CN115710589A - Genetic transformation method of sesbania - Google Patents
Genetic transformation method of sesbania Download PDFInfo
- Publication number
- CN115710589A CN115710589A CN202211452332.4A CN202211452332A CN115710589A CN 115710589 A CN115710589 A CN 115710589A CN 202211452332 A CN202211452332 A CN 202211452332A CN 115710589 A CN115710589 A CN 115710589A
- Authority
- CN
- China
- Prior art keywords
- culture
- sesbania
- genetic transformation
- transformation method
- explant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to the technical field of plant genetic transformation, in particular to a genetic transformation method of sesbania. The transformation method provided by the invention comprises the following steps: the method comprises the following steps of (1) preparation of sesbania aseptic seedlings, (2) explant pre-culture, (3) infection and co-culture, (4) recovery culture, (5) screening culture, (6) differentiation culture and (7) rooting culture. The method takes cotyledon or hypocotyl of sesbania as an initial explant to establish a rapid and effective regeneration system. The method establishes a glyphosate screening and transforming system of the sesbania mediated by agrobacterium for the first time, and fills the blank of a sesbania genetic transformation system.
Description
Technical Field
The invention belongs to the field of plant genetic transformation, and particularly relates to a genetic transformation method of sesbania.
Background
The sesbania is an annual herbaceous leguminous plant, is fond of warm climate, has strong salt tolerance, waterlogging tolerance and barren tolerance, is a pioneer green manure crop for improving saline-alkali soil, and has great popularization value in saline-alkali areas. In addition, the use value of sesbania has also been found in the industrial and medical fields: the corrosion resistance degree and the fiber tension of the sesbania stem skin are superior to those of jute, and the sesbania stem skin is an ideal substitute of the jute; sesbania gum extracted from the endosperm of sesbania seeds is a natural polysaccharide high molecular substance, mainly contains D-galactose and D-mannose, and can be used as emulsifier, thickener and stabilizer for food to improve the quality of food.
Sesbania has certain research on the aspects of ecology, physiological and biochemical characteristics, cultivation and planting technology and the like, and has very little research on the aspects of transgenosis and genetic transformation. Because of the limited factors of few available resources, weak genetic ability and the like, the development of deep research on sesbania is severely restricted. To solve the above problems, genetic modification of sesbania by biotechnology has been the most effective means.
The genetic transformation system of sesbania is still blank, and establishment of the transformation system of sesbania and acquisition of transgenic materials have great significance for improvement and application of sesbania characters.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, provides a sesbania genetic transformation method and fills the blank of a sesbania genetic transformation system.
The technical scheme provided by the invention is as follows:
a sesbania genetic transformation method comprises the following steps:
(1) Preparation of sesbania aseptic seedlings: inoculating the sterilized sesbania seeds into a 1/2MS solid culture medium for culture to obtain aseptic seedlings;
(2) Pre-culturing explants: cutting an explant part from the aseptic seedling, and inoculating the explant to a pre-culture medium for pre-culture;
(3) Infection and co-culture: dip-dyeing the explant and an agrobacterium infection solution for 5-10min, wherein the agrobacterium infection solution contains acetosyringone, absorbing water of the explant after infection is finished, and placing the explant into a co-culture medium for dark culture for 2-4d to obtain a co-culture explant;
(4) And (3) recovery culture: subjecting the co-cultured explants to recovery culture at 25 ℃ in the light;
(5) Screening and culturing: transferring the recovered tissue to a screening culture medium, performing light culture at 25 ℃, and screening to obtain resistant callus;
(6) Transferring the resistant callus onto a differentiation culture medium, and culturing and differentiating at 25 ℃ to obtain sesbania seedlings;
(7) Rooting culture: and transferring the sesbania seedlings to a rooting culture medium, and culturing at 25 ℃ until the height of the sesbania seedlings is about 10cm to obtain sesbania transgenic plants.
Further, in the step (1), the 1/2MS solid medium comprises the following components: 2g/L of MS salt, 3g/L of B5 vitamin, 15g/L of sucrose and 10g/L of agar, and the culture time is 7-10 days.
