CN115710589B - Genetic transformation method of sesbania - Google Patents

Abstract

The invention relates to the technical field of plant genetic transformation, in particular to a genetic transformation method of sesbania. The conversion method provided by the invention comprises the following steps: (1) preparation of sesbania sterile seedlings, (2) pre-culture of explants, (3) infection and co-culture, (4) recovery culture, (5) screening culture, (6) differentiation culture and (7) rooting culture. The method takes sesbania cotyledon or hypocotyl as an initial explant, and establishes a rapid and effective regeneration system. The method establishes an agrobacterium-mediated sesbania glyphosate screening transformation system for the first time, and fills the blank of a sesbania genetic transformation system.

Description

Genetic transformation method of sesbania

Technical Field

The invention belongs to the field of plant genetic transformation, and particularly relates to a sesbania genetic transformation method.

Background

Sesbania, which is an annual herb leguminous plant, is good in warm climate, has strong salt tolerance, waterlogging tolerance and barren tolerance, is pioneer green manure crop for improving saline-alkali soil, and has great popularization value in saline-alkali areas. Furthermore, the utility value of sesbania is also found in the industrial and medical fields: the corrosion resistance degree and the fiber tension of sesbania stem bark are better than those of jute, so that the sesbania stem bark is an ideal substitute of jute; sesbania gum extracted from sesbania seed endosperm is a natural polysaccharide polymer, and its main components are D-galactose and D-mannose, and can be used as food emulsifying agent, thickening agent and stabilizing agent to improve food quality.

Sesbania has a certain research on ecology, physiological and biochemical characteristics, cultivation and planting technology and the like, and has little research on transgenesis and genetic transformation. Because of the limited factors of few available resources, weak genetic ability and the like, the development of deep sesbania research is severely restricted. In order to solve the above problems, the most effective means is to genetically modify sesbania by biotechnology.

The genetic transformation system of sesbania is blank, and the establishment of the transformation system of sesbania and the acquisition of transgenic materials have great significance for the improvement and application of sesbania properties.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides a genetic transformation method of sesbania, and fills the blank of a sesbania genetic transformation system.

The technical scheme provided by the invention is as follows:

a genetic transformation method of sesbania, comprising the steps of:

(1) Preparation of sesbania sterile seedlings: inoculating sterilized sesbania seeds into a 1/2MS solid culture medium for culture to obtain aseptic seedlings;

(2) Explant preculture: cutting an explant part from the aseptic seedling, and inoculating the explant to a preculture medium for preculture;

(3) Infection and co-cultivation: impregnating the explant with an agrobacterium infection liquid for 5-10min, wherein the agrobacterium infection liquid contains acetosyringone, drying the moisture of the explant after infection, and placing the explant into a co-culture medium for dark culture for 2-4d to obtain a co-culture explant;

(4) Recovery culture: subjecting the co-cultured explant to recovery culture at 25 ℃ under illumination;

(5) Screening and culturing: transferring the recovered tissue to a screening culture medium, performing light culture at 25 ℃, and screening to obtain a resistant callus;

(6) Transferring the resistant callus onto a differentiation medium, and culturing and differentiating at 25 ℃ to obtain sesbania seedlings;

(7) Rooting culture: transferring the sesbania seedling to a rooting culture medium, and culturing at 25 ℃ until the plant height is about 10cm to obtain a sesbania transgenic plant.

Further, in the step (1), the 1/2MS solid medium comprises the following components: MS salt 2g/L, B5 vitamin 3g/L, sucrose 15g/L, agar 10g/L, and culturing for 7-10 days.

Further, in the step (1), the specific sterilization method comprises the steps of wrapping sesbania seeds by gauze, boiling in a water bath kettle at 80 ℃ for 15min, sterilizing by 75% alcohol for 2 times, sterilizing by 40% NaCl for 2 times, flushing by sterile water for 4-5 times for 15min each time, and then removing surface moisture.

Further, in the step (2), the components of the preculture medium are as follows: MS salt 4.3g/L, B5 vitamin 3g/L, sucrose 20g/L, agar 10g/L, MES g/L, auxin (IAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, pH5.6, and incubation time of 2-4 days, preferably 3 days.

