CN110423701B

CN110423701B - Aspergillus niger strain for high yield of arabinofuranosidase

Info

Publication number: CN110423701B
Application number: CN201910512907.9A
Authority: CN
Inventors: 徐晓东; 刘文瑶; 朱倩倩
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2019-06-14
Filing date: 2019-06-14
Publication date: 2022-10-28
Anticipated expiration: 2039-06-14
Also published as: CN110423701A

Abstract

The invention provides an aspergillus niger strain for high yield of arabinofuranosidase and application thereof. The applicant firstly constructs an aspergillus niger engineering strain for recombining and expressing the arabinofuranosidase gene, and then further screens by an ultraviolet mutagenesis method to obtain a mutant strain with high yield of the arabinofuranosidase, wherein the preservation number of the mutant strain is CCTCC NO: M2019433. The mutant bacteria are beneficial to reducing the production cost of the arabinofuranoside, and have wide application prospects.

Description

Aspergillus niger strain for high yield of arabinofuranosidase

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an aspergillus niger strain capable of highly producing arabinofuranosidase and application thereof.

Technical Field

In nature, hemicellulose is the second most abundant polysaccharide next to cellulose as the main component of plant cell walls, and has profound biological significance for improving the biodegradation performance. Xylan is a representative main component in hemicellulose, the structure of the xylan is very complex, a main chain D-xylopyranose is formed by connecting beta-1, 4 glycosidic bonds, and different substituents such as arabinose, glucuronic acid, ferulic acid ester group, acetyl group and the like are also connected to a side chain, so that the complete degradation of xylan can be completed under the combined action of a plurality of enzymes. The xylanase is used as a main enzyme to act on a main chain of xylan in an endo mode, and the arabinofuranosidase is a side chain degrading enzyme and plays an important role in promoting the degradation of the main chain.

Arabinofuranosidases belong to the family of glycosyl hydrolases and can be classified into two classes, β -L-arabinofuranosidases (β -L-arabinofuranosidases) and α -L-arabinofuranosidases (α -L-arabinofuranosidases, anabf a), depending on the substrate conformation. beta-L-arabinofuranosidases can degrade beta-L-arabinose residues from the non-reducing end of a variety of substrates. Anabf a is hydrolyzed from the non-reducing end of polymers such as Arabinoxylans (AX), arabinans (arabinans) and arabinogalactans (arabinogalactams) to produce an α -L-arabinose molecule. Arabinose residues occurring in nature are mainly α -L-arabinose residues.

As one of hemicellulose degrading enzyme systems, alpha-L-arabinofuranosidase participates in the reutilization of low-price agricultural product residues to produce monosaccharide and other byproducts which can be used for generating fuel ethanol through fermentation, so that the alpha-L-arabinofuranosidase has a good application prospect in the agricultural-industrial industry. In the feed industry, cellulose and hemicellulose are the main energy sources for ruminants, but due to their low degradation rates, only 40-60% are actually utilized by animals. The arabinofuranosidase as a feed additive removes arabinose side chains on xylan, promotes the degradation of the xylan and is easy to digest and absorb by animals. Arabinofuranosidases are also widely used in the food industry. The L-arabinose serving as a sweetening agent with low intake can replace the traditional cane sugar, and is suitable for the old and patients with hyperglycemia. Meanwhile, the health-care product can also block the absorption of a human body to cane sugar, and has good application prospects in the aspects of losing weight and controlling diabetes. The arabinofuranosidase can also increase the concentration of terpene alcohol in the wine-making process, improve the fragrance of wine, and is applied to the fruit juice production industry because it removes arabinose side chains, hydrolyzes arabinoside into short-chain soluble substances, and increases the clarity of fruit juice.

In nature, the sources of alpha-L-arabinofuranosidase are wide. Researchers have discovered and isolated alpha-L-arabinofuranosidase genes from fungi, bacteria and plants and successfully expressed heterologously. However, the yield of the alpha-L-arabinofuranosidase in the existing production strains is generally low, so that the production cost of the alpha-L-arabinofuranosidase is high, and the application of the alpha-L-arabinofuranosidase is limited.