Further, in the step (1), the sterilization method specifically comprises the steps of wrapping sesbania seeds with gauze, boiling the sesbania seeds in a water bath kettle at 80 ℃ for 15min, sterilizing the sesbania seeds with 75% alcohol for 2 times, sterilizing the sesbania seeds with 40% NaCl for 2 times, washing the sesbania seeds with sterile water for 4-5 times and 15min each time, and then removing surface moisture.
Further, in the step (2), the components of the pre-culture medium are as follows: 4.3g/L MS salt, 3g/L B5 vitamin, 20g/L sucrose, 10g/L agar, 4g/L MES, 0.5mg/L auxin (IAA), 1 mg/L6-benzyladenine (6-BAP), pH5.6, and culture time of 2-4 days, preferably 3 days.
Further, in the step (3), the OD660 of the agrobacterium infection solution is 0.4-0.6; the composition of the co-culture medium is as follows: 3g/L of MS salt, 2g/L of B5 vitamin, 20g/L of cane sugar, 10g/L of glucose, 2g/L of MES, 2mg/L of naphthylacetic acid (NAA), 20mg/L of AS, 50mg/L of cysteine, 8g/L of agar, pH5.6, co-culture time of 2-4 days and co-culture temperature of 22 ℃.
In a specific embodiment, the explant is the hypocotyl of sesbania; and (4) treating the explants and the agrobacterium infection solution in the step (3) by using ultrasonic waves during co-culture, wherein the infection time is 5min, and the agrobacterium infection solution contains acetosyringone with the concentration of 40 mg/L.
In a specific embodiment, the explant is a cotyledon of sesbania; at the moment, the time for infection of the explants cultured together with the agrobacterium infection solution in the step (3) is 2-4min, and the agrobacterium infection solution contains 20mg/L acetosyringone.
Further, in step (4), the composition of the recovery medium is: 3g/L of MS salt, 4g/L of B5 vitamin, 1g/L of MES, 30g/L of sucrose, 0.5mg/L of Kinetin (KT), 1mg/L of 6-benzyladenine (6-BAP), 8g/L of agar, 150mg/L of cefamycin, 100mg/L of glutamic acid and 100mg/L of aspartic acid, pH5.6 and culture time is 7-10 days.
Further, in the step (5), the composition of the screening medium is as follows: MS salt 2g/L, B5 vitamin 4g/L, MES 1g/L, sucrose 30g/L, cefomycin 0.2g/L, glyphosate 30-50mg/L, naphthalene Acetic Acid (NAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, pH5.6, culture time is 4 weeks.
Further, in step (6), the composition of the differentiation medium is: 2g/L of MS salt, 4g/L of B5 vitamin, 1g/L of MES, 30g/L of sucrose, 0.2g/L of cefamycin, 10-30mg/L of glyphosate, 0.5-3mg/L of Zeatin (ZT), 8g/L of agar and 5.6 of PH.
Further, the rooting medium comprises the following components: 3g/L of B5 salt, 4g/L of B5 vitamin, 30g/L of cane sugar, 8g/L of agar, 150mg/L of cefuroxime axetil and 0.2-1.0mg/L of naphthylacetic acid (NAA).
Compared with the prior art, the invention has the beneficial effects that:
(1) The sesbania genetic transformation method provided by the invention fills the blank of sesbania genetic transformants.
(2) The invention explores the treatment mode and culture condition in the optimized transformation process through experiments, uses herbicide glyphosate as a screening agent to obtain a transgenic positive strain, and successfully establishes a stable agrobacterium-mediated sesbania genetic transformation system.
(3) The genetic transformation method of the invention has high transformation efficiency and short transformation period, and the whole process only needs 3-4 months.
Drawings
FIG. 1A shows callus obtained in example 1 of the present invention; FIG. 1B shows the resistant callus obtained after screening with the screening medium in example 1; FIG. 1C shows the plant obtained in example 1 after culturing in rooting medium.
Detailed Description
The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.