Further, in step (3), the OD660 of the agrobacterium tumefaciens invasive solution is 0.4-0.6; the co-culture medium comprises the following components: MS salt 3g/L, B5 vitamin 2g/L, sucrose 20g/L, glucose 10g/L, MES g/L, naphthalene Acetic Acid (NAA) 2mg/L, AS mg/L, cysteine 50mg/L, agar 8g/L, pH5.6, co-cultivation time of 2-4 days, co-cultivation temperature of 22 ℃.

In a specific embodiment, the explant is the hypocotyl of sesbania; at the moment, the explant in the step (3) is treated by ultrasonic waves when being co-cultured with an agrobacterium infection liquid, wherein the infection time is 5min, and the agrobacterium infection liquid contains acetosyringone with the concentration of 40 mg/L.

In a specific embodiment, the explant is a cotyledon of sesbania; at this time, the time for infection by co-culturing the explant in the step (3) with an agrobacterium infection solution is 2-4min, wherein the agrobacterium infection solution contains acetosyringone with the concentration of 20 mg/L.

Further, in step (4), the composition of the recovery medium is: MS salt 3g/L, B5 vitamin 4g/L, MES g/L, sucrose 30g/L, kinetin (KT) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6, and culturing time of 7-10 days.

Further, in step (5), the composition of the screening medium is: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 30-50mg/L, naphthylacetic acid (NAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, pH5.6, and incubation time of 4 weeks.

Further, in the step (6), the composition of the differentiation medium is: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 10-30mg/L, zein (ZT) 0.5-3mg/L, agar 8g/L, and pH5.6.

Further, the rooting medium comprises the following components: b5 salt 3g/L, B5 vitamin 4g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, and naphthylacetic acid (NAA) 0.2-1.0mg/L.

Compared with the prior art, the invention has the beneficial effects that:

(1) The sesbania genetic transformation method established by the invention fills the blank of sesbania genetic transformants.

(2) The invention adopts herbicide glyphosate as a screening agent to obtain a transgenic positive strain by experimental exploration of a treatment mode and culture conditions in the optimized transformation process, and smoothly establishes a stable agrobacterium-mediated sesbania genetic transformation system.

(3) The genetic transformation method has high transformation efficiency and short transformation period, and the whole process only needs 3-4 months.

Drawings

FIG. 1A is a callus obtained in example 1 of the present invention; FIG. 1B shows the resistant calli obtained after screening with the screening medium of example 1; FIG. 1C shows the plant obtained after the rooting medium in example 1.

Detailed Description

The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.

The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

EXAMPLE 1 sesbania genetic transformation procedure

1. Construction of a genetic transformation expression vector:

the glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (cEPSPS) of the Agrobacterium CP4 strain driven by the cauliflower mosaic virus (CaMV) 35S promoter was constructed onto the pCAMBIA3301 vector backbone (vast Biotechnology, cat: MLCC 9683) by double enzyme digestion technique to construct a recombinant over-expression vector I p S-EPSPS, the p35S sequence of which is shown as SEQ ID NO:1, and the EPSPS sequence of which is shown as SEQ ID NO: 2.

SEQ ID NO:1

CATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAATTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCATTGAGATTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTATTGTGAAGATAGTGAAAGGAAGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTGCCGACAGTGTCCAAAGAGACCCCACCCAOGAGGAGCATCGTGGAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAACCACTATCTTCGCAAGACCTTCTCTATATAAGGATTTTATTGAGAGAACACGGGGGACT

