples of the present invention, all raw material components are commercially available products well known to those skilled in the art unless specified otherwise; in the embodiments of the present invention, unless specifically indicated, all technical means used are conventional means well known to those skilled in the art.

It is worth first describing that the study shows that: cell surface sialic acids are divided into α -2, 3-sialic acid and α -2, 6-sialic acid. Genes regulating α -2, 3-sialyltransferase synthesis are the st3gal gene family, including st3gal1, st3gal2, st3gal3, st3gal 4, st3gal 5, st3gal6, and st3gal 2-like. Genes regulating the synthesis of alpha-2, 6-sialyltransferase are the st6gal family, including st6gal 1 and st6gal2.

Key test materials and test methods:

and (3) cells: MDCK cells, ATCC introduction, MDCK CCL-34, P57.

Virus: all three are NIBSC introductions. Virus H1N1: from the H1N1 (IVR 215) working seed pool, stored in the institute of wuhan biologicals viral vaccine study two, lot number: 202103W01H1. Virus BV: BV (BVR-11) working seed pool, stock in the institute of Sichuan-Biotechnology viral vaccine study two-house, lot: 202103W01BV. Virus BY: from BY (BVR-1B) working seed stock, stored in the institute of Sichuan biologicals viral vaccine study two, lot number: 202103W01BY.

VP-SFM medium was purchased from Gibco company under the trade designation: 12559019; fetal bovine serum was purchased from Gibco company under the accession number: 16140071; TPCK-trypsin was purchased from Sigma company.

Preparation of complete medium: under aseptic conditions, 5% FBS/NBS was added to VP-SFM medium and stored at 4℃for further use. If the storage time exceeds three months after the preparation of the culture medium, 1% glutamine additive is added.

Preparation of monoclonal cell culture medium: mixing VP-SFM serum-free culture medium and 24h cell culture solution at 1:1 under aseptic condition, centrifuging at 1500rpm for 5min to remove cell debris, filtering with 0.22 μm filter membrane to remove impurity components, and keeping at 4deg.C for use, wherein if resistance screening is required, screening antibiotic with certain concentration is added before use (after adding screening antibiotic, the mixture is prepared and is not suitable for long-term preservation).

Preparation of cell maintenance solution: under aseptic conditions, 2. Mu.g/mL of TPCK pancreatin was added to VP-SFM medium (prepared immediately after addition of TPCK pancreatin, and it was not preferable to preserve for a long period of time).

Preparing cell frozen stock solution: preparing the cell frozen stock solution according to the following proportion under the aseptic condition according to the total volume of the frozen stock solution required during cell freezing: 70% VP-SFM+20% FBS+10% DMSO, and is ready to use.

Phosphate Buffered Saline (PBS) has a normal pH in the range of 7.2 to 7.4.

MDCK cell growth curve drawing: digesting the cells in the culture flask into cell suspension according to the above steps, counting the cells according to the above steps, and diluting the cell suspension to a density of 1×10 according to the counting result ⁵ Per mL, the diluted cell suspension was added to T25 (5 mL per bottle, the total amount of starting cells was 5X 10) ⁵ /flask), at least 30T 25 flasks were incubated at 37 ℃. Counting cells every 12h, counting two T25 s according to the method, recording data to calculate average value if the two bottles of counting results differ by less than 10%, if the two bottles of counting results differ by more than 10%,then a further T25 is taken for counting and analysis is performed based on the counting results of the three flasks. The cells were counted continuously for 7 days (168 h), and based on the result of each cell count, the viable cell density (. Times.10) was measured on the abscissa of hours (h) ⁵ /mL) is plotted on the ordinate as a cell growth curve.

gRNA vector plasmid: as a gRNA vector plasmid, a CRISPR-Cas9 system specific mammalian cell expression vector pX330 with a gRNA backbone, cas9 expression sequence, NLS nuclear localization sequence, and an anti-ampicillin gene was selected, the map of which is shown in fig. 1.

Homology arm vector plasmid: pY75 with multiple adjacent common cleavage sites, loxp fragment and puromycin resistance gene was selected as a homology arm vector plasmid, the map of which is shown in FIG. 2.

Plasmid, DNA, RNA extraction kit were purchased from Takara company. Tool enzymes for the cleavage enzyme ligation experiments were purchased from NEB.

Construction of the gRNA vector plasmid: two single strands were synthesized from the designed gRNA sequence in the form:

5′-CACCGNNNNNNNNNNNNNNNNNNNN-3′(Oligos 1)

3′-CNNNNNNNNNNNNNNNNNNNNCAAA-5′(Oligos 2)

after obtaining the above Oligos, the phosphorylation and annealing were carried out according to the following system:

gRNA phosphorylation and annealing system

Volume of	Component (A)
		1μL	oligo1(100μM)
1μL	oligo 2(100μM)
		1μL	10×T4 Ligation Buffer
6.5μL	ddH 2 O
		0.5μL	T4 PNK (phosphokinase)
10μL	total

The PCR reaction is carried out according to the system, and the specific procedures are as follows: 37 ℃ for 30min;95 ℃ for 5min; the reaction is carried out at a temperature of 5 ℃ per minute, and the final temperature is 25 ℃; preserving the temperature at 25 ℃ and diluting the reaction solution 250 times for later use

The cleavage and ligation reaction system for PX330 (gRNA vector plasmid) is shown in the following Table:

PX330 enzyme cutting and connecting one-step system

Volume of	Component (A)
		XμL	pX330(100ng)
2μL	Reaction solution diluted by 1:250
		2μL	10× Tango buffer
1μL	DTT(10mM)
		1μL	ATP(10mM)
1μL	Bbsl
		0.5μL	T7 DNA ligase
YμL	ddH 2 O
		20μL	Total

The PCR reaction is carried out according to the system, and the specific procedures are as follows: 37 ℃ for 30min;23 ℃ for 30min; 4-degree preservation.

After extracting MDCK cell genome, obtaining 5 'and 3' homology arms by PCR respectively, performing enzyme digestion on the 5 'or 3' homology arms and a pY75 plasmid containing the same enzyme digestion site, and incubating overnight at 37 ℃ by using a NEB enzyme digestion system (the enzyme digestion sites are relatively close, so that the enzyme digestion is ensured to be sufficient overnight); purifying the enzyme digestion product by using a PCR purification kit; performing enzyme-linked reaction (blank control) according to a corresponding system of T4 DNA ligase, and performing enzyme-linked incubation at 16 ℃ overnight; a small amount of enzyme-linked product is transformed into about 100 mu L of TOP10 competent cells, the cells are placed on ice for 30min, then the cells are transferred into a water bath at 42 ℃ for 1min, an ice bath for 5min, 800 mu LLB liquid culture medium is added for shaking at 37 ℃ for 1h, and 150 mu L of LB-coated solid plates are taken.

