CN115703996A - Trichoderma reesei strain for high xylanase yield and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, and particularly provides trichoderma reesei for high xylanase yield and application thereof. The Applicant first came from Penicillium decumbens (Penicillium decumbens) The xylanase gene is produced in Trichoderma reeseiMainly carrying out over-expression to construct a recombinant expression strain; then, the strain is used as a starting strain to carry out ultraviolet mutagenesis, and a mutant strain capable of greatly improving the expression quantity of xylanase is obtained by screening, wherein the preservation number is CCTCC NO: m2021920. The mutant strain can be widely applied to the production of xylanase, and is beneficial to reducing the production cost of the xylanase.

Description

Trichoderma reesei strain for high xylanase yield and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a Trichoderma reesei strain for high yield of xylanase and application thereof.

Technical Field

Xylan (Xylan) is the major component of plant hemicellulose, accounting for about one third of the plant's dry weight. Is polysaccharide which is most abundant in nature except cellulose, and is also one of the most abundant renewable resources in nature. The beta-1,4-glycosidic bond connects beta-D-xylopyranose residues to form the main chain of xylan, and side chain substituents thereof are various. Xylan exists in plant cell walls in nature, has a complex structure, and is mostly heterogeneous polysaccharide. The degradation of xylan is mainly dependent on xylanase enzymolysis, and xylanase is a combination of a series of enzymes for degrading xylan instead of a single enzyme according to the complexity and diversity of xylan. At present, the most studied xylanases come from fungi and bacteria in microorganisms, wherein the fungi can only produce alkaline xylanase, and the bacteria can produce both alkaline xylanase and acidic xylanase. And (3) randomly cutting the main chain of the xylan by the xylanase to obtain xylo-oligosaccharide, xylose and arabinose degradation products.

Xylanase has wide application in the fields of food, feed and paper making. When the xylanase is used as a feed additive in animal feed, the xylanase can degrade crude fibers, so that the absorption of nutrients in the feed by animals is promoted; the xylanase can reduce the addition of chemical reagents by cooperating with other enzymes in the process of pulp bleaching, improve the bleaching quality and the damage of the paper industry to the environment; degrading agricultural wastes such as straws, corncobs and the like by xylanase to generate soluble pentose so as to produce products such as xylo-oligosaccharide, ethanol and the like and realize biomass resource regeneration; the xylanase can be used as flour dough, bread baking and steamed bread improver to be applied to flour products.

In addition, xylooligosaccharide, a hydrolysis product of xylanase, is a functional oligosaccharide, and is a mixture which is obtained by hydrolyzing beta-1,4 glycosidic bonds of xylan by using endo-xylanase and takes xylobiose, xylotriose, xylotetraose and xylopentaose as main components. It has obvious effect in promoting the proliferation of bifidobacterium and other intestinal probiotics, lowering serum cholesterol, regulating blood sugar, promoting the absorption of calcium in intestinal tract, improving constipation, etc. The reaction of the process of producing the xylo-oligosaccharide by using the xylanase through the enzyme method is mild, the enzyme has specificity, and the purity of the xylo-oligosaccharide in the product is high, so that the method is the most common method for producing the xylo-oligosaccharide at present. Sun Juntao et al show that under the conditions that the ultrasonic temperature is 60 ℃, the ultrasonic power is 300W, the xylanase and cellulase form a complex enzyme according to the proportion of 3:2, the addition amount of the complex enzyme is 1%, the enzymolysis time is 20min, the feed-liquid ratio is 1 (g/mL). Tang Yanbin, etc. reports that when the alkaline pretreatment solution of soybean straw is added with the thermophilic ankle bacteria xylanase, the experimental conditions are that the substrate concentration is 1.0%, the enzyme addition amount is 30U/mL, the temperature is 60 ℃, and the xylo-oligosaccharide yield can reach 24.2% after 240 min. Liu Guofeng and other research results show that the neutral bacterial xylanase has the function of remarkably improving functional oligosaccharide in beer products, and when the enzymolysis temperature is 50 ℃ and the addition amount of the xylanase is 110U/g, the yield of xylooligosaccharide is the highest and is 0.621 g/L.