SEQ ID NO:2

ATGCTTCACGGTGCAAGCAGCCGTCCAGCAACTGCTCGTAAGTCCTCTGGTCTTTCTGGAACCGTCCGTATTCCAGGTGACAAGTCTATCTCCCACAGGTCCTTCATGTTTGGAGGTCTCGCTAGCGGTGAAACTCGTATCACCGGTCTTTTGGAAGGTGAAGATGTTATCAACACTGGTAAGGCTATGCAAGCTATGGGTGCCAGAATCCGTAAGGAAGGTGATACTTGGATCATTGATGGTGTTGGTAACGGTGGACTCCTTGCTCCTGAGGCTCCTCTCGATTTCGGTAACGCTGCAACTGGTTGCCGTTTGACTATGGGTCTTGTTGGTGTTTACGATTTCGATAGCACTTTCATTGGTGACGCTTCTCTCACTAAGCGTCCAATGGGTCGTGTGTTGAACCCACTTCGCGAAATGGGTGTGCAGGTGAAGTCTGAAGACGGTGATCGTCTTCCAGTTACCTTGCGTGGACCAAAGACTCCAACGCCAATCACCTACAGGGTACCTATGGCTTCCGCTCAAGTGAAGTCCGCTGTTCTGCTTGCTGGTCTCAACACCCCAGGTATCACCACTGTTATCGAGCCAATCATGACTCGTGACCACACTGAAAAGATGCTTCAAGGTTTTGGTGCTAACCTTACCGTTGAGACTGATGCTGACGGTGTGCGTACCATCCGTCTTGAAGGTCGTGGTAAGCTCACCGGTCAAGTGATTGATGTTCCAGGTGATCCATCCTCTACTGCTTTCCCATTGGTTGCTGCCTTGCTTGTTCCAGGTTCCGACGTCACCATCCTTAACGTTTTGATGAACCCAACCCGTACTGGTCTCATCTTGACTCTGCAGGAAATGGGTGCCGACATCGAAGTGATCAACCCACGTCTTGCTGGTGGAGAAGACGTGGCTGACTTGCGTGTTCGTTCTTCTACTTTGAAGGGTGTTACTGTTCCAGAAGACCGTGCTCCTTCTATGATCGACGAGTATCCAATTCTCGCTGTTGCAGCTGCATTCGCTGAAGGTGCTACCGTTATGAACGGTTTGGAAGAACTCCGTGTTAAGGAAAGCGACCGTCTTTCTGCTGTCGCAAACGGTCTCAAGCTCAACGGTGTTGATTGCGATGAAGGTGAGACTTCTCTCGTCGTGCGTGGTCGTCCTGACGGTAAGGGTCTCGGTAACGCTTCT

GGAGCAGCTG

TCGCTACCCACCTCGATCACCGTATCGCTATGAGCTTCCTCGTTATGGGTCTCGTTTC

TGAAAACCCTGTTACTGTTGATGATGCTACTATGATCGCTACTAGCTTCCCAGAGTTC

ATGGATTTGATGGCTGGTCTTGGAGCTAAGATCGAACTCTCCGACACTAAGGCTGCT

TGA

2. Agrobacterium transformation:

transforming an agrobacterium competent cell EHA105 purchased from Shanghai Geotex (China, shanggai, cat: AC 1010) with a 35S-EPSPS overexpression vector I to obtain a successfully transformed p35S-EPSPS agrobacterium I; using the EPSPS gene as an indication mark to verify a hypocotyl stable transformation system;

3. specific procedures for genetic transformation

(1) Collecting mature pods from sesbania plants, removing shells, selecting full and spot-free seeds, wrapping with gauze, putting into a water bath kettle at 80 ℃ and boiling for 15min, sterilizing with 75% alcohol for 2 times, sterilizing with 40% NaCl for 2 times, and washing with sterile water for 4-5 times each time for 15 min. Transferring the sterilized seeds to sterile paper, drying the water in an ultra-clean bench, and placing the sterilized seeds into a sterile centrifuge tube for standby.

(2) Inoculating the sterilized sesbania seeds into a solid medium containing 1/2MS in an ultra-clean workbench, and dispersing the seeds as much as possible to obtain the maximum growth space. Placing the inoculated sesbania seeds in a 25-DEG illumination culture room for culture, and unfolding the cotyledons of the seedlings approximately for 7-10 days.

1/2MS solid medium composition: MS salt 2g/L, B5 vitamin 3g/L, sucrose 15g/L and agar 10g/L.

(3) After 7-10d inoculation, sesbania cotyledons are placed on a preculture medium under a sterile environment for preculture. The preculture medium is pretreated for 2 to 4 days, preferably for 3 days.