The successfully identified plasmid carries out large endotoxin removal extraction (using a large endotoxin removal extraction kit), so that no endotoxin is ensured to avoid damage to cells by transfection, and the large extraction plasmid has high concentration, thereby being beneficial to improving the transfection efficiency.

Cell electrotransformation: since MDCK cells have not been performed before in the laboratory, the relevant electrotransformation experiments, the electrotransformation conditions of the cells, in particular the parameters of the electrotransformation apparatus, have to be explored. In order to avoid pollution caused by the electric rotating cup, the electric rotating cup after cleaning is firstly placed in absolute ethyl alcohol for soaking for 6-8 hours. Before electric rotating, the electric rotating cup is placed under ultraviolet irradiation for sterilization for 1h, and air-dried for 1h under aseptic condition, so that the residual ethanol in the electric rotating cup is volatilized, and the electric rotating cup is preserved under aseptic condition at 4 ℃ for standby. VP-SFM complete medium 2 mL/well is added into a 6-well cell culture plate, the cell culture plate is placed into a 37 ℃ incubator for preheating for standby, and in order to avoid pollution caused by plasmids, 1:1000 double antibodies are added into each well. Cell concentration was recorded according to the experimental procedure of cell counting, the volume of the cell suspension taken was calculated according to the total amount of cells required for electrotransformation, centrifuged at 1500rpm for 5min, the supernatant was discarded, the cell pellet was collected, and a quantitative serum-free medium was added. The total cell amount in each electrotransformation system was 1X 10 with serum-free medium ⁶ After the cells were resuspended at a system volume of 0.2 mL/mL, the gRNA vector plasmid and the homology arm vector plasmid were added thereto, each 8. Mu.g/system, and the cell suspension was gently blown and mixed for use. Setting the electric rotating voltage intensity, pulse width and pulse times, taking 0.2mL of cell suspension, lightly adding the cell suspension into a groove between two electrode plates of an electric rotating cup, fully mixing the cell suspension before sucking, covering the electric rotating cup without cell precipitation, and starting electric rotating. After the electric transfer pulse procedure is completed, 180 mu L of cell suspension after electric transfer is sucked into the groove each time, three holes in the six-hole plate are added with 60 mu L of cell suspension in each hole, the cells in the culture plate are mixed evenly by gentle blowing, and the culture plate is placed in a incubator at 37 ℃ for culture.

Monoclonal cell screening and genome PCR identification, comprising the following steps: and (3) carrying out puromycin cell primary screening results and monoclonal cell rescreening by a limiting release method according to the optimized parameters of the puromycin cell killing experiment and the optimized electrotransformation parameter conditions, and then carrying out monoclonal cell identification.

Wherein, the puromycin cell primary screening comprises the following steps: after electrotransformation is completed, the growth condition of the cells is closely observed, and as the electroporation of the cell surface during electrotransformation causes the gradual death of part of the cells, the observation under a six-hole plate lens in the next day can find that part of the cells float after apoptosis, and the liquid change is needed when the adherent cells grow to 60% confluence. The six-hole plate is changed once every 2-3 days, and most cells can be found to gradually stop growing and falling off after observation under a lens. Puromycin resistant cells were observed to form small clusters of single cells or 2-3 cells under approximately day 5-7, and the number of clones of cells was progressively increased as seen with continued selection of culture.

The step of rescreening the monoclonal cells by the limiting release method is as follows: after the cells were cultured for 7 to 10 days, the six-well plate was observed for the occurrence of monoclonal cell growth into cell clusters, the number of medium monoclonal cell clusters in a single cell well was counted, and the medium was discarded and sufficiently digested. Cell counts were performed on the digested cell suspensions, and limiting dilutions were performed to 96-well plates after calculation of the total cell mass. The growth of the monoclonal cells was closely observed daily after limiting dilution, and observed under a 4-5 day rear mirror, labeling wells containing only a single monoclonal cell mass. Under normal conditions, the monoclonal cells can grow into cell holes of a 96-well plate in 10-14 days of culture, after the cells grow into the cells, the cells are passaged to a 24-well plate for expansion culture, the cells are sequentially expanded to two 6-well plates, one part of the cells are continuously cultured for seed preservation, and the other part of the cells are extracted from a genome for PCR identification.

The identification of monoclonal cells comprises the following steps: after carrying out cell digestion on a six-hole plate to be identified, extracting MDCK cell genome, and respectively designing two pairs of primers to identify monoclonal cells: firstly, respectively designing upstream and downstream primers at the positions of a 5 'homologous arm and a 3' homologous arm of a target gene (or designing primers at the upstream of the 5 'homologous arm and the downstream of the 3' homologous arm), wherein the distance between the binding position of the primers and a gRNA binding site is more than 100bp, and the full-length PCR designed by the method can simultaneously identify different types of monoclone of negative, single allele knockout and double allele knockout; secondly, two sets of upstream and downstream primers are respectively designed on the 5 '-homologous arm sequence and the puromycin resistance gene sequence or the resistance gene sequence and the 3' -homologous arm sequence, so that the designed positioning PCR is used for further confirming the cloning position so as to eliminate the interference of residual plasmids and off-target sites in cells, and the result is difficult to obtain due to the fact that the full-length PCR fragment is too long, therefore, the positioning PCR is mainly used. The PCR reaction system adopts a high-fidelity enzyme system, can be used for subsequent sequencing of PCR products and electrophoretic analysis of the PCR products, and corresponding positive clones (single knockout or double knockout) are subjected to passage amplification and cryopreservation, and cell samples are taken after passage to extract DNA and the PCR detection is repeated. Subsequent expression and functional identification of the final positive clones were performed.

Construction of a Cre-Loxp system and cutting of a Loxp tag: because the homologous arm vector plasmid (pX 75) contains the puromycin resistance gene sequence with Loxp at two sides between two homologous arm sequences in the plasmid, if the puromycin resistance is to be recycled on the basis of gene knockout for cell screening, firstly, the knocked-in Loxp-Puro-Loxp sequence is removed to ensure that cells lose the original puromycin resistance. Wherein the Cre recombinase expression sequence is located on a plasmid pY48 which is a special tool for Cre-loxP system.

The specific test steps are as follows: the edited cells which have been subjected to puromycin selection are electrotransferred into a pY48 plasmid, the specific electrotransfer mode is the same as above, the pY48 plasmid is greatly extracted by removing endotoxin, and the plasmid concentration in the electrotransfer system is kept at 8 mug/mL. The cells are normally cultured after liquid change in the next day after electrotransformation without any antibiotics screening, and the confluence of the cells can reach more than 60% after 3-5 days because the cells are adapted to the environment after the cells are normally grown for 3-5 days. Cells were limiting diluted to 96-well plates, wells of single cells were identified, and monoclonal cell cultures were performed. After 1-2 weeks, when the monoclonal cells in the 96-well plate grow to the confluence degree of more than 80%, dividing each well into two wells, normally culturing one well, and adding puromycin with a certain concentration into the other well for screening. And observing the cell holes which are screened by adding puromycin, observing in one-to-one correspondence, and after one week, completely dying the cells in the screening holes, wherein the cell sample of the normal growth of the cells in the original holes is positive cells, and extracting genome for carrying out positioning sequencing verification after expanding culture and preservation.