At present, the production cost of xylanase is generally higher, and the wide application of xylanase in the production of xylo-oligosaccharide is severely limited, so how to improve the yield of xylanase is a research focus in the current field.

Disclosure of Invention

The invention provides trichoderma reesei for high xylanase yield and application thereof, aiming at solving the problems of the prior art. The Applicant first came from Penicillium decumbens (Penicillium decumbens) The xylanase gene is over-expressed in a trichoderma reesei host, and a recombinant expression strain is constructed; then the strain is used as a starting strain to carry out ultraviolet mutagenesis, and a mutant strain capable of greatly improving the expression quantity of xylanase is obtained by screening. The mutant strain can be widely applied to the production of xylanase, and is beneficial to reducing the production cost of the xylanase.

The invention provides a trichoderma reesei engineering bacterium which carries an expression vector for recombining and expressing xylanase genes.

The amino acid sequence of the xylanase is SEQ ID NO:1, the coding nucleotide sequence of which is SEQ ID NO:2.

the invention provides a trichoderma reesei mutant strain which is obtained by taking the trichoderma reesei engineering bacteria as a spawn and adopting an ultraviolet mutagenesis method.

The mutant strain is named as Trichoderma reesei MQ20 (Trichoderma reesei MQ 20), and has been preserved in the China center for type culture Collection of Wuhan university in Wuhan, china at 7 months and 21 days in 2021, with the preservation number of CCTCC NO: M2021920.

The invention also provides application of the trichoderma reesei mutant strain in xylanase production.

The invention is derived from Penicillium decumbens (Penicillium decumbens) The xylanase gene of (A) in Trichoderma reesei (Trichoderma reesei) (III)Trichoderma reesei) The host is over-expressed, the constructed recombinant expression strain Trichoderma reesei MQ1 is fermented in a 30L tank for 160h, and the enzyme activity of the xylanase reaches 7610u/ml.

The trichoderma reesei MQ1 is taken as a spawn, the mutant strain trichoderma reesei MQ20 obtained by screening through an ultraviolet mutagenesis method is fermented in a 30L tank for 160h, the enzyme activity of xylanase is up to 16429u/ml, the enzyme activity is improved by 116% compared with that of the starting strain trichoderma reesei MQ1, and unexpected technical effects are obtained. The Trichoderma reesei mutant strain can be widely applied to the production of xylanase, thereby being beneficial to reducing the production cost of the xylanase and promoting the wide application of the xylanase in the field of xylo-oligosaccharide production.

Drawings

FIG. 1 is a map of plasmid pTG;

FIG. 2 is a graph of a 30L tank fermentation.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

The present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 cloning of xylanase Gene and construction of recombinant vector

The applicant will derive from Penicillium decumbens (Penicillium decumbens) The xylanase gene of (2) is codon optimized according to the codon preference of trichoderma reesei, a 6-base TCTAGA (Xba I cleavage site) is added before the 1 st amino acid codon, a TCTAGA (Xba I cleavage site) is added after the termination codon TAA, and the optimized nucleotide sequence is synthesized by the Shanghai Czeri bioengineering company. The amino acid sequence of the xylanase is SEQ ID NO. 1, and the coding nucleotide sequence is SEQ ID NO. 2.

The xylanase gene was amplified by PCR. The primer sequences are as follows:

primer 1 (F): GCTCTAGAATGGTTCATCTGTCTGCCACC；

Primer 2 (R): GCTCTAGATTACAAGCACTGAGAGTACCA。

The PCR reaction conditions are as follows: denaturation at 94 deg.C for 5min; then, 30 cycles of denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 70s, and heat preservation at 72 ℃ for 10min. Agarose gel electrophoresis results showed that the xylanase gene was a 1233bp fragment.