Disclosure of Invention

The invention provides an aspergillus niger strain for high yield of arabinofuranosidase and application thereof, aiming at solving the problems in the prior art. The applicant firstly constructs an Aspergillus niger engineering strain for recombining and expressing the arabinofuranosidase gene, and then further screens the Aspergillus niger engineering strain by an ultraviolet mutagenesis method to obtain an arabinofuranosidase high-yield strain, so that the production cost of the arabinofuranosidase is reduced, and the application prospect is wide.

The invention provides a recombinant plasmid, which carries an arabinofuranosidase gene.

The amino acid sequence of the arabinofuranosidase is SEQ ID NO. 2, and the coding nucleotide sequence thereof is SEQ ID NO. 3.

The invention provides an Aspergillus niger engineering strain, and the strain carries the recombinant plasmid.

The invention also provides a mutant strain Aspergillus niger Su12-9969B (Aspergillus nigerSu 12-9969B) is obtained by ultraviolet mutagenesis by taking the aspergillus niger engineering bacteria as starting strains.

The mutant strain is preserved in China center for type culture collection and management of Wuhan university in Wuhan, china at 6 months and 5 days in 2019, and the preservation number is CCTCC NO: M2019433.

The invention also provides application of the Aspergillus niger mutant strain in producing arabinofuranosidase.

The invention will originate from Aspergillus aculeatus (A.aculeatus) ((A.aculeatus))Aspergillus aculeatus) The arabinofuranosidase gene is over-expressed in an Aspergillus niger host, and the Aspergillus niger Su12-9969A is constructed. After fermentation in a 20L tank for 160h, the enzymatic activity of the arabinofuranosidase in the fermentation supernatant of the strain reaches 751U/ml.

In order to improve the yield of the arabinofuranosidase, the applicant takes Aspergillus niger Su12-9969A as an original strain, and further obtains a mutant strain Aspergillus niger Su12-9969B by screening through an ultraviolet mutagenesis method, so that the yield of the arabinofuranosidase can be greatly improved. After fermentation is carried out for 160h in a 20L tank, the enzymatic activity of the arabinofuranosidase in the fermentation supernatant of the mutant strain reaches 1281U/ml, which is improved by 70.6 percent compared with that of the original strain, and unexpected technical effects are obtained. The mutant strain can be widely applied to production of the arabinofuranosidase, so that the production cost of the arabinofuranosidase is reduced, and the popularization and application of the arabinofuranosidase in the industrial fields of feeds, foods and the like are promoted.

Drawings

FIG. 1 is a map of plasmid pSU;

FIG. 2 is a 20L tank fermentation curve;

FIG. 3 is an SDS-PAGE protein electrophoretogram: wherein: m is a protein molecular weight Marker, and lanes 1 and 2 are fermentation supernatants of a starting bacterium Aspergillus niger Su12-9969A and a mutant bacterium Aspergillus niger Su12-9969B respectively.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as those described IN MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

The present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 cloning of arabinofuranosidase Gene

With Aspergillus aculeatus (Aspergillus aculeatus) Genome is taken as a template, and an arabinofuranosidase gene fragment is amplified by using a primer 1 and a primer 2, wherein the nucleotide sequence is shown as SEQ ID NO:2, the encoded amino acid sequence is SEQ ID NO:1.

the PCR primers and reaction conditions were as follows:

primer 1 (F): ATGCCTTCACGACGAACCTC

Primer 2 (R): CTACGCGGACGCAAAGCCCGA

The reaction conditions are as follows: denaturation at 94 deg.C for 5min; then carrying out denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, extension at 72 ℃ for 90s, and carrying out heat preservation at 72 ℃ for 10min after 30 cycles. Agarose electrophoresis results show that the size of the obtained arabinofuranosidase gene through amplification is 1506bp.