EXAMPLE 1 construction of st3gal1KO cell lines deleted for st3gal1 Gene

This example provides a method for constructing a st3gal1KO cell line with a deletion of a st3gal1 gene, comprising the steps of:

s1, designing and evaluating the gRNA sequence:

downloading the gene sequence of st3gal1 from NCBI (Gene ID: 482050), discarding Exon1 which is a multiple of 3 in the st3gal1 gene, designing gRNA for the Exon2 sequence in the st3gal1 gene:

according to the evaluation specificity S, the literature citation ratio A and the score of the cutting efficiency E of the webpage, performing preliminary screening on gRNA to obtain five gRNA sequences related to EXON2, and performing off-target evaluation on off-target sites, wherein the specific evaluation is shown in the following table:

assessment of gRNA off-target properties of st3gal1KO cells

gRNA numbering	Potential off-target sites	Sense off-target site	PAM sequence alignment	Off-target risk site	E scoring
						2-1	206	97	52	17	72.956
2-2	190	82	41	4	70.791
						2-3	188	83	43	9	66.096
2-4	177	46	25	5	60.178
						2-5	161	64	34	1	56.072

The pair gRNA sequences were designed according to table 2 above:

gRNA1：5'-CACCGCCCGTACCAGGACTCTCGG-3'(SEQ ID NO.1)

3'-CGGGCATGGTCCTGAGAGCCCAAA-5'(SEQ ID NO.2)。

gRNA2：5'-CACCGAAGATGAAGAGGACGAGGA-3'(SEQ ID NO.3)

3'-CTTCTACTTCTCCTGCTCCTCAAA-5'(SEQ ID NO.4)。

NCBI-blast localization verification was performed on two pairs of gRNAs:

gRNA1 locates chromoname 13, canFam3.1, 29863779-29863798, blast match rate 100%.

gRNA2 locates chromoname 13, canFam3.1, 29871706-29871725, blast match 100%.

It was shown that both pairs of gRNA sequences are expected to be 100% localized at the target site of the target gene.

S2, sequencing the constructed gRNA vector plasmid:

The gRNA vector plasmid was constructed according to the procedure described above.

The gRNA related sequencing primer was designed as follows:

gRNA forward primer：ggcctatttcccatgattcc；

gRNAreverse primer：cttgatgtactgccaagtgg。

since the inserted gRNA sequence in the gRNA construction plasmid is too short, the detection by nucleic acid electrophoresis is difficult to identify, and thus the sequencing of the plasmid PCR product is directly carried out, and the sequencing results are shown in FIG. 3 and the following table:

sample numbering	Sequence matching rate
		pX330-1	100% (accord with)
pX330-2	100% (accord with)
		pX330-3	Failure of sequencing
pX330-4	10% (disagreement)
		pX330-5	100% (accord with)
pX330-6	100% (accord with)
		pX330-7	15% (disagreement)
pX330-8	100% (accord with)

As can be seen from the above table, 5 of the 8 samples were perfectly matched, indicating successful construction of the gRNA vector plasmid. And (5) selecting and greatly extracting the pX330-1 plasmid for later use.

S3, sequencing the constructed homology arm vector plasmid:

the homology arm vector plasmid was constructed according to the procedure described above.

The 1kbp sequence with about 30bp on both sides of gRNA is designed as a homologous arm sequence, the space of a reserved primer expands the homologous arm to 1.2kbp, and the sequences at both ends are the homologous arm sequences, and the specific sequences are as follows:

5' homology arm sequence:

5’cctggtgggcctctccctcggagacctgattccttccatctcggggccgggggtgctgcctgcctctggatctccccatagaccccatcacgaatctcctggacggtggtcaaagcaggccctaggctatcctttcttttctcagccactcagccctgggccagggggctgggagaggctagtgagactcaccccacagccaacctccccacccgtgaccccccaccccggcccctacaaccccatggactgggctttctgaaaggtcaaggttccaagggtctgagatgggggcagtattgtgggagagactttgaggtgggtttctaaaagcctgggttcaaatcctggtttgggatttgggacctgtggttcagccagcccgggccccagagcatcctcctcgtccacagttcagatgtggtgtggtatagatgttgcggcacggcgacggggtcagaggtgataactgcttaggaaatgtctccaggttttaccgtgagtgaggaggtgggaagtctggagctaggtcttcaaggatgaaaacagtttgccaggcagacatcggaggccttgtgcatccagcaaagggctggttttttggtcttgctggagcccagtggtcccctgggaggagtggcgggggcaggaggatggagggagcagaagcagggaggtgggctcagaggtcacctgacccttctcctatcacccgatgtcattgcctccggctgatggaggagctagcacatagtaggtgctcaataagcctttgcagaatgagtgagggagctctctcccgtctcctggagtgggccctgggcttctggaccagcggggaggtggctggctgagcctcctggggcctccggcgccttgcagaagggaaggtactggagaagggggcccagggagggggctcaggggccccggccagaggcagcacagcccggctgacctttctccttccaccctccgcccgcagaggctccagcgggagaagcaacc 3’(SEQ ID NO.5)

3' homology arm sequence:

5’caggtgagcgcctggagcccctcggagccgcgggaggcgcctgggctcagggccaggagggcaagacccagtcctagcaggcctagactccccttcggaccttgggggctccctgtgggcctcagtttccccatctgtgcattataggaaggaggtagaccagcagtgcctctctggaccccgatgggagaccataaacgggaggaagccagcaggtcgggagctttgcacagagaggcctggagggagggcaagaggcagttgcagacccttgtctgatctttaaaattcagccccattttgcaacctaggctgtaataaaactatgtgcttttaatgtaaatgcatttccctgtcaccaaggagaatagtttccctgggaagagatgtattctgggtttcttataatctccacgctgttcactcagtagtgaggccgctgctccccaggcaccttctagaatagtctcctgtctctgcgatctctgcatttatgtccttagactgctctcacccggcttctcggagcctccgtgtgcccggcgtgcggcaggaacatccgtgggggagggaaagcatcgggtcccaggtcagacagacctgagttcaaggctgcacacttgccagctccgtgtcctgggactaattcttggcgttcagatttctcccatcatagaataggaccagagaatacctcccgggcgcagtcatcattcggatgtaatgaggcgcgcctcttggccaggacggggccttgcgcacagtaggtcagcaggagtggccacggtcaggctcgctccagagcgcgtaagagatggaaagcagcaagagcatttgagctgtgtcctgatcgtctccatcgaagccgcccccttgcgacgtgatgcgatgcgtgtcccgctgtcccttccctcccaggatgaacaaggcccccacggcgggcttcgagatggatgtcgggagcaagaccacccaccacctggtgtaccccgagagcttcagggagctggcggagaatgtcagcatggtcctggtgcccttcaagaccaccgacctggagtgggtggtcagtgccaccaccacaggcaccatctctcagtgagtccccggggtggagagcccccacgccctcactggtcctccgtgcccccaccatgtggtgcccgcaccaggatgcctcccccgctggacttccttctg 3’(SEQ ID NO.6)