Pre-culture medium composition: MS salt 4.3g/L, B5 vitamin 3g/L, sucrose 20g/L, agar 10g/L, MES g/L, auxin (IAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L (pH 5.6). (4) Adding the cotyledon which grows well after preculture into an agrobacterium invasion solution (OD 660 = 0.4-0.6) which is transformed and identified to carry out p35S-EPSPS over-expression vector for infection, wherein the agrobacterium invasion solution is obtained by shaking and uniformly mixing agrobacterium containing a target gene expression vector in an invasion solution containing acetosyringone with the concentration of 20 mg/L; the sterile cultured cotyledon is co-cultured with the agrobacterium infection solution for 5-10 minutes, preferably 7 minutes, and the cotyledon is placed on sterilized filter paper to be dried after infection is finished. The cotyledons were then inoculated onto the co-culture medium and dark-cultured at 22℃for 2-4d.

Co-culture medium composition: MS salt 3g/L, B5 vitamin 2g/L, sucrose 20g/L, glucose 10g/L, MES g/L, naphthalene Acetic Acid (NAA) 2mg/L, AS mg/L, cysteine 50mg/L, agar 8g/L (pH 5.6).

(5) After the co-cultivation is completed, recovery cultivation is performed for 7-10d, and light cultivation is performed at 25 ℃.

Recovery medium composition: MS salt 3g/L, B5 vitamin 4g/L, MES g/L, sucrose 30g/L, kinetin (KT) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L (pH 5.6).

(6) Transferring the recovered tissue to a screening culture medium, culturing at 25 ℃ for 4 weeks, and screening to obtain the resistant callus.

Screening medium composition: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 30-50mg/L, naphthylacetic acid (NAA) 0.5mg/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L (pH5.6).

(7) Transferring the selected resistant callus onto a differentiation medium, and culturing and differentiating at 25 ℃.

Differentiation medium composition: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 10-30mg/L, zeatin (ZT) 1mg/L, agar 8g/L (PH 5.6).

(8) The differentiated seedlings are transferred to rooting medium, cultured at 25 ℃ until the plant height is about 10cm, and transferred to greenhouse culture.

Rooting medium composition: b5 salt 3g/L, B5 vitamin 4g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, and naphthylacetic acid (NAA) 0.2-1.0mg/L.

4. Identification of transgenic positive plants

The sesbania plant transformed with EPSPS gene was verified by ordinary PCR amplification of full-scale gold company 2X EasyTaq PCR SuperMix (China, beijin, cat: AS 111-11), and the transgenic plant with 1368bp size was obtained by PCR amplification AS positive transgenic sesbania containing EPSPS gene in genome.

The PCR primer sequences are as follows:

EPSPS-F(SEQ ID NO:3)：ATGCTTCACGGTGCAAGEPSPS-R(SEQ ID NO:4)：TCAAGCAGCCTTAGTGTCG

the conditions for the PCR reaction were: 30 cycles, each cycle 95℃30',58℃30',72℃40'.

The results show that 8 positive transgenic sesbania plants are finally identified, and the transformation efficiency is calculated to be 5% because the number of initial cotyledons is 150.

Example 2 optimization of sesbania genetic transformation method

This example is a modification of the genetic transformation procedure of example 1 as follows:

(1) Sesbania explant site replacement

Under the condition of keeping the other conditions unchanged, replacing sesbania cotyledons in the step (3) and the step (4) of the specific operation step of the genetic transformation in the example 1 with hypocotyls, cutting the hypocotyls into small sections with the length of about 1cm by scissors or a surgical knife, and uniformly placing the cut hypocotyls on a preculture medium for preculture and subsequent steps.

(2) Agrobacterium infection procedure optimization

Under the precondition of not changing other conditions, ultrasonic auxiliary infection is used in the step (4) of the specific operation step of '3 and genetic transformation' in the embodiment 1, the concentration of acetosyringone in the invasion solution is adjusted to 40mg/L, and the co-culture duration of the aseptically cultured sesbania hypocotyl and the agrobacterium invasion solution is prolonged to 5min.

The identification result shows that under the condition that the number of the initial hypocotyls is 150, 18 positive transgenic sesbania plants are obtained through screening, and the conversion rate reaches 12%.

In summary, in the agrobacterium infection process, the efficiency of inserting the exogenous gene into the plant genome is remarkably increased by optimizing the positions of the explants, the concentration of acetosyringone in the invasion solution, the co-culture time period, the ultrasonic auxiliary treatment and other links, and finally the conversion efficiency of sesbania is improved (from 5% to 12%).

