CN114686458B

CN114686458B - Application and method of regulating gene 28781 for improving trichoderma reesei cellulase expression level and enzyme activity

Info

Publication number: CN114686458B
Application number: CN202210563769.9A
Authority: CN
Inventors: 苏小运; 孙先花; 姚斌; 罗会颖; 王晓璐; 秦星; 王苑; 涂涛; 柏映国; 于会民; 黄火清; 张红莲; 王亚茹
Original assignee: Institute of Animal Science of CAAS
Current assignee: Institute of Animal Science of CAAS
Priority date: 2022-05-23
Filing date: 2022-05-23
Publication date: 2022-12-30
Anticipated expiration: 2042-05-23
Also published as: CN114686458A

Abstract

The invention relates to the technical field of agricultural biology, in particular to a regulatory gene28781And an application and a method for regulating and controlling the expression of Trichoderma reesei cellulase. The invention provides a transcription factor related to the expression of the cellulase28781Has regulating effect on the activity expression of cellulase, and inhibits transcription factor in host bacteria by constructing interference plasmid of the gene and transforming the host bacteria with the interference plasmid28781The expression of (2) can improve the protein expression quantity of host bacteria and the cellulase activity. The invention enriches the transcription regulation network of the Trichoderma reesei cellulase, and improves a new way for improving the yield of the cellulase, reducing the cost of the cellulase and realizing the effective utilization of the cellulose.

Description

Application and method of regulating gene 28781 for improving trichoderma reesei cellulase expression level and enzyme activity

Technical Field

The invention relates to the technical field of agricultural biology, in particular to application and a method for improving the cellulase expression quantity and the enzyme activity of trichoderma reesei by regulating a gene 28781.

Background

The filamentous fungus trichoderma reesei is widely used as an important industrial production strain for industrial products such as: production of feed enzymes, organic acids, antibiotics, etc. It has strong capability of producing cellulase and protein secretion, and is a food safety strain approved by FDA, so that it is widely regarded. In the mixed fermentation liquor, the expression of cellobiohydrolase accounts for more than 50% of the total extracellular secreted protein. However, the high cost of cellulase is still one