among the 5' homology arms are available cleavage sites: ecoRI, claI, ecoR V; the available cleavage sites for the 3' homology arm are: sall, accI, hincI, bglII, bamHI, hindIII. Since the 3' homology arm contains AccI, the cleavage specificity is maintained in order to avoid the homotail enzyme and the same cleavage site before and after. The experimental design results are as follows: 5' cleavage site: ecoRI, ecoRV; 3' cleavage site: bamHI and HindIII are connected in the sequence of 5 'homology arm-3' homology arm.

The two ends of the homology arm designed above are added with proper enzyme cutting sites and corresponding protecting bases, and PCR nucleic acid electrophoresis verification is carried out by using primers of enzyme cutting sites and protecting bases, and the result is shown in the following figure 4: positive homologous arm bands appear at about 1000bp

Homology arm PCR nucleic acid electrophoresis showed that homology arm PCR on MDCK cells released a band of approximately 1 kbp. Consistent with the design, both 5 'and 3' homology arms were obtained by PCR.

The cleavage reaction was performed according to the 5 'homology arm cleavage ligation scheme shown in FIG. 5 to construct a pY75 plasmid containing a 5' homology arm. Thus, plasmid pY75+5' homology arm is obtained by transformation of shake bacteria and plasmid miniprep, and the results of bacterial liquid PCR and enzyme digestion verification are shown in FIG. 6. The graph a shows the bacterial liquid PCR result, wherein the released 1500bp band is positive, and the released 500bp band is negative. Panel b shows the result of plasmid restriction enzyme verification, wherein the homology arm band releasing 1000bp is positive. And (3) obtaining bacterial liquid PCR of the samples 1 and 4, and performing enzyme digestion verification to positive, and performing sequencing verification in the next step. Sequencing validation results are shown in figures 7 to 9 for 5' homology arm sequencing alignment.

Further, the cleavage reaction was performed according to the 3 'homology arm cleavage ligation scheme shown in FIG. 10, to construct a pY75 plasmid containing a 3' homology arm, designated pY75+5'+3' homology arm. The bacterial liquid PCR and the enzyme digestion test are shown in FIG. 11 (a graph shows the bacterial liquid PCR result, wherein the band of 1300bp is released positively, the band of about 250bp is negative, b graph shows the enzyme digestion verification result, wherein the band of 1000bp of homologous arm is released positively), and the results show that the bacterial liquid PCR verification and the enzyme digestion verification of the plasmid with only the sample No. 3 are positive.

FIGS. 12 to 14 for 3' homology arm sequencing alignment show low probability of occurrence of mismatched bases and substantial identity of the remaining sequences, and the occurrence of identical mismatched bases from different sample sequencing can be considered as a base mutation in a cell without affecting experimental accuracy.

S4, transfection and screening to obtain St3gal1 gene knockout cells (MDCK-St 3gal1KO cells):

the MDCK cell survival was investigated by setting 10 concentration gradients of puromycin solution in the range of 0 to 22.5. Mu.g/mL at every 2.5. Mu.g/mL concentration gradient. The results show that: MDCK cells in the control group and the 2.5 and 5 μg/mL experimental groups were partially survived, and the rest were all dead.

Puromycin solution in the range of 3-8 μg/mL was set with a concentration gradient of 0.5 μg/mL, and the experimental results are shown in FIG. 15 (puromycin cell killing experiment 5-7 days cell viability) and FIG. 16 (sixth day cell growth state at different puromycin concentrations): the minimum MDCK cell killing concentration was finally confirmed to be 6 mug/mL (complete cell killing was achieved by day 6).

Three different sets of electric conversion conditions are designed, namely: 100v,25ms;100v,30ms;110v,25ms, all three are single pulses. The growth of cells under different electrotransfer conditions is shown in FIG. 17.

In the three sets of electrical switching schemes designed, the research results show that: the first group (100 v,25 ms) and the second group (100 v,30 ms) still have a certain amount of cells to survive within two weeks, and are mixed with a large amount of cell fragments to be aggregated into clusters, so that the clusters are not easy to distinguish, and a large number of living cells in normal state are observed under a digestive lens, so that the first two electrotransformation conditions are unfavorable for cell monoclonal screening. The third group (110 v,25 ms) was able to kill substantially all cells within a week, facilitating the picking of single cell clones. Therefore, the optimal electric transfer parameter is finally determined to be 110V pulse voltage, 25ms pulse width and single pulse.

MACKA cell monoclonals were screened according to the limiting dilution screening procedure of FIG. 18, 784 single cell wells were obtained, and after two weeks of culture, 13 wells remained after the failure to grow into distinct monoclonal cell clusters were excluded, and subjected to genomic PCR validation.

Verification of DNA level (cell genome PCR) cell genome PCR verification was performed with two primer designs, respectively:

(A) Full length PCR was performed on both the 5 'homology arm and the 3' homology arm, and the results are shown in FIG. 19 (genome full length PCR verification).

PCR product nucleic acid electrophoresis showed: only 9C5 samples had negative (2600 bp) and positive (4000 bp) bands, which were heterozygous mutations.

(B) Primers were designed on the 5' homology arm and puro for cell genome-localized PCR.

The two primers are respectively designed on the upstream of the puromycin resistance sequence and the 5 'homology arm or on the downstream of the puromycin resistance sequence and the 3' homology arm by adopting positioning PCR, the exact position of gene editing can be identified through the display of a nucleic acid electrophoresis band, and if the off-target condition occurs, the band can not occur. The results are shown in FIG. 20 (genome-localized PCR verification). The result of genome positioning PCR verification shows that after secondary limiting dilution of MDCK-9C5 cells, 60 sample holes are obtained for expansion culture, and positioning PCR verification is carried out, wherein 45 samples have positive bands (about 1400 bp). The sequencing of the positioning PCR products is shown in FIGS. 21-23.

S5, drawing a growth curve of st3gal1 gene knockout cells, and the result is shown in FIG. 24 (MDCK cells are compared with MDCK-st3gal1KO cells in growth curve). The cell growth curve shows that the multiplication time of MDCK cells is 26 hours, the time to reach the platform phase is 60 hours, the average density of the living cells at the platform phase is 5.3 multiplied by 105/mL, the multiplication time of MDCK-st3gal1KO cells is 36 hours, the time to reach the platform phase is 72 hours, and the average density of the living cells at the platform phase is 5.2 multiplied by 10 ⁵ /mL。

S6, designing a Q-PCR experiment primer and a probe aiming at the st3gal1 gene, wherein the Q-PCR experiment result is shown in FIG. 25 (Q-PCR of MDCK cells and MDCK-st3gal1KO cells). Wherein WT and KO represent MDCK cells and MDCK-st3gal1KO cells, respectively.