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Claims (8)

1. A genetic transformation method of sesbania, which is characterized by comprising the following steps:

(1) Preparation of sesbania sterile seedlings: inoculating sterilized sesbania seeds into a 1/2MS solid culture medium for culture to obtain aseptic seedlings; the 1/2MS solid culture medium comprises the following components: MS salt 2g/L, B5 vitamin 3g/L, sucrose 15g/L and agar 10g/L;

(2) Explant preculture: cutting an explant part from the aseptic seedling, and inoculating the explant to a preculture medium for preculture; the components of the preculture medium are as follows: MS salt 4.3g/L, B5 vitamin 3g/L, sucrose 20g/L, agar 10g/L, MES g/L, auxin IAA 0.5mg/L, 6-benzyl adenine 6-BAP 1mg/L, pH5.6;

(3) Infection and co-cultivation: impregnating the explant with an agrobacterium infection liquid for 5-10min, wherein the agrobacterium infection liquid contains acetosyringone, drying the moisture of the explant after infection, and placing the explant into a co-culture medium for dark culture for 2-4d to obtain a co-culture explant; the co-culture medium comprises the following components: MS salt 3g/L, B5 vitamin 2g/L, sucrose 20g/L, glucose 10g/L, MES g/L, NAA 2mg/L, AS mg/L, cysteine 50mg/L, agar 8g/L, pH5.6;

(4) Recovery culture: subjecting the co-cultured explant to recovery culture at 25 ℃ under illumination; the composition of the recovery medium was: MS salt 3g/L, B5 vitamin 4g/L, MES g/L, sucrose 30g/L, kinetin KT 0.5mg/L, 6-benzyl adenine 6-BAP 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6;

(5) Screening and culturing: transferring the recovered tissue to a screening culture medium, and performing light culture at 25 ℃ to obtain a resistant callus after screening culture; the composition of the screening culture medium is as follows: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 30-50mg/L, NAA 0.5mg/L, 6-benzyl adenine 6-BAP 1mg/L, agar 8g/L, pH5.6;

(6) Transferring the resistant callus onto a differentiation medium, and culturing and differentiating at 25 ℃ to obtain sesbania seedlings; the composition of the differentiation medium is as follows: MS salt 2g/L, B5 vitamin 4g/L, B vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephalosporin 0.2g/L, glyphosate 10-30mg/L, zein ZT 0.5-3mg/L, agar 8g/L, pH5.6;

(7) Rooting culture: transferring the sesbania seedling to a rooting culture medium, and culturing at 25 ℃ until the plant height is 10cm to obtain a sesbania transgenic plant; the rooting culture medium comprises the following components: b5 salt 3g/L, B5 vitamin 4g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, naphthylacetic acid NAA) 0.2-1.0mg/L;

the explant is the hypocotyl of sesbania;

and (3) treating the explant by ultrasonic waves when co-culturing the explant and an agrobacterium infection solution in the step (3), wherein the infection time is 5min, and the agrobacterium infection solution contains acetosyringone with the concentration of 40 mg/L.

2. The genetic transformation method according to claim 1, wherein in the step (1), the culturing time is 7 to 10 days.

3. The genetic transformation method according to claim 1, wherein in the step (1), the specific sterilization method is to wrap sesbania seeds with gauze, cook the sesbania seeds in a water bath kettle at 80 ℃ for 15min, sterilize the sesbania seeds with 75% alcohol for 2 times, sterilize the sesbania seeds with 40% NaCl for 2 times, rinse the sesbania seeds with sterile water for 4-5 times for 15min each time, and then remove surface moisture.

4. The genetic transformation method according to claim 1, wherein in the step (2), the culturing time is 2 to 4 days.

5. The genetic transformation method according to claim 4, wherein in the step (2), the culturing time is 3 days.

6. The genetic transformation method according to claim 1, wherein in step (3), the OD660 of the agrobacterium infested solution is between 0.4 and 0.6; the co-cultivation time is 2-4 days, and the co-cultivation temperature is 22 ℃.

7. The genetic transformation method according to claim 1, wherein in the step (4), the culturing time is 7 to 10 days.

8. The genetic transformation method according to claim 1, wherein in step (5), the culturing time is 4 weeks.