The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
Example 1 Sesbania genetic transformation Process
1. Construction of genetic transformation expression vectors:
a glyphosate-tolerant 5-enol-pyruvylshikimate-3-phosphate synthase (cEPSPS) of an Agrobacterium CP4 strain driven by a cauliflower mosaic virus (CaMV) 35S promoter is constructed on a pCAMBIA3301 vector backbone (28156ling biotechnology Cat: MLCC 9683) by a double digestion technique using restriction endonucleases NcoI and EcoRI to construct a recombinant over-expression vector Ip 35S-EPSPS, wherein the sequence of the p35S is shown as SEQ ID NO 1, and the sequence of the EPSPS is shown as SEQ ID NO 2.
SEQ ID NO:1
CATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAATTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCATTGAGATTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTATTGTGAAGATAGTGAAAGGAAGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTGCCGACAGTGTCCAAAGAGACCCCACCCAOGAGGAGCATCGTGGAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAACCACTATCTTCGCAAGACCTTCTCTATATAAGGATTTTATTGAGAGAACACGGGGGACT
SEQ ID NO:2
ATGCTTCACGGTGCAAGCAGCCGTCCAGCAACTGCTCGTAAGTCCTCTGGTCTTTCTGGAACCGTCCGTATTCCAGGTGACAAGTCTATCTCCCACAGGTCCTTCATGTTTGGAGGTCTCGCTAGCGGTGAAACTCGTATCACCGGTCTTTTGGAAGGTGAAGATGTTATCAACACTGGTAAGGCTATGCAAGCTATGGGTGCCAGAATCCGTAAGGAAGGTGATACTTGGATCATTGATGGTGTTGGTAACGGTGGACTCCTTGCTCCTGAGGCTCCTCTCGATTTCGGTAACGCTGCAACTGGTTGCCGTTTGACTATGGGTCTTGTTGGTGTTTACGATTTCGATAGCACTTTCATTGGTGACGCTTCTCTCACTAAGCGTCCAATGGGTCGTGTGTTGAACCCACTTCGCGAAATGGGTGTGCAGGTGAAGTCTGAAGACGGTGATCGTCTTCCAGTTACCTTGCGTGGACCAAAGACTCCAACGCCAATCACCTACAGGGTACCTATGGCTTCCGCTCAAGTGAAGTCCGCTGTTCTGCTTGCTGGTCTCAACACCCCAGGTATCACCACTGTTATCGAGCCAATCATGACTCGTGACCACACTGAAAAGATGCTTCAAGGTTTTGGTGCTAACCTTACCGTTGAGACTGATGCTGACGGTGTGCGTACCATCCGTCTTGAAGGTCGTGGTAAGCTCACCGGTCAAGTGATTGATGTTCCAGGTGATCCATCCTCTACTGCTTTCCCATTGGTTGCTGCCTTGCTTGTTCCAGGTTCCGACGTCACCATCCTTAACGTTTTGATGAACCCAACCCGTACTGGTCTCATCTTGACTCTGCAGGAAATGGGTGCCGACATCGAAGTGATCAACCCACGTCTTGCTGGTGGAGAAGACGTGGCTGACTTGCGTGTTCGTTCTTCTACTTTGAAGGGTGTTACTGTTCCAGAAGACCGTGCTCCTTCTATGATCGACGAGTATCCAATTCTCGCTGTTGCAGCTGCATTCGCTGAAGGTGCTACCGTTATGAACGGTTTGGAAGAACTCCGTGTTAAGGAAAGCGACCGTCTTTCTGCTGTCGCAAACGGTCTCAAGCTCAACGGTGTTGATTGCGATGAAGGTGAGACTTCTCTCGTCGTGCGTGGTCGTCCTGACGGTAAGGGTCTCGGTAACGCTTCT
GGAGCAGCTG
TCGCTACCCACCTCGATCACCGTATCGCTATGAGCTTCCTCGTTATGGGTCTCGTTTC
TGAAAACCCTGTTACTGTTGATGATGCTACTATGATCGCTACTAGCTTCCCAGAGTTC
ATGGATTTGATGGCTGGTCTTGGAGCTAAGATCGAACTCTCCGACACTAAGGCTGCT
TGA
2. And (3) agrobacterium transformation:
transforming agrobacterium competent cells EHA105, which are purchased from Shanghai Dinghai (China, shanghai, cat: AC 1010), by a 35S-EPSPS over-expression vector I to obtain successfully transformed p35S-EPSPS agrobacterium I; using an EPSPS gene as an indicator mark to verify a stable transformation system of the hypocotyl;
3. specific operation steps of genetic transformation
(1) Collecting mature bean pods from sesbania plants, removing shells, selecting full and spotless seeds, wrapping with gauze, boiling in a water bath kettle at 80 ℃ for 15min, sterilizing with 75% alcohol for 2 times, sterilizing with 40% NaCl for 2 times, and washing with sterile water for 15min each time for 4-5 times. And transferring the sterilized seeds to sterile paper, drying the sterilized seeds in a super clean bench, and putting the sterilized seeds into a sterile centrifuge tube for storage for later use.