The results show that: Q-PCR results showed a significant reduction in the transcript level of st3gal1 in MDCK-st3gal1KO cells compared to MDCK cells (p < 0.01).

EXAMPLE 2 construction of St3gal2KO cell lines with St3gal2 Gene deletion

This example provides a method for constructing St3gal2KO cell lines deleted for St3gal2 gene, comprising the steps of:

s1, designing and evaluating the gRNA sequence:

downloading the gene sequence of st3gal2 from NCBI (Gene ID: 489714), discarding Exon1 (339 bp) and Exon3 (180 bp) which are multiples of 3 in st3gal2, and designing gRNA sequences on the web page for the sequences of Exon2 and Exon1 in the st3gal2 gene because of the offset of the Exon4 position:

according to the evaluation specificity S of the webpage, the literature citation rate A and the score of the cleavage efficiency E, performing primary screening on gRNA, obtaining five gRNA sequences on Exon2 and Exon1 respectively, and performing off-target evaluation on off-target sites, wherein the specific evaluation is as follows:

assessment of gRNA off-target Properties of St3gal2-KO

gRNA numbering	Potential off-target sites	Off-target risk point	E scoring
				2-1	39	2	75.858
2-2	30	2	66.211
				2-3	12	2	66.149
2-4	27	5	64.621
				2-5	41	1	64.286
1-1	19	4	72.241
				1-2	33	5	58.667
1-3	60	13	57.43
				1-4	48	4	56.339
1-5	14	2	72.334

The pair gRNA sequences were designed according to table 2 above:

gRNA2-1:5’-CACCGTGTTGTGTGACTTGAACTG-3’(SEQ ID NO.7)

3’-CACAACACACTGAACTTGACCAAA-5’(SEQ ID NO.8)。

gRNA1-5:5’-CACCGTGGCTGTCAAACCAGTCAG-3’(SEQ ID NO.9)

3’-CACCGACAGTTTGGTCAGTCCAAA-5’(SEQ ID NO.10)。

NCBI-blast localization verification was performed on two pairs of gRNAs:

gRNA2-1 localization chromoname 5, canFam3.1, 7682917to 7682936, blast match 100%

gRNA1-5 localization chromoname 5, canFam3.1, 76829009 to 76829428, blast match 100%. Both gRNA sequences were able to be 100% localized at the target site of the target gene.

S2, sequencing the constructed gRNA vector plasmid:

after construction of the gRNA vector plasmid, the gRNA related sequencing primer is designed as follows:

gRNAforwardprimer：GGCCTATTTCCCATGATTCC；

gRNAreverse primer：CTTGATGTACTGCCAAGTGG。

since only 20bp of gRNA sequence was inserted into the gRNA construction plasmid, the detection by nuclear electrophoresis was difficult to identify, and thus the sequencing of plasmid PCR products was directly performed, and the sequencing result is shown in FIG. 26.

S3, sequencing the constructed homology arm vector plasmid:

the 1kbp sequence with a distance of about 30bp at two sides of the gRNA is designed as a homologous arm sequence, meanwhile, the space of a reserved primer is considered to expand the homologous arm to 1.2kbp, and the sequences at the two ends are the homologous arm sequences, and the specific sequences are as follows:

5' homology arm sequence:

5’aaaatggggatgatgattacagccctgtgtgagtctcctggggctgccaccacaaagttctacaactgggtgacttaaacaacagaagcgtatttttttgtaattctagaatcaagatcagggtgccatcaaaattggtgtctcgtgagacttctcttcctggcctgcagactggcaccattctgctgcatcctcatgggcccttcttgtctgggtgcactgcgagggctcttcggtgtctcttccttttcttataaggatgattagggccgtactcttatgacctcatcaaacctcagttacctccccataggcccgatctccaaaatacagtcacattgaggtgctgaacaaaagctaggtctctattagtgcttggctggggcttgtcccacattatactgattgggcatttccctgcagcagtgattcctcaattccatctatctttatgtccttggcacttatcccttggcacagaccaggtgctcagaaaacacatttttggaatcctacagtgaaccaggaggcagttaatggcagccaaccagatttggggagccctgagcattgctaacctgccaagacttaaggcatgtcactgtctccaggctccaccttgcaagacaagggttttgcaaatggcaagatttcattctttttatggctgaatagtattccattgtatttctacaaccacatctttctccattcatttattgatggaaaatttggactgcttccataatttggctattgtcaataatgctacactaggtaacctatagaattcttgaattactacattgtgcacctgaaactaatgtaacactgtatattaactacactgaattttttttttttttaaagaaaaaggccaaagattttgccagcaaaatctcatcagattgcattttcgtacagccttttgtggctacaccagggtaactgggcaatcttcaggaccaaaatagactcggattcttttttacaaagatgctgttgtaaacttcaaagtggcagttgtaattctccgaacccctcccagaaatactgtctcccaccaataaagcaccacaatgaccct 3’。(SEQ ID NO.11)

3' homology arm sequence:

5’gtgagaggatgaggtcagagatgtcactaagaccctgggactgaccagtgtatgcagggacaggtgggagcccccagcctctgtcccctttctctccagtctcccacctgcgttcccatgggccacacccaccgcaagccccccggggtgggagcccattgatgcaggccctagggtcagcccgggacacggagcaaggcgggaaagacagagggaaagcccagatgcccagctccccgcctgaacacccccgcccccccaggaaggctcgggtgcacacgttcagggctcctcgacagcagggccaggagaggtggcgccgtgggaggtgcccttctgggggccctgactatgcatcccagcagcgtggcccaggcaggccatgacctcccttagcctgacttggaaacctcaccatgtcataccctgccaggggcttgctgtggcccccagggtgtggcccagcccgccctccagctccattttgcatctttctctctggggttctgctgggcttggccttctctctttcagttccttcggactcacccactcttcccccacagaccttttttgcaccagcagctggcccggaggctcatcttttctgccccgtgacccatctgtcgtgcagacctcaggccattaccacttcctggggacacttgccagctgcagcccatgcccacttccctgtggcactgcaggtggccgttatcagtcagggttcttgagggaaacagaccctacagaataggcgtacacatattcaggaattggcttaagtgttgtgggactggcaacttcaaaatccatagggctggatggcaggctgtaaactcaggcaggattagatttctctgttacggtgctgagatgaaattccctctcctggaagcctctgtttccttcgcacctagggccttcaactgattagatgaggcccacccacattttggaggataatctcctttacttcatggcaaccacatctataaaaatgccttcacggccacacctagactagcatttgaccaagcatccgggtgccatggcctagctgagtcgactcatggatgtgatccatctcagcctttcttaattct 3’。(SEQ ID NO.12)

PY75 cleavage site selection. 5' cleavage site: ecoRI, ecoRV; 3' cleavage site: salI and HindIII are connected in the sequence of 5 'homology arm-3' homology arm.