And (3) performing single restriction enzyme digestion on the xylanase gene fragment and an expression vector pTG by using a restriction enzyme XbaI under the following digestion conditions:

PCR fragment digestion system (50 ul)	Plasmid pTG restriction system (50 ul)
		PCR fragment 20ul	pTG plasmid 20ul
10*M 5ul	10*M 5ul
		BSA 5ul	BSA 5ul
XbaI 2ul	XbaI 2ul
		ddH 2 O 18ul	ddH 2 O 18ul

Carrying out enzyme digestion treatment for 2h in water bath at 37 ℃, respectively recovering two target fragments after electrophoresis, and dissolving in 20ul ddH ₂ And O. Ligation was performed with T4 DNA ligase in the following system:

PCR fragments	2ul
		pTG	2ul
10*Buffer	1ul
		T4 DNA ligase	1ul
ddH 2 O	4ul
		Total volume	10ul

The cells were ligated at 22 ℃ for 1 hour to transform E.coli DH5a competent cells, plated with LB + AMP, and cultured overnight at 37 ℃ to grow single colonies. And verifying the correctly connected transformant through colony PCR, extracting plasmids, sequencing, and obtaining the recombinant vector pTG-MQ containing the xylanase gene after sequencing is correct.

EXAMPLE 2 construction of xylanase recombinant expression strains

1. Preparing protoplasts:

inoculating host strain Trichoderma reesei 4Q to PDA + U (potato 200g/L, boiling for 20-30min, filtering to remove residue, glucose 2%, uridine 1%, and agar powder 1.5%), and culturing at 30 deg.C for 5-7d; cutting 2cm × 2 cm-sized fungus block, inoculating 100ml liquid PDA + U (potato 200g/L, boiling for 20-30min, filtering to remove residue, glucose 2%, and uracil 1%) culture medium, and culturing at 30 deg.C for 16 hr to grow mycelium for transformation; the grown mycelia were filtered and resuspended in 20ml of 1.2M magnesium sulfate solution; adding 0.2g of lysozyme, culturing at 30 ℃ and 100rpm for 2-3h; filtering the cracked mycelium with 2 layers of mirror paper, centrifuging at 3000rpm for 10min to obtain protoplast; filtering the cracked mycelium with a piece of lens wiping paper, and centrifuging to obtain a protoplast; then, the mixture is resuspended by using a proper amount of sorbitol solution.

2. And (3) transformation:

washing the obtained trichoderma reesei 4Q protoplast with 1.2M sorbitol solution for 2 times, and then re-suspending with appropriate amount of sorbitol solution to make the protoplast concentration reach 10 ⁸ Per ml; adding 10ul of the prepared recombinant vector pTG-MQ into every 200ul of protoplast, adding 50ul of 25% PEG6000, ice-cooling for 20min, adding 2ml of 25% PEG6000, and standing at room temperature for 5min; adding 4ml sorbitol solution, mixing, pouring 50ml conversion upper layer culture medium, pouring into 4 conversion lower layer flat plates, solidifying the upper layer culture medium, and culturing in 30 deg.C incubator for 5d.

3. And (3) transformant screening:

after 5 days of culture, the grown colonies are picked up, spotted on a transformation lower layer plate for re-screening, and cultured for 3 days at 30 ℃. The transformants which grew normally were inoculated into fresh PDA plates, respectively, and cultured at 30 ℃ for 5-7 days. Each transformant was harvested into 2cm × 2 cm-sized clumps, inoculated into 50ml of liquid shake flask medium (1% glucose, 2% lactose, 1.5% corn steep liquor, 0.9% ammonium sulfate, 0.15% magnesium sulfate, 0.073% citric acid, 0.1125% calcium chloride, 0.1% trace elements) respectively, fermented at 28 ℃ for 5 days. After culturing for 5 days, centrifuging the thalli to obtain supernatant fluid which is crude enzyme liquid, and carrying out SDS-PAGE protein electrophoresis detection and xylanase enzyme activity detection.

(1) Definition of xylanase enzyme Activity units

The enzyme amount required for releasing 1 mu mol of reducing sugar from the xylan solution with the concentration of 5 mg/ml per minute is one enzyme activity unit U under the conditions of 37 ℃ and pH value of 5.5.