(2) And (3) inoculating the sterilized sesbania seeds in a 1/2MS solid culture medium in an ultra-clean workbench, and scattering the seeds as much as possible to obtain the maximum growth space. And (3) placing the inoculated sesbania seeds in a 25-degree illumination culture room for culture, and expanding cotyledons of seedlings for about 7-10 days.
1/2MS solid medium composition: 2g/L of MS salt, 3g/L of B5 vitamin, 15g/L of sucrose and 10g/L of agar.
(3) After inoculating for 7-10 days, the sesbania cotyledons are placed on a pre-culture medium in an aseptic environment for pre-culture. The pre-culture medium is pre-treated for 2-4 days, preferably for 3 days.
The pre-culture medium consists of: MS salt 4.3g/L, B5 vitamin 3g/L, sucrose 20g/L, agar 10g/L, MES4g/L, auxin (IAA) 0.5mg/L, 6-benzyladenine (6-BAP) 1mg/L (pH 5.6). (4) Adding the cotyledon which grows well after pre-culture into an agrobacterium infection solution (OD 660= 0.4-0.6) which is transformed and identified to have a p35S-EPSPS overexpression vector for infection, wherein the agrobacterium infection solution is obtained by shaking and uniformly mixing agrobacterium containing a target gene expression vector in an infection solution containing acetosyringone with the concentration of 20 mg/L; and co-culturing the sterile cultured cotyledon and the agrobacterium infection solution for 5-10 minutes, preferably treating for 7 minutes, and blow-drying on sterilized filter paper after infection is finished. Then inoculating the cotyledon on the co-culture medium, and culturing at 22 deg.C for 2-4 days.
The composition of the co-culture medium is as follows: 3g/L of MS salt, 2g/L of B5 vitamin, 20g/L of sucrose, 10g/L of glucose, 2g/L of MES, 2mg/L of naphthylacetic acid (NAA), 20mg/L of AS, 50mg/L of cysteine and 8g/L of agar (pH 5.6).
(5) After the completion of the co-culture, recovery culture was carried out at 7-10d, and light culture was carried out at 25 ℃.
Recovery of medium composition: MS salt 3g/L, B5 vitamin 4g/L, MES 1g/L, sucrose 30g/L, kinetin (KT) 0.5mg/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L (pH5.6).
(6) Transferring the recovered tissue to a screening culture medium, performing light culture at 25 ℃ for 4 weeks, and screening to obtain resistant callus.
Screening medium composition: MS salt 2g/L, B5 vitamin 4g/L, MES 1g/L, sucrose 30g/L, cephamycin 0.2g/L, glyphosate 30-50mg/L, naphthalene Acetic Acid (NAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L (pH5.6).
(7) Transferring the screened resistant callus onto a differentiation medium, and culturing and differentiating at 25 ℃.
Composition of the differentiation medium: 2g/L of MS salt, 4g/L of B5 vitamin, 1g/L of MES, 30g/L of sucrose, 0.2g/L of cefamycin, 10-30mg/L of glyphosate, 1mg/L of Zeatin (ZT) and 8g/L of agar (PH 5.6).