According to the selection of homologous arm sequences and enzyme cutting sites, the primer design scheme for obtaining 5 'and 3' homologous arms after adding the protective base of the corresponding enzyme cutting site is as follows:

primer name	Sequence(s)	Cleavage site
			5up primer	CGGAATTCATAGCAGCCTGCCTGCAACG	EcoRⅠ
5down primer	GGGATATCCGCTGCAGACCAGCATAGCC	EcoRV
			3up primer	ACGCGTCGACTGGGAGTCACTCTTCAAGCC	SalI
3down primer	CCCAAGCTTAAGCTCCAGGCTGTTACAGG	HindⅢ

After the enzyme digestion and enzyme ligation reaction, a pY75 plasmid containing a 5' homology arm can be constructed, and a plasmid containing pY75+5' homology arm can be obtained by transformation of rocking bacteria and plasmid miniextraction, and the bacterial liquid PCR result is shown in FIG. 27 (the result of PCR nucleic acid electrophoresis of the 5' homology arm ligation bacterial liquid). The result of pY75+5' homology arm sequence sequencing alignment is shown in FIGS. 28-29, and the sequence alignment is consistent.

Further, the ligation reaction was continued to construct pY75+5'+3' plasmid containing 3 'homology arm, and the result of bacterial liquid PCR was shown in FIG. 30 (result of PCR nucleic acid electrophoresis of 3' homology arm ligation bacterial liquid). The pY75+5'+3' homology arm sequence sequencing alignment results are shown in FIGS. 31-33.

S4, transfection and screening to obtain St3gal2 gene knockout cells (MDCK-St 3gal2KO cells):

transfection and screening were performed as in example 1. Finally, all 30 sample wells in the six-well plate are diluted to 96-well plate at the limit, 3 strains which are not grown into obvious monoclonal cell mass are removed after two weeks of culture, and cell genome PCR verification is carried out on the cells.

Verification of DNA level (cell genome PCR) cell genome PCR verification was performed with two primer designs, respectively: the two primers are respectively designed on the upstream of the puromycin resistance sequence and the 5 'homology arm or on the downstream of the puromycin resistance sequence and the 3' homology arm by adopting positioning PCR, the exact position of gene editing can be identified through the display of a nucleic acid electrophoresis band, and if only the off-target condition occurs, the band can not occur. The results are shown in FIG. 34 (genome-localized PCR verification). In the positioning PCR verification, two pairs of primers are designed, and 5' positioning PCR verification is carried out on three cells of C4, E8 and F5.

As can be seen from the results, in the system of the primer 2, the number of the mixed bands is small, the positive bands are obvious (2600 bp), the positive bands appear on three cells of C4, E8 and F5, the three cells are purified and then sent to sequencing, the sequencing results are shown in figures 35 and 36, and the sequencing shows that the puro sequence is successfully inserted.

S5, the growth curve of St3gal2 knockout cells was plotted, and the results are shown in FIG. 37 (MDCK cells vs. MDCK-St3gal2KO cells). The cell growth curve shows that the multiplication time of MDCK cells is 26h, the time to reach the plateau is 60h, and the average density of the living cells in the plateau is 5.3X10 ⁵ The MDCK-st3gal2KO cell doubling time is 34h, the time to reach the plateau is 70h, and the average density of the living cells in the plateau is 4.7X10 ⁵ /mL。

EXAMPLE 3 construction of St3gal1 and St3gal2 Co-knocked-out MDCK cell lines (MDCK-St 3gal KO or MDCK-St3gal 1&2 KO)

This example is based on MDCK-st3gal1KO to further knock out the st3gal2 gene and requires removal of puromycin resistance. Using the Cre-loxp system, the loxp-puro-loxp sequence was excised by pY48, and then gene editing by st3gal2 was performed.

The pY48 plasmid greatly extracted from endotoxin removal is electrically transferred into MDCK-st3gal1KO cell strain which has been subjected to puromycin screening and verification, the cell strain is normally cultured after liquid exchange for the next day after the electric transfer, no antibiotics are added into a culture medium, limiting dilution is carried out to 96-well plates when the confluence of the cells reaches about 60% after the normal growth of the cells for 3-5 days, the confluence of monoclonal cells in the 96-well plates is more than 80% after 1 week, the cells are separated into plates, and the other plate is added with puromycin for screening, and the sample holes in the two plates are noted to correspond to one another. After further culturing for one week, the cells in the screening wells are completely dead, but the cell samples of the cells in the original wells are positive cells, so that two positive cell sample wells (B1 and H11) are obtained in total, after the amplification culture and preservation, the genome is extracted for full-length PCR (two pairs of primers for designing the full-length PCR are respectively from 3 'and 5' homology arms, two groups of different primers are respectively adopted for the two cell samples), and sequencing verification is carried out, and the full-length PCR verification result is shown as figure 38, which shows that the sequence of loxp-puro inserted in the two cell sample genes is sheared, and only homologous arm sequences are left, so that the bands are between 1000 and 1200bp, and the PCR products are purified and sequenced.

After the cells were subjected to expansion culture and cryopreservation, st3gal2 gene knockout was performed, and the specific steps were the same as those of the experiment in example 2, and the primers, plasmids and homology arms were all the same, and 4 single cell clone samples were obtained after screening, and the sampled genome was subjected to positional PCR validation and sequencing, and the results were shown in fig. 39: positive bands appear in both the 5 'and 3' positional PCRs of the four cell samples, and the PCR products are purified and sequenced.

Q-PCR experiment primers and probes were designed for st3gal2 gene, and Q-PCR experiments were performed, wherein WT and KO components represent MDCK-st3gal1KO cells and MDCK-st3gal1&2KO cells, respectively, and the experimental results are shown in FIG. 40. Wherein, the selected negative control is MDCK-st3gal1KO cell strain after Cre-loxp is sheared by loxp-puro-loxp fragments, and the transcription level of st3gal2 in cells before and after st3gal2 knockout is detected, so that the result shows that the transcription level of st3gal2 is obviously reduced (p < 0.01).