EXAMPLE 2 construction of recombinant vectors

The arabinofuranosidase gene is amplified by PCR, and XbaI sites are introduced at two ends of the primer. The primer sequences are as follows:

primer 3 (F): GTATCTAGA ATGCCTTCACGACGAACCCTC

Primer 4 (R): GACTCTAGA CTACGCGGACGCAAAGCCCGA

The PCR reaction conditions are as follows: denaturation at 94 deg.C for 5min; then carrying out denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s, extension at 72 ℃ for 90s, and carrying out heat preservation at 72 ℃ for 10min after 30 cycles. Agarose gel electrophoresis results show that the arabinofuranosidase gene is a fragment of 1506bp in size.

And (2) performing single restriction enzyme digestion of the obtained arabinofuranosidase gene fragment and an expression vector pSU by using a restriction enzyme XbaI under the following conditions:

PCR fragment digestion system (50 ul)	Plasmid pSU restriction enzyme system (50 ul)
		PCR fragment 20ul	pTG plasmid 20ul
10*M 5ul	10*M 5ul
		BSA 5ul	BSA 5ul
XbaI 2ul	XbaI 2ul
		ddH ₂ O 18ul	ddH ₂ O 18ul

Carrying out enzyme digestion treatment for 2h in water bath at 37 ℃, respectively recovering two target fragments after electrophoresis, and dissolving in 20ul ddH ₂ And O. Ligation was performed with T4 DNA ligase in the following system:

PCR fragments	2ul
		pSU	2ul
10*Buffer	1ul
		T4 DNA ligase	1ul
ddH ₂ O	4ul
		Total volume	10ul

Connecting for 1h at 22 ℃, transforming escherichia coli DH5a competence, coating an LB + AMP flat plate, culturing overnight at 37 ℃, growing a single colony, verifying a correctly connected transformant by colony PCR, extracting a plasmid, sequencing, and obtaining the recombinant vector pSU-9969 containing the arabinofuranosidase gene after correct sequencing.

Example 3 recombinant expression of arabinofuranosidase

1. Preparing protoplasts:

inoculating Aspergillus niger host bacteria Su12 to PDA + U (potato 200g/L, boiling for 20-30min, filtering to remove residue, glucose 2%, uracil 1%, and agar powder 1.5%) plate, and culturing at 30 deg.C for 5-7d; cutting 2cm × 2 cm-sized fungus block, inoculating into 100ml liquid PDA + U (potato 200g/L, boiling for 20-30min, filtering to remove residue, glucose 2%, and Uridine 1%) culture medium, and culturing at 30 deg.C for 16 hr to grow mycelium for transformation; the grown mycelia were filtered and resuspended in 20ml of 1.2M magnesium sulfate solution; adding 0.2g of lysozyme, culturing at 30 ℃ and 100rpm for 2-3h; filtering the cracked mycelium with 2 layers of mirror paper, centrifuging at 3000rpm for 10min to obtain protoplast; filtering the cracked mycelium with a piece of lens wiping paper, and centrifuging to obtain a protoplast; then, the mixture is resuspended by using a proper amount of sorbitol solution.

And (3) transformation:

cleaning the obtained Aspergillus niger Su12 protoplast with 1.2M sorbitol solution for 2 times, and re-suspending with appropriate amount of sorbitol solution to make the protoplast concentration reach 10 ⁸ Per ml; adding 10ul of the prepared recombinant vector pSU-9969 into 200ul of protoplast, adding 50ul of 25% PEG6000, performing ice bath for 20min, adding 2ml of 25% PEG6000, and standing at room temperature for 5min; adding 4ml sorbitol solution, mixing, pouring 50ml conversion upper layer culture medium, pouring into 4 conversion lower layer flat plates, solidifying the upper layer culture medium, and culturing in 30 deg.C incubator for 5d.

And (3) transformant screening:

after 5 days of culture, the grown colonies are picked up, spotted on a transformation lower layer plate for re-screening, and cultured for 3 days at 30 ℃. The transformants which grew normally were inoculated into fresh PDA plates, respectively, and cultured at 30 ℃ for 5-7 days. Each transformant was harvested into 2cm × 2 cm-sized clumps, inoculated into 50ml of liquid shake flask culture medium (12% maltose, 1.5% corn steep liquor, 0.5% ammonium sulfate, 0.3% magnesium sulfate, 0.37% potassium sulfate, 0.1125% calcium chloride, 0.1% trace elements) respectively, fermented at 30 ℃ for 5 days. After culturing for 5 days, centrifuging the thalli to obtain supernatant fluid which is crude enzyme liquid, and carrying out SDS-PAGE protein electrophoresis detection and arabinofuranosidase enzyme activity detection.