(8) Transferring the differentiated seedlings to a rooting culture medium, culturing at 25 ℃ until the plant height is about 10cm, and transferring to a greenhouse for culturing.
The rooting medium comprises: 3g/L of B5 salt, 4g/L of B5 vitamin, 30g/L of sucrose, 8g/L of agar, 150mg/L of cefamycin and 0.2-1.0mg/L of naphthylacetic acid (NAA).
4. Identification of transgenic Positive plants
The sesbania plant transferred with the EPSPS gene is verified by using the common PCR amplification of 2 XEasyTaq PCR Supermix (China, beijing, cat: AS 111-11) of the whole gold company, and the PCR amplification obtains a transgenic plant with the size of 1368bp AS a positive transgenic sesbania containing the EPSPS gene in the genome.
The PCR primer sequence is:
EPSPS-F(SEQ ID NO:3)：ATGCTTCACGGTGCAAGEPSPS-R(SEQ ID NO:4)：TCAAGCAGCCTTAGTGTCG
the conditions for the PCR reaction were: 30 cycles, each cycle being 95 ℃ 30',58 ℃ 30',72 ℃ 40'.
The results show that 8 positive transgenic sesbania plants are finally identified, and the calculated transformation efficiency is 5% due to the fact that the number of the initial cotyledons is 150.
Example 2 optimization of sesbania genetic transformation method
This example is based on the following changes made in the genetic transformation procedure of example 1:
(1) Sesbania explant site replacement
Under the premise that other conditions are not changed, the sesbania cotyledons in the step (3) and the step (4) of the step (3) and the specific operation step of genetic transformation in the embodiment 1 are replaced by hypocotyls, the hypocotyls are cut into small sections of about 1cm by scissors or a scalpel, and the cut hypocotyls are uniformly placed on a pre-culture medium for pre-culture and subsequent steps.
(2) Optimization of agrobacterium infection steps
Under the premise that other conditions are not changed, the step (4) of step 3 of the specific operation step of genetic transformation in the embodiment 1 is infected with ultrasonic waves in an auxiliary mode, the concentration of the acetosyringone in the infection solution is adjusted to be 40mg/L, and the co-culture time of the sterile-cultured sesbania hypocotyl and the agrobacterium infection solution is prolonged to 5min.
The identification result shows that under the condition that the number of the initial hypocotyls is 150, 18 positive transgenic sesbania plants are obtained by screening, and the transformation rate reaches 12%.
In conclusion, in the agrobacterium infection process, the efficiency of inserting the foreign gene into the plant genome is obviously increased by optimizing various links such as the position of the explant, the concentration of acetosyringone in the infection solution, the co-culture time, the ultrasonic auxiliary treatment and the like, and the transformation efficiency of the sesbania is finally improved (from 5% to 12%).
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.
Claims (11)
1. A sesbania genetic transformation method is characterized by comprising the following steps:
(1) Preparation of sesbania aseptic seedlings: inoculating the sterilized sesbania seeds into a 1/2MS solid culture medium for culture to obtain aseptic seedlings;
(2) Pre-culturing explants: cutting an explant part from the aseptic seedling, and inoculating the explant to a pre-culture medium for pre-culture;
(3) Infection and co-culture: dip-dyeing the explant and an agrobacterium infection solution for 5-10min, wherein the agrobacterium infection solution contains acetosyringone, absorbing water of the explant after infection is finished, and placing the explant into a co-culture medium for dark culture for 2-4d to obtain a co-culture explant;
(4) And (3) recovery culture: subjecting the co-cultured explants to recovery culture at 25 ℃ in the light;
(5) Screening and culturing: transferring the recovered tissue to a screening culture medium, performing light culture at 25 ℃, and obtaining resistant callus after screening culture;
(6) Transferring the resistant callus onto a differentiation culture medium, and culturing and differentiating at 25 ℃ to obtain sesbania seedlings;
(7) Rooting culture: and transferring the sesbania seedlings to a rooting culture medium, and culturing at 25 ℃ until the height of the sesbania seedlings is about 10cm to obtain sesbania transgenic plants.