The result of plotting the growth curve of MDCK-st3galKO is shown in FIG. 41. The cell growth curve shows that the multiplication time of MDCK cells is 26 hours, the time to reach the plateau is 60 hours, and the average density of living cells in the plateau is 5.3×10 ⁵ /mL，MDCK-st3gal1&The 2KO cell doubling time is 34h, the time to reach the plateau is 72h, and the average density of the living cells in the plateau is 4.8X10 ⁵ /mL。

Example 4 human influenza Virus susceptibility verification

The three types of cells MDCK-st3gal1KO, MDCK-st3gal2KO and MDCK-st3gal KO were inoculated with three types of influenza viruses H1N1, BY and BV according to MOI=0.01, and their hemagglutination titers were measured and compared for 72 hours, so that the sensitivity of each cell to human influenza virus was verified.

The results are shown in FIG. 42, and the results of the hemagglutination experiments indicate that: the virus titer obtained BY culturing three strains of H1, BV and BY in MDCK-st3gal2KO cells is not significantly different from that of MDCK cells. The titres of MDCK-st3gal1KO cells and MDCK-st3gal1&2KO cells in three viruses of H1N1, BV and BY are significantly increased compared with MDCK cells: compared with MDCK cells, the titers of the H1N1, BV and BY viruses harvested in the MDCK-st3gal1KO cells are respectively increased BY 4 times, 4 times and 2 times, and the titers of the H1N1, BV and BY viruses harvested in the MDCK-st3gal1&2KO cells are respectively increased BY 8 times, 8 times and 4 times.

EXAMPLE 5 verification of sialic acid expression

Since sialic acid is expressed on the cell surface and different sialic acids can bind specifically to different lectins, sialic acid abundance can be quantified by flow analysis of the average fluorescence intensity by fluorescent labelling with avidin after lectin-biotin binding specifically to sialic acid. Wherein biotinylated Maackia amurensis lectin II (MAL-II lectin) can specifically recognize alpha-2, 3 sialic acid on cell surface, and sambucus chinensis lectin (SNA lectin) can specifically recognize alpha-2, 6 sialic acid.

1) MAL-II lectin specific recognition. Alpha. -2, 3-sialic acid assay: (1) MDCK cells were digested and then subjected to cell counting to prepare 1X 10 cells ⁶ A/mL cell suspension (in this case PBS+2% NBS as incubation medium) was dispensed into 1.5mL EP tubes and incubated for 20min. (2) To each EP tube 10-15. Mu.L of biotinylated MAL II was added and incubated for 30min at room temperature. (3) Centrifuging to remove supernatant, re-suspending with PBS, blowing, mixing, repeating the centrifugation and re-suspending for three times, and adding into cell suspensionFluorescent-labeled Streptavidin Protein (PE label), incubated at room temperature for 30min in the dark. (4) Centrifuging to remove supernatant, re-suspending with PBS, repeating for three times, adding 1mLPBS into the cell suspension, blowing and mixing thoroughly, observing that no cell mass exists in the EP tube, detecting fluorescent signals with flow, and counting the fluorescent intensities of different groups.

2) SNA lectin specific recognition a-2, 6-sialic acid assay: (1) MDCK cells were digested and then subjected to cell counting to prepare 1X 10 cells ⁶ A/mL cell suspension (in this case PBS+2% NBS as incubation medium) was dispensed into 1.5mL EP tubes and incubated for 20min. (2) To each EP tube 10-15. Mu.L of FITC-labeled SNA was added and incubated for 30min at room temperature in the absence of light. (3) Centrifuging to remove supernatant, re-suspending cells with PBS, repeating for three times, adding 1mLPBS into the cell suspension, blowing and mixing thoroughly, observing that no cell mass exists in the EP tube, detecting fluorescent signals with flow, counting the fluorescent intensities of different groups, and calculating the average fluorescent intensity.

Sialic acid expression in three cells, MDCK-st3gal1KO, MDCK-st3gal1&2KO, were studied separately: after binding specifically to sialic acid by lectin-biotin, biotin reacts with the fluorescent-labeled avidin, and the average fluorescence intensity on the cell surface is analyzed by flow to quantify sialic acid abundance. Five repeated controls are made for each group, cell fragments and cell clusters are subjected to two-step screening by setting a gate, the obtained cell clusters are subjected to corresponding fluorescence labeled positive cells for gate coiling, and the average fluorescence intensity of the positive cells is analyzed.

The results of the average fluorescence intensity flow pattern after three cell siallectin-biotin binding are shown in FIG. 43. The results of the average fluorescence intensity test for expression of different generations of hyposialic acid in the three cells are shown in FIG. 44.

The MDCK cells, the MDCK-st3gal1KO cells and the MDCK-st3gal1&2KO cells have significant differences, while the MDCK-st3gal1KO cells have insignificant differences between generations. Wherein the MDCK cell P72 control group has an average fluorescence intensity (16325 units of fluorescence) of alpha-2, 6-sialic acid+SNP-FITC (green fluorescence); the average fluorescence intensity of the MDCK-st3gal1KO P92, P97, P102 and P107 experimental groups alpha-2, 6-sialic acid+SNP-FITC is 25433, 24810, 26917 and 24828 units fluorescence, the average value is 25497 units fluorescence, and the average value is 1.56 times that of the control group; MDCK-st3gal1&2KOP101 experimental group alpha-2, 6-sialic acid + SNP-FITC average fluorescence intensity is 29100 units fluorescence, which is 1.78 times that of control group.

The MDCK cells, the MDCK-st3gal1KO cells and the MDCK-st3gal1&2KO cells have obvious differences with each other, but the difference between the generations of the MDCK-st3gal1KO cells is not obvious, wherein the average fluorescence intensity of the alpha-2, 3-sialic acid+MAL-II+PE marked avidin (red) of the P72 control group of the MDCK cells is 721561 units of fluorescence; the average fluorescence intensities of the MDCK-st3gal1KO P92, P97, P102 and P107 experimental groups alpha-2, 3-sialic acid+MAL-II+PE marked avidin are 541008, 501920, 539661 and 584379 unit fluorescence, the average value is 541742 unit fluorescence, which is 0.75 times that of the control group; the average fluorescence intensity of the MDCK-st3gal1&2KOP101 experimental group alpha-2, 3-sialic acid+MAL-II+PE labeled avidin is 481677 units of fluorescence, which is 0.67 times that of the control group.

Example 6 histology sequencing and analysis

The MDCK-st3galKO (P102) cell genome was extracted, and second generation genome sequencing was performed and aligned with the MDCK cell reference genome.

The second generation sequencing experimental procedure is as follows: extracting and purifying cell genome DNA, fragmenting DNA, repairing end, selecting library size, adding A-connecting joint at 3' end, amplifying quality inspection and sequencing.

The analysis flow of the genome sequencing result is as follows: sequencing raw data-data quality control screening high quality data-comparison reference genome-to perform mutation detection, wherein the mutation detection comprises: single Nucleotide Polymorphisms (SNPs), nucleotide insertions or deletions (indels), structural Variations (SVs), and gene Copy Number Variations (CNVs). Finally, the mutation situation related to gene knockout in the genome is obtained as shown in figure 45.