The applicant named the positive transformant with the highest arabinofuranosidase enzyme activity as Aspergillus niger Su 12-9969A: (Aspergillus nigerSu 12-9969A), and the activity of the arabinofuranosidase in the fermentation supernatant of the strain is 142U/ml.

(1) Definition of the Activity Unit of arabinofuranosidase

The enzyme amount required for degrading and releasing 1 micromole of p-nitrophenol from a solution of 4-nitrophenyl alpha-L-arabinofuranoside with the concentration of 5mmol/L per minute is one enzyme activity unit U under the conditions of 50 ℃ and pH value of 4.8.

(2) Enzyme activity measuring method

5 mmol/L4-nitrophenyl alpha-L-arabinofuranoside solution: accurately weighing 0.0678g of 4-nitrophenyl alpha-L-arabinofuranoside to 0.0001g, slowly adding corresponding buffer solution to approach 50ml, magnetically stirring for about 10min, adjusting the corresponding pH value with 2mol/L citric acid or sodium hydroxide, and finally metering to 50 ml.

Enzyme solution: diluting with pH4.8 sodium citrate buffer solution to proper times, and controlling absorbance value within 0.2-0.4.

Drawing a standard curve: accurately diluting the p-nitrophenol solution of 5mmol/L by 10 times, and then respectively diluting by 2, 4, 6, 8, 10, 12 and 16 times.

0.5ml of the above-mentioned p-nitrophenol diluent (blank control buffer) was taken, 2ml of sodium carbonate solution was added, 0.5ml of substrate solution was added, and the mixture was mixed well and adjusted to zero with blank control to measure the absorbance at 410 nm.

And drawing a standard curve y = kA + b by taking the content of the p-nitrophenol in the system as an abscissa (X) and the light absorption value as an ordinate (y).

Dilution factor	Blank control	16	12	10	8	6	4	2
									P-nitrophenol content in the system (μmol)	0	0.0156	0.0208	0.025	0.0313	0.0417	0.0625	0.125

And (3) determination: taking a proper amount of substrate, and preheating for 5min at 50 ℃;

taking four 15 x 150 test tubes (one blank tube and three sample tubes), and accurately adding 0.5ml of diluted enzyme solution into the four test tubes;

placing four test tubes in a 50 + -0.1 deg.C water bath, and preheating for 2min;

accurately adding 0.5ml of substrate solution into a sample test tube, and accurately timing for 15min;

quickly and accurately adding 2.0ml of sodium carbonate solution into each tube, accurately adding 0.50ml of substrate solution into a blank tube, and shaking up.

The measurement was carried out in 10mm cuvettes with the blank tube set to zero at a wavelength of 410nm in a spectrophotometer.

And (5) taking the average value of the absorbance of the sample liquid in the three sample tubes.

The p-nitrophenol content is determined by looking up a standard curve or using a linear regression equation.

The enzyme activity calculation formula is as follows: a = X × 1/0.5 × n/15

In the formula:

a-arabinofuranosidase enzyme activity, U/g (or U/ml);

x-absorbance is checked (or calculated) on a standard curve to obtain the p-nitrophenol content, mu mol;

1/0.5-volume of enzyme solution added;

n-dilution factor of the enzyme sample;

15-time scaling factor.

Example 4 mutagenesis screening

The mutation caused by ultraviolet mutagenesis has strong randomness, and the effect generated by mutation is random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, the screening workload is large, and the possibility that effective positive mutations cannot be obtained exists. However, UV mutagenesis requires simple equipment, is low in cost, and can obtain a large number of mutants in a short time, so that it is still a common mutagenesis breeding method.

The Aspergillus niger Su12-9969A is taken as an original strain by the applicant, and is genetically modified by an ultraviolet mutagenesis method, so that the yield of the arabinofuranosidase is further improved.

1. Determination of the mortality rate:

inoculating Aspergillus niger Su12-9969A on PDA plate, and culturing at 30 deg.C for 5-7d. When a large amount of spores are generated on the surface of the colony, 5ml of sterile water is absorbed for elution to obtain a spore liquid, the spore liquid is resuspended by the sterile water after centrifugation, and a blood counting chamber is used for counting. A90 mm petri dish was taken and 5ml of diluted spore suspension (concentration 1X 10) was added ⁷ Per ml), added to a rotor and stirred on a magnetic stirrer to bring the spore liquid to a homogeneous state. Irradiating with ultraviolet lamp with power of 9w at a vertical distance of 20cm in a sterile ultra-clean bench for 30s, 45s, 60s, 75s, 90s, 105s and 120s, diluting the irradiated spore solution for 10, 100 and 1000 times, coating 100ul PDA plate, culturing at 30 deg.C for 2-3d, counting, and calculating lethality with unirradiated spore solution as control. Wherein the lethality was 96% at 105s irradiation time, which was selected for subsequent mutagenesis experiments.

2. First round mutagenesis screening

A90 mm petri dish was taken and 5ml of diluted spore suspension (concentration 1X 10) was added ⁷ Per ml), addingStirring the spore liquid on a magnetic stirrer to make the spore liquid in a uniform state. Irradiating with ultraviolet lamp with power of 9w at a vertical distance of 20cm in a sterile ultra-clean bench, diluting 1000 times after irradiating for 105s, taking 100ul of coated PDA plate, and culturing at 30 deg.C for 2-3d.

In the first round, 180 PDA plates are coated in total, 20-40 colonies are grown on each plate after the plates are cultured at 30 ℃ for 2-3 days, and mutants with short branches are screened through colony morphology. The applicant selects 85 mutant bacteria with small colony morphology, dense hyphae and short villus around the colony, and the mutant bacteria are respectively inoculated to a PDA plate and cultured for 5-7 days at 30 ℃. Each mutant strain is cut into 2cm × 2 cm-sized strain blocks, respectively inoculated into 50ml liquid shake flask culture medium for fermentation, and cultured at 30 ℃ for 5d. After culturing for 5 days, centrifuging the thallus to obtain supernatant, namely crude enzyme liquid, and respectively carrying out protein electrophoresis detection and arabinofuranosidase enzyme activity detection. Meanwhile, the starting strain Aspergillus niger Su12-9969A is used as a control group.

The result shows that the enzyme activity of the arabinofuranosidase in the fermentation supernatant of no mutant strain in 85 mutant strains obtained by the first round of ultraviolet mutagenesis screening is higher than that of the original strain; wherein, the enzyme activity of 78 mutant strains is basically equivalent to that of the original strain, and the enzyme activity of the rest mutant strains is even reduced by 6-11 percent compared with that of the original strain.

The applicant continues to carry out 8 rounds of mutagenesis screening according to the method, and finally obtains a mutant strain with the yield of the arabinofuranosidase remarkably higher than that of the starting strain, namely Aspergillus niger Su 12-9969B: (A. Niger)Aspergillus nigerSu 12-9969B). The arabinofuranosidase enzyme activity in the supernatant obtained by shake flask fermentation of the mutant strain reaches 239U/ml, and is improved by 68.3% compared with the original strain.

The applicant further performs 20L tank fermentation on the starting bacterium Aspergillus niger Su12-9969A and the mutant bacterium Aspergillus niger Su12-9969B respectively, the fermentation curve is shown in figure 2, and the SDS-PAGE electrophoresis detection result of the fermentation supernatant is shown in figure 3. After fermentation for 160h, the enzyme activity of the arabinofuranosidase in the supernatant obtained by fermenting the starting bacteria reaches 751U/ml, while the enzyme activity of the arabinofuranosidase in the supernatant obtained by fermenting the mutant bacteria Aspergillus niger Su12-9969B reaches 1281U/ml, which is 70.6% higher than that of the starting bacteria, and unexpected technical effects are obtained.

The applicant has already introduced the mutant strain Aspergillus niger Su12-9969B (5/6/2019)Aspergillus nigerSu 12-9969B) is preserved in China center for type culture Collection, CCTCC NO: M2019433.

Sequence listing

<110> Islands blue biological group Co Ltd

<120> Aspergillus niger strain capable of highly producing arabinofuranosidase

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 501

<212> PRT

<213> Aspergillus aculeatus (Aspergillus aculeatus)

<400> 1

Met Pro Ser Arg Arg Thr Leu Leu Gly Leu Ala Ala Thr Gly Thr Leu

1 5 10 15

Val Ser Ala Gly Pro Cys Asp Ile Tyr Ala Ser Gly Gly Ala Pro Cys

20 25 30

Ile Ala Ala His Ser Thr Thr Arg Ala Leu Tyr Ser Ala Tyr Ser Gly

35 40 45

Pro Leu Tyr Gln Val Ile Arg Gly Ser Asp Ser Ala Thr Thr Asp Ile

50 55 60

Lys Pro Leu Thr Ala Gly Gly Val Ala Asn Ala Ala Ala Gln Asp Thr

65 70 75 80

Phe Cys Ser Gly Thr Thr Cys Leu Ile Ser Ile Ile Tyr Asp Gln Ser

85 90 95

Gly Ser Gly Asn Asp Leu Thr Gln Ala Pro Pro Gly Gly Phe Asp Gly

100 105 110

Pro Glu Ala Asn Gly Tyr Asp Asn Leu Ala Ser Ala Ile Gly Ala Pro

115 120 125

Val Thr Leu Asn Gly Gln Lys Ala Tyr Gly Val Phe Val Ser Pro Gly

130 135 140

Thr Gly Tyr Arg Asn Asn Asp Ala Asn Gly Thr Ala Thr Gly Asp Glu

145 150 155 160

Pro Glu Gly Met Tyr Ala Val Leu Asp Gly Thr His Tyr Asn Asp Ala

165 170 175

Cys Cys Phe Asp Tyr Gly Asn Ala Glu Val Ser Ser Thr Asp Thr Gly

180 185 190

Asn Gly His Met Glu Ala Ile Tyr Tyr Gly Thr Ser Lys Thr Trp Gly

195 200 205

Tyr Gly Ser Gly Ser Gly Pro Trp Val Met Ala Asp Leu Glu Asn Asn

210 215 220

Leu Phe Ser Gly Gln Ala Glu Gly Leu Asn Ser Ala Asp Pro Ser Ile

225 230 235 240

Ser Tyr Arg Phe Val Thr Ala Ala Val Lys Gly Glu Pro Asn Gln Trp

245 250 255

Ala Ile Arg Gly Gly Asn Ala Ala Ser Gly Ser Leu Thr Ser Tyr Tyr

260 265 270

Ser Gly Ala Arg Pro Thr Val Ser Gly Tyr Asn Pro Met Ser Lys Glu

275 280 285

Gly Ala Ile Ile Leu Gly Ile Gly Gly Asp Asn Ser Asn Gly Ala Gln

290 295 300

Gly Thr Phe Tyr Glu Gly Val Met Thr Ser Gly Tyr Pro Ser Asp Ala

305 310 315 320

Thr Glu Asn Ser Val Gln Ala Asn Ile Val Ala Ala Lys Tyr Ala Thr

325 330 335

Thr Ser Leu Thr Ser Gly Ser Ala Leu Thr Ala Gly Ser Ser Ile Ser

340 345 350

Leu Arg Val Thr Thr Thr Gly Tyr Thr Thr Arg Tyr Leu Ala His Asn

355 360 365

Thr Thr Asn Val Ile Thr Ser Val Val Ser Ser Ser Ser Ser Ser Thr

370 375 380

Leu Gln Lys Gln Ala Ser Trp Thr Val Val Ala Gly Leu Ala Asn Ser

385 390 395 400

Gly Cys Phe Ser Phe Glu Ser Val Asp Thr Pro Gly Ser Tyr Ile Arg

405 410 415

His Tyr Asn Phe Glu Leu Leu Leu Ala Ala Ser Asp Gly Thr Lys Gln