(2) And a measuring method

Taking a xylan substrate (prepared by a pH5.5 acetic acid-sodium acetate buffer solution) with the concentration of 2ml of 1 percent, adding the xylan substrate into a colorimetric tube, balancing for 10min at 37 ℃, adding an acidic xylanase enzyme solution which is properly diluted by 2ml through the pH5.5 acetic acid-sodium acetate buffer solution and well balanced at 37 ℃, uniformly mixing, and accurately preserving heat at 37 ℃ for reaction for 30 min. After the reaction was completed, 5ml of DNS reagent was added and mixed well to terminate the reaction. Boiling in boiling water bath for 5min, and cooling with tap water to room temperatureAdding distilled water to constant volume of 25 ml, mixing, taking standard blank sample as blank control, and measuring light absorption value at 540 nmA _E 。

The enzyme activity calculation formula is as follows:

X _D =

。

in the formula: x _D For the activity of xylanase in the diluted enzyme solution, U/ml;A _E the absorbance of the enzyme reaction solution;A _B is the absorbance of the enzyme blank; k is the slope of the standard curve; c ₀ Is the intercept of the standard curve; m is the molar mass of xylose, 150.2 g/mol; t is enzymolysis reaction time, min; n is the dilution multiple of enzyme solution; 1000 is the conversion factor, 1 mmol =1000 μmol.

The detection result shows that the highest xylanase activity in the fermentation supernatant of the positive transformant obtained by the construction can reach 356U/ml. The applicant named the positive transformant with the highest activity of the fermentation enzyme as Trichoderma reesei MQ1 (C.) (Trichoderma reesei MQ1）。

Example 3 mutagenesis screening

The mutation caused by ultraviolet mutagenesis has strong randomness, and the effect generated by mutation is random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, the screening workload is large, and there is a possibility that effective positive mutations cannot be obtained. However, ultraviolet mutagenesis requires simple equipment and low cost, and can obtain a large number of mutants in a short time, so that it is still a common mutagenesis breeding method.

The applicant takes Trichoderma reesei MQ1 as an original strain, and carries out genetic modification on the strain by an ultraviolet mutagenesis method, thereby further improving the yield of xylanase.

1. Determination of the mortality rate:

inoculating the original strain Trichoderma reesei MQ1 to a PDA plate, and culturing at 30 ℃ for 5-7d. When a large amount of spores are generated on the surface of the colony, 5ml of sterile water is absorbed for elution to obtain a spore liquid, the spore liquid is resuspended by the sterile water after centrifugation, and a blood counting chamber is used for counting. GetA90 mm petri dish was filled with 5ml of diluted spore suspension (concentration 1X 10) ⁷ Pieces/ml) were added to a rotor and stirred on a magnetic stirrer to make the spore liquid homogeneous. Irradiating with ultraviolet lamp with power of 9w at a vertical distance of 20cm in a sterile ultra-clean bench for 30s, 45s, 60s, 75s, 90s, 105s and 120s, diluting the irradiated spore solution for 10, 100 and 1000 times, coating 100ul PDA plate, culturing at 30 deg.C for 2-3d, counting, and calculating lethality with unirradiated spore solution as control. Wherein the lethality is 95% when the irradiation time is 90s, and the irradiation time is selected for subsequent mutagenesis experiments.

2. First round mutagenesis screening:

a90 mm petri dish was taken and 5ml of diluted spore suspension (concentration 1X 10) was added ⁷ Pieces/ml) were added to a rotor and stirred on a magnetic stirrer to make the spore liquid homogeneous. Irradiating with ultraviolet lamp with power of 9w in sterile ultra-clean bench at vertical distance of 20cm for 90s, diluting 1000 times, coating 100ul PDA plate, and culturing at 30 deg.C for 2-3d.

A total of 300 PDA plates were plated and cultured at 30 ℃ for 2-3 days, each plate developing 30-50 colonies. The mutants with short branches are screened out by colony morphology. 89 mutants with small colony morphology, dense hyphae and short villi around the colony are selected, respectively inoculated to a PDA plate, and cultured at 30 ℃ for 5-7 days. Each transformant was cut into 2cm × 2cm pieces, inoculated into 50ml liquid shake flask medium, fermented, and cultured at 28 deg.C for 5 days. After culturing for 5 days, centrifuging the thallus to obtain supernatant, respectively carrying out protein electrophoresis detection and xylanase enzyme activity detection, and taking the outbreak MQ1 as a control group.

The result shows that the xylanase activity in the fermentation supernatant of no 89 mutant bacteria in 89 mutant bacteria obtained by the first round of ultraviolet mutagenesis screening is higher than that of the original bacteria; wherein, the enzyme activity of 85 mutant strains is basically equivalent to that of the original strain, and the enzyme activity of the rest 4 mutant strains is even lower than that of the original strain.