MDCK-st3galKO cell genome second-generation sequencing analysis result

Note that: in the second generation sequencing result, small fragment insertion and large fragment insertion occur, and in the experiment, the small fragment insertion is residual loxp (30-35 bp) left by Cre-loxp shearing after the puro sequence is inserted; the large fragment was inserted as an insert of the entire puro sequence (1 kbp-1.3 kbp).

By sequencing alignment, the small fragment insert on chromosome 13 matched the loxp sequence (st 3gal 1), the large fragment insert on chromosome 5 matched the puro sequence (st 3gal 2), demonstrating that the insertion sites at both sites were consistent with expectations.

Transcriptomic analysis

To investigate the mechanism of action of combined knockout of st3gal1 and st3gal2 on MDCK susceptibility to influenza virus. The MDCK-st3galKO was further transcriptome sequenced. Two cells were each examined for 3 samples (designated MDCK-normal1, 2, 3 and MDCK-st3gal1, 2, 3, respectively).

The transcriptome sequencing flow is: cell RNA extraction quality inspection, cDNA synthesis, library preparation, library amplification quality inspection and sequencing on the machine. The transcriptome data analysis flow is: data quality control, comparison of reference genome, mutation detection (SNP, inDel), gene quantification and expression difference analysis (KEGG enrichment analysis, GO enrichment analysis). The specific analysis results are shown in FIGS. 46-49.

Transcriptome sequencing results showed that the expression levels of st3gal1 and st3gal2 were significantly reduced in MDCK-st3gal ko cells, p1<0.01, p2<0.05, compared to MDCK cells.

The invention carries out a series of verification experiments aiming at a new MDCK cell strain obtained by gene editing, and can be specifically seen that:

1. the positioning PCR and sequencing results show that MDCK-st3gal1KO cells are heterozygous mutations and MDCK-st3gal2KO cells are homozygous mutations. Q-PCR results showed that the transcript level of st3gal1 was significantly reduced in MDCK-st3gal1KO cells compared to MDCK cells; whereas the level of transcription of st3gal2 was significantly reduced in MDCK-st3gal1&2KO cells compared to MDCK-st3gal1KO cells.

2. The genomic sequencing results showed that in MDCK-st3gal1&2KO cells, the small fragment insert at position 29863779-29863814 of chromosome 13 where st3gal1 is located was matched with the loxp sequence, and the large fragment insert at position 76829232-76830128 of chromosome 5 where st3gal2 is located was matched with the puro sequence. Transcriptome sequencing results showed a significant decrease in the expression levels of st3gal1 and st3gal2 in MDCK-st3gal1&2KO cells compared to MDCK cells.

3. The cell growth curve shows that the multiplication time of MDCK cells is 26 hours, the time to reach the platform phase is 60 hours, and the average density of the living cells in the platform phase is 5.3 multiplied by 105/mL; MDCK-st3gal1KO cells multiply for 36h, reach the time of the plateau for 72h, the average density of the living cells in the plateau is 5.2X105/mL; MDCK-st3gal2KO cell doubling time is 34h, time to reach a plateau is 70h, and average density of living cells in the plateau is 4.7X10 ⁵ /mL；MDCK-st3gal1&The 2KO cell doubling time is 34h, the time to reach the plateau is 72h, and the average density of the living cells in the plateau is 4.8X10 ⁵ /mL。

4. The difference in average fluorescence intensity of cell surface sialyl lectin binding represents the difference in sialic acid content, wherein there are significant differences among MDCK cells, MDCK-st3gal1KO cells, and MDCK-st3gal1&2KO cells. Whereas the difference between the generations of MDCK-st3gal1KO cells was not significant. The expression amount of alpha-2, 6-sialic acid in MDCK-st3gal1KO cells is 1.56 times that of MDCK cells; the expression quantity of alpha-2, 6-sialic acid in MDCK-st3gal1&2KO cells is 1.78 times that of MDCK cells; MDCK-st3gal1KO cells expressing 0.75 times of the amount of alpha-2, 3-sialic acid expressed in MDCK cells; the expression level of alpha-2, 3-sialic acid in MDCK-st3gal1&2KO cells was 0.67 times that in MDCK cells.

5. The results of the hemagglutination experiments show that the titer of MDCK-st3gal1KO cells and MDCK-st3gal1&2KO cells in three viruses of H1N1, BV and BY is significantly increased compared with MDCK cells. Compared with MDCK cells, the titers of H1N1, BV and BY viruses harvested in the MDCK-st3gal1KO cells are respectively increased BY 4 times, 4 times and 2 times, the titers of H1N1, BV and BY viruses harvested in the MDCK-st3gal1&2KO cells are respectively increased BY 8 times, 8 times and 4 times, and the titers of viruses obtained BY culturing the three strains of H1, BV and BY in the MDCK-st3gal2KO cells are not significantly different from the titers of the MDCK cells.

In conclusion, the MDCK-st3galKO cell strain obtained by gene editing has the characteristic of being highly sensitive to human influenza virus, and has potential for producing pandemic influenza vaccines.

It should be noted that the above examples are only for further illustrating and describing the technical solution of the present invention, and are not intended to limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (2)

1. A method for constructing an MDCK cell line in which both sialyltransferase genes st3gal 1 and st3gal2 are deleted, comprising the steps of:

obtaining a MDCK cell strain with a deletion of a sialyltransferase gene st3gal 1, and knocking out the sialyltransferase gene st3gal 1 in the MDCK cell by using a CRISPR Cas9 gene editing system, wherein the target sequence is as follows: GCCCGTACCAGGACTCTCGG;

knocking out a sialyltransferase gene st3gal2 in the MDCK cells by using a CRISPR Cas9 gene editing system;

the CRISPR Cas9 gene editing system adopts a gRNA vector plasmid which is pX330 with a gRNA framework, a Cas9 expression sequence, an NLS nuclear localization sequence and an anti-ampicillin gene, and a homologous arm vector plasmid which is pY75 with a plurality of adjacent common enzyme cutting sites, loxp fragments and puromycin resistance genes;

The gRNA sequence of the targeted knockout gene st3gal 1 is shown as SEQ ID NO.1 and SEQ ID NO.2, the 5 'homologous arm sequence is shown as SEQ ID NO.5, the 3' homologous arm sequence is shown as SEQ ID NO.6,

the gRNA sequence of the targeted knockout gene st3gal2 is shown as SEQ ID NO.7 and SEQ ID NO. 8; the 5' homologous arm sequence is shown as SEQ ID NO. 11; the 3' homology arm sequence is shown as SEQ ID NO. 12.

2. The method for constructing an MDCK cell strain in which both sialyltransferase genes st3gal 1 and st3gal2 are deleted according to claim 1, wherein puromycin screening conditions adopted in the construction process are as follows: the concentration of puromycin solution is 6 mug/mL;

the electric transfer process conditions are as follows: single pulse, pulse voltage 110v, pulse width 25ms.