420 425 430

Phe Lys Glu Asp Ala Thr Phe Cys Pro Glu Ser Gly Leu Ser Gly Ser

435 440 445

Gly Thr Ser Ile Arg Ser Trp Asn Tyr Pro Thr Arg Trp Phe Arg His

450 455 460

Tyr Ser Asn Val Gly Tyr Ile Ala Ser Asn Gly Gly Val His Thr Phe

465 470 475 480

Asp Ser Lys Thr Ser Phe Asn Ala Asp Val Thr Trp Ser Ile Ser Ser

485 490 495

Gly Phe Ala Ser Ala

500

<210> 2

<211> 1506

<212> DNA

<213> Aspergillus aculeatus (Aspergillus aculeatus)

<400> 2

atgccttcac gacgaaccct cctcgggctg gcggccacgg gcaccctggt cagcgccgga 60

ccctgcgaca tctatgcctc cggtggggcg ccctgtatcg ctgcgcacag caccactcgt 120

gccttgtaca gtgcctattc cggtcccctt taccaggtca tccgtggctc ggacagtgct 180

accaccgaca tcaagccgct caccgctggt ggggttgcca atgctgccgc ccaggacacc 240

ttctgctctg gcacgacctg cctgatctcg atcatctacg accagtccgg tagtggaaac 300

gacctcaccc aggctcctcc gggcggcttc gatgggcccg aggccaacgg ctacgacaac 360

ctggccagcg cgatcggcgc ccccgtcacg ttgaacggac agaaggcgta cggtgtcttc 420

gtctcgcccg gcaccggcta ccgcaacaac gatgccaacg gcactgccac cggcgatgag 480

cccgagggca tgtacgcggt cctggacggc acgcactaca acgatgcctg ctgcttcgac 540

tacggcaacg ccgaggtcag cagcaccgac acgggcaacg gccacatgga ggccatctac 600

tacggtacca gcaagacctg gggctatggc tcgggcagtg gcccgtgggt gatggccgat 660

ctcgagaaca acctgttctc cgggcaggcg gagggcctga actcggcgga cccgtcgatc 720

tcctaccggt tcgtgacggc ggcggtcaag ggcgagccca accagtgggc gatccgcggt 780

ggcaacgcgg cctcgggctc gctgacgagc tattacagcg gcgcgcggcc cacggtgagc 840

ggctacaacc cgatgagcaa ggagggggcg atcatcctgg ggatcggcgg cgacaacagc 900

aacggcgcgc agggcacctt ctacgagggg gtgatgacct cgggctaccc gtcggacgcg 960

acggagaact cggtgcaggc caacatcgtg gcggccaagt acgcgacgac ctcgctgacc 1020

agcgggtcgg cgctgacggc gggctcctcg atctcgctgc gcgtcacgac cacggggtac 1080

acgacccgct acctcgccca caacaccacc aacgtcatca cctcggtcgt ctcctcgtcc 1140

agctcctcca ccctgcagaa gcaggccagc tggaccgtcg tcgcggggct ggccaactcc 1200

ggctgctttt ccttcgagtc cgtcgacacc cccggcagct acatccgcca ctacaacttc 1260

gagctgctgc tcgccgccag cgacggcacc aagcagttca aagaggacgc caccttctgc 1320

ccggagtccg gcctcagcgg ctccggcacc tccatccgct cctggaacta ccccacccgt 1380

tggttccgcc actacagcaa cgtgggctac atcgccagca acggcggcgt gcacaccttc 1440

gactccaaga cttcgttcaa tgcggatgtg acctggtcga tcagctcggg ctttgcgtcc 1500

gcgtag 1506

Claims

1. A new kind of Aspergillus nigerAspergillus niger) The mutant strain is characterized in that the preservation number of the Aspergillus niger mutant strain is CCTCC NO: M2019433.

2. Use of the mutant strain of aspergillus niger according to claim 1 for the production of arabinofuranosidase.