2. The genetic transformation method according to claim 1, wherein in step (1), the 1/2MS solid medium comprises: 2g/L of MS salt, 3g/L of B5 vitamin, 15g/L of sucrose and 10g/L of agar, and the culture time is 7-10 days.
3. The genetic transformation method according to claim 1, wherein in step (1), the sterilization is carried out by wrapping sesbania seeds with gauze, boiling in a water bath at 80 ℃ for 15min, sterilizing with 75% alcohol for 2 times, sterilizing with 40% NaCl for 2 times, rinsing with sterile water for 4-5 times for 15min, and removing surface moisture.
4. The genetic transformation method according to claim 1, wherein in step (2), the pre-culture medium comprises: 4.3g/L MS salt, 3g/L B5 vitamin, 20g/L sucrose, 10g/L agar, 4g/L MES, 0.5mg/L auxin (IAA), 1 mg/L6-benzyladenine (6-BAP), pH5.6, and culture time of 2-4 days, preferably 3 days.
5. The genetic transformation method according to claim 1, wherein in step (3), the agrobacterium infection solution has an OD660 of 0.4-0.6; the composition of the co-culture medium is as follows: MS salt 3g/L, B5 vitamin 2g/L, sucrose 20g/L, glucose 10g/L, MES 2g/L, naphthylacetic acid (NAA) 2mg/L, AS 20mg/L, cysteine 50mg/L, agar 8g/L, pH5.6, co-culture time of 2-4 days, and co-culture temperature of 22 ℃.
6. The genetic transformation method according to any one of claims 1 to 5, wherein the explant is the hypocotyl of sesbania; and (3) carrying out co-culture on the explants and the agrobacterium infection solution in the step (3) by using ultrasonic treatment, wherein the infection time is 5min, and the agrobacterium infection solution contains acetosyringone with the concentration of 40 mg/L.
7. The genetic transformation method according to any one of claims 1 to 5, wherein the explant is cotyledon of sesbania; at the moment, the time for infection of the explants cultured together with the agrobacterium infection solution in the step (3) is 2-4min, and the agrobacterium infection solution contains 20mg/L acetosyringone.
8. The genetic transformation method according to claim 1, wherein in step (4), the recovery medium has a composition of: 3g/L of MS salt, 4g/L of B5 vitamin, 1g/L of MES, 30g/L of sucrose, 0.5mg/L of Kinetin (KT), 1mg/L of 6-benzyladenine (6-BAP), 8g/L of agar, 150mg/L of cefamycin, 100mg/L of glutamic acid and 100mg/L of aspartic acid, pH5.6 and culture time is 7-10 days.
9. The genetic transformation method according to claim 1, wherein in step (5), the composition of the screening medium is: MS salt 2g/L, B5 vitamin 4g/L, MES 1g/L, sucrose 30g/L, cefomycin 0.2g/L, glyphosate 30-50mg/L, naphthalene Acetic Acid (NAA) 0.5mg/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, pH5.6, culture time is 4 weeks.
10. The genetic transformation method according to claim 1, wherein in step (6), the composition of the differentiation medium is: 2g/L of MS salt, 4g/L of B5 vitamin, 1g/L of MES, 30g/L of sucrose, 0.2g/L of cefamycin, 10-30mg/L of glyphosate, 0.5-3mg/L of Zeatin (ZT), 8g/L of agar and 5.6 of PH.