The applicant carries out 26 rounds of mutagenesis screening according to the method, and finally obtains a mutant strain with xylanase yield remarkably higher than that of the original strain, namely the mutant strain is named as Richterella freeborealisTrichoderma MQ20 (Trichoderma reeseiMQ 20). The xylanase activity in the mutant strain shake flask fermentation supernatant reaches 697U/ml, which is 96% higher than that of the original strain, and unexpected technical effect is obtained.

EXAMPLE 4 30L tank fermentation Scale-Up

Fermenting original fungus Trichoderma reesei MQ1 and mutant fungus Trichoderma reesei MQ20 in a 30-liter fermentation tank respectively, wherein the formula of a culture medium used for fermentation is as follows: 10g/L glucose, 20g/L lactose, 9g/L ammonium sulfate, 1.125 g/L calcium chloride, 1.5 g/L magnesium sulfate, 0.73 g/L citric acid, 20g/L potassium dihydrogen phosphate, 4g/L diammonium hydrogen phosphate, 15ml/L corn steep liquor and 0.05% defoaming agent. A supplemented medium: the concentration of liquid sugar is 400g/L, and the pH is adjusted to be between 4.0 and 5.0.

The fermentation production process comprises the following steps: the pH value is 4.0, the temperature is 30 ℃, the stirring speed is 300-700rpm, the ventilation volume is 1.0-1.5 (v/v), and the dissolved oxygen is controlled to be more than 20%.

The whole fermentation process is divided into three stages: the first stage is a thallus culture stage, seeds are inoculated according to the proportion of 7 percent, and the mixture is cultured at the temperature of 30 ℃ for 15-25 h, and the dissolved oxygen is recovered and used as a mark; the second stage is a hungry stage, when the sugar is consumed, no carbon source is added, and the dissolved oxygen rises to more than 60 percent to indicate that the second stage is finished, wherein the period is about 30-120 min; the third stage is an enzyme production stage, enzyme production culture is carried out by feeding a feed supplement culture medium, the dissolved oxygen is kept above 20 percent, the concentration of reducing sugar in the fermentation liquor is maintained to be not less than 1g/L, and the fermentation period is 140-170 h. After the fermentation is finished, the fermentation liquor is processed by a plate and frame filter to obtain a crude enzyme liquid.

By measuring the enzyme activity of xylanase in the fermentation broth at different times, a fermentation process curve can be obtained (fig. 2).

The results show that: after fermenting for 160h, the enzyme activity of xylanase in the supernatant obtained by fermenting the original strain trichoderma reesei MQ1 reaches 7610u/ml, and the enzyme activity of the mutant strain trichoderma reesei MQ20 reaches 16429u/ml, so that the enzyme activity is improved by 116% compared with that of the original strain, and unexpected technical effects are achieved.

The applicants have introduced the mutant strain Trichoderma reesei MQ20 (21/7/2021: (R))Trichoderma reeseiMQ 20) is preserved in the China center for type culture Collection of the university of Wuhan, chinaThe preservation number is CCTCC NO: m2021920.

Example 5 application of xylanase in production of xylooligosaccharide

Taking the corncob cooking liquor as a reaction substrate, adding the trichoderma reesei MQ20 fermentation supernatant for enzymolysis. The application effect of the xylanase is evaluated by detecting the content of xylooligosaccharide in an enzymolysis product through a high performance liquid chromatography.

Respectively taking 5 test tubes, adding 10ml of corncob cooking liquor into each test tube, calculating the adding amount according to the xylanase activity, enabling the final xylanase activity in a reaction system to be 0, 5, 10, 20 and 30U respectively, uniformly mixing, and reacting for 8 hours in a 55 ℃ water bath kettle. Boiling to inactivate enzyme, and performing high performance liquid detection.

The instrument comprises the following steps: waters 2695;

a detector: a difference detector;

a chromatographic column: a calcium-based column;

column temperature: 90 ℃;

mobile phase: water;

flow rate: 0.3ml/min.

And respectively calculating the peak areas of the monosaccharide and the xylobiose-xyloheptaose, and summing to calculate the peak area of the total saccharide. The content of each saccharide is equal to the peak area of that saccharide divided by the peak area of the total saccharide. The results are shown in the following table.

Numbering	1	2	3	4	5
						Amount of enzyme added (U/ml)	0	0.5	1	2	3
Monosaccharide content (%)	43.99	34.04	21.62	20.12	20.60
						Xylobiose content (%)	13.10	16.20	20.21	25.34	33.41
Xylobiose-xylotetraose content (%)	46.34	57.17	52.94	60.16	66.01
						Xylobiose-xyloheptaose content (%)	46.34	57.17	78.38	79.88	79.40

As can be seen from the data in the table, after the trichoderma reesei MQ20 fermentation supernatant is added, the content of xylobiose is increased by 23.7-155.0%; the total content of the xylobiose-xylotetraose and the total content of the xylobiose-xyloheptaose are respectively increased by 23.4-42.4% and 23.4-71.3%. Therefore, the mutant strain Trichoderma reesei MQ20 fermentation xylanase provided by the invention can be widely applied to xylo-oligosaccharide production, and has obvious effect.

Sequence listing

<110 Weifang kang lawn biotechnology Limited

Qingdao Ulan Kangcheng Biological Technology Co.,Ltd.

QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

<120> Trichoderma reesei strain for high xylanase yield and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 410

<212> PRT

<213> Penicillium decumbens (Penicillium decumbens)

<400> 1

Met Val His Leu Ser Ala Thr Ser Leu Leu Leu Ala Ala Gly Ile Leu

1 5 10 15

Pro Asn Leu Ala Leu Gly Ala Gly Leu Asn Asp Ala Ala Lys Ala Ile

20 25 30

Gly Gln Val Tyr Phe Gly Ser Ala Thr Asp Asn Pro Glu Leu Ser Asp

35 40 45

Ser Ala Tyr Val Lys Gln Leu Ser Asn Thr Ala Asp Phe Gly Gln Ile

50 55 60

Thr Pro Gly Asn Ser Gln Lys Trp Asp Ala Thr Glu Pro Ser Arg Asn

65 70 75 80

Val Phe Thr Phe Ser Gly Gly Asp Thr Val Ala Lys Leu Ala Gln Ser

85 90 95

Asn Gly Gln Lys Leu Arg Cys His Asn Leu Val Trp His Ser Gln Leu

100 105 110

Pro Ser Trp Val Thr Asn Gly Asn Phe Asn Asn Ala Thr Leu Ile Ser

115 120 125

Ile Met Lys Asn His Ile Thr Asn Leu Val Gln His Tyr Lys Gly Gln

130 135 140

Cys Tyr Ala Trp Asp Val Val Asn Glu Ala Leu Asn Glu Asp Gly Ser

145 150 155 160

Tyr Arg Gln Ser Val Trp Tyr Asn Thr Ile Gly Pro Ala Tyr Leu Pro

165 170 175

Ile Ala Phe Ala Thr Ala Ala Ser Val Asp Pro Thr Val Lys Leu Tyr

180 185 190

Tyr Asn Asp Tyr Asn Ile Glu Tyr Ser Gly Ala Lys Ala Ala Gly Ala

195 200 205

Arg Arg Ile Val Glu Leu Val Gln Ser Tyr Gly Ala Lys Ile Asp Gly

210 215 220

Val Gly Leu Gln Ala His Phe Ile Val Gly Ser Thr Pro Ser Lys Asp

225 230 235 240

Asp Gln Lys Lys Val Met Ala Gly Tyr Thr Ala Tyr Gly Val Glu Val

245 250 255

Ala Ile Thr Glu Leu Asp Ile Arg Met Asn Leu Pro Ser Thr Asn Ala

260 265 270

Gln Leu Thr Gln Gln Ala Thr Asp Tyr Ser Asn Thr Val Ser Ala Cys

275 280 285

Val Glu Thr Lys Asn Cys Val Gly Ile Thr Ile Trp Asp Trp Thr Asp

290 295 300

Lys Tyr Ser Trp Val Pro Ser Thr Phe Ser Gly Gln Gly Ala Ala Cys

305 310 315 320

Pro Trp Asp Ser Asn Phe Gln Lys Lys Pro Ala Tyr Asn Ala Ile Leu

325 330 335

Asn Ala Leu Asn Ala Gly Ser Ser Thr Gly Gly Gly Ser Pro Thr Thr

340 345 350

Thr Thr Thr Thr Thr Ala Ala Ala Thr Thr Thr Thr Ala Pro Gly Gly

355 360 365

Ser Gly Ser Thr Gly Gly Met Ala Gln His Trp Gly Gln Cys Gly Gly

370 375 380

Asn Gly Trp Thr Gly Pro Thr Thr Cys Ala Ser Pro Tyr Thr Cys Gln

385 390 395 400

Ala Ser Asn Pro Trp Tyr Ser Gln Cys Leu

405 410

<210> 2

<211> 1233

<212> DNA

<213> Penicillium decumbens (Penicillium decumbens)

<400> 2

atggttcatc tgtctgccac ctccctgctt ttggcagcgg gaatcttgcc caatcttgcc 60

ctcggtgccg gattgaacga cgctgccaaa gcaatcggac aggtctactt cggatccgct 120

accgacaatc ctgaactgag tgattctgcc tacgtcaagc agctcagcaa cacagccgat 180

tttggccaga tcacgcctgg aaactcccaa aagtgggatg ccacagagcc atcgcgaaat 240

gtcttcacct tctctggagg tgacactgtt gccaaattgg ctcagtccaa tggccaaaag 300

ctgcgatgcc acaacctggt ctggcacagc cagcttccta gctgggttac caacggcaac 360

ttcaacaatg cgacgttgat ttccatcatg aagaaccaca tcaccaacct ggtccagcac 420

tacaaagggc agtgctacgc gtgggacgtc gtgaacgagg ctctgaacga ggacggatca 480

tatcgccaga gtgtttggta taacaccatc ggcccggcct acctccccat cgcctttgcc 540

actgctgcta gtgtggaccc tactgtcaaa ctctactaca atgattacaa cattgagtac 600

tccggcgcca aggccgccgg tgcccgaaga attgtcgagc ttgttcagtc ctacggtgcc 660

aagatcgacg gagttggtct ccaggctcac ttcatcgtcg gcagcacccc cagcaaggac 720

gaccaaaaga aggtcatggc cggttacact gcctacggag ttgaggttgc catcacggaa 780

cttgacattc gtatgaactt gccctcgacc aatgcgcagc tcacccagca ggccaccgac 840

tacagcaaca ccgtcagcgc ctgtgttgag accaagaact gcgtcggtat taccatctgg 900

gactggactg acaagtactc ctgggttcca agcactttct ctggacaagg cgcggcctgc 960

ccctgggact ccaacttcca gaagaagcct gcctacaacg ctattctgaa cgccctgaac 1020

gctggcagca gcaccggcgg tggctcaccc actaccacca ccaccaccac tgccgccgcg 1080

acgaccacca ctgcccccgg tggaagcgga tctactggtg gcatggctca gcactgggga 1140

cagtgcggtg gtaacggctg gactggccct actacctgcg ccagccccta cacttgccag 1200

gcctccaacc cctggtactc tcagtgcttg taa 1233

Claims (7)

1. The trichoderma reesei engineering bacterium is characterized in that the trichoderma reesei engineering bacterium carries an expression vector for recombining and expressing xylanase genes.

2. The trichoderma reesei engineered bacterium of claim 1, wherein the xylanase has an amino acid sequence of SEQ ID No. 1 and a coding nucleotide sequence of SEQ ID No. 2.

3. The trichoderma reesei mutant strain is characterized in that the trichoderma reesei mutant strain is obtained by taking the trichoderma reesei engineering strain of claim 2 as a spawn and performing ultraviolet mutagenesis.

4. The Trichoderma reesei mutant strain of claim 3, wherein the preservation number of the Trichoderma reesei mutant strain is CCTCC NO: M2021920.

5. Use of the mutant strain of trichoderma reesei of claim 3 or 4 for producing xylanase.

6. A xylanase produced by using the Trichoderma reesei mutant strain of claim 4 as a fermentation strain.

7. Use of the xylanase of claim 6 in the production of xylo-oligosaccharides.

Images