11. The genetic transformation method according to claim 1, wherein in step (7), the rooting medium consists of: 3g/L of B5 salt, 4g/L of B5 vitamin, 30g/L of sucrose, 8g/L of agar, 150mg/L of cefamycin and 0.2-1.0mg/L of naphthylacetic acid (NAA).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211452332.4A CN115710589B (en) | 2022-11-21 | 2022-11-21 | Genetic transformation method of sesbania |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211452332.4A CN115710589B (en) | 2022-11-21 | 2022-11-21 | Genetic transformation method of sesbania |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115710589A true CN115710589A (en) | 2023-02-24 |
| CN115710589B CN115710589B (en) | 2023-09-08 |
Family
ID=85233910
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211452332.4A Active CN115710589B (en) | 2022-11-21 | 2022-11-21 | Genetic transformation method of sesbania |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115710589B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705243A (en) * | 2009-11-13 | 2010-05-12 | 华南农业大学 | Application of method for smearing and transforming agrobacterium rhizogene-mediated hypocotyl to soybean transformation |
| CN102766650A (en) * | 2012-07-03 | 2012-11-07 | 吉林大学 | Agrobacterium rhizogenes-mediated and vacuum infiltration-assisted soybean genetic transformation method |
| CN109220076A (en) * | 2018-08-14 | 2019-01-18 | 江苏沿海地区农业科学研究所 | A kind of Sesbania seed processing method |
-
2022
- 2022-11-21 CN CN202211452332.4A patent/CN115710589B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101705243A (en) * | 2009-11-13 | 2010-05-12 | 华南农业大学 | Application of method for smearing and transforming agrobacterium rhizogene-mediated hypocotyl to soybean transformation |
| CN102766650A (en) * | 2012-07-03 | 2012-11-07 | 吉林大学 | Agrobacterium rhizogenes-mediated and vacuum infiltration-assisted soybean genetic transformation method |
| CN109220076A (en) * | 2018-08-14 | 2019-01-18 | 江苏沿海地区农业科学研究所 | A kind of Sesbania seed processing method |
Non-Patent Citations (1)
| Title |
|---|
| 王慧中等: "豆科植物田菁农杆菌转化的研究", 遗传, vol. 14, no. 5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115710589B (en) | 2023-09-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6858777B2 (en) | Methods for stable transformation of plants | |
| CN101948867B (en) | Agrobacterium-mediated jatropha curcas gene transformation method | |
| US7910803B2 (en) | Transformation in Camelina sativa | |
| US20090151023A1 (en) | Transformation system for Camelina sativa | |
| JP2005535312A (en) | Method for transforming soybean | |
| WO2000012735A9 (en) | Transgene assay using stable agrobacterium rhizogenes transformation | |
| CN114561426A (en) | Genetic transformation method of alfalfa | |
| CN116411021B (en) | Conversion method of tomato glyphosate screening system | |
| EP1745132B1 (en) | Methods for high efficiency transformation and regeneration of plant suspension cultures | |
| CN112553248A (en) | Establishment method and genetic transformation method of Miscanthus stramineus genetic transformation system | |
| Amin et al. | Regeneration study of some Indica rice cultivars followed by Agrobacterium-Mediated transformation of highly regenerable cultivar BR-8 | |
| CN115710589B (en) | Genetic transformation method of sesbania | |
| Chen et al. | Agrobacterium-mediated genetic transformation of peanut and the efficient recovery of transgenic plants | |
| CN114921490B (en) | Genetic transformation method for agrobacterium-mediated white clover callus | |
| WO2002012521A1 (en) | Method of improving gene transfer efficiency into plant cells | |
| CN113755521B (en) | Construction method of agrobacterium-mediated strawberry 'sweet Charles' genetic transformation system | |
| CN104017823B (en) | Screening method for fast and effectively reducing false positive rate of peanut genetic transformation plant | |
| EP1196024B1 (en) | Novel method for the generation and selection of transgenic linseed/flax plants | |
| CN113512523A (en) | Preparation method of sterile pineapple explant and agrobacterium transformation method thereof | |
| KR101174491B1 (en) | Method for increasing transformation efficiency of Chinese cabbage plant using Agrobacterium and Chinese cabbage plant produced by the method | |
| CN117384946A (en) | Agrobacterium tumefaciens-mediated radish genetic transformation method and application thereof | |
| CN116515898A (en) | Agrobacterium-mediated genetic transformation method for red-bolt cabbage mustard | |
| CN114342802A (en) | Method for creating heat-resistant wheat mutant by using cell engineering technology | |
| CN101250518A (en) | Ramie highly effective genetic transformation method | |
| CN114606258A (en) | Genetic transformation method for feeding bermuda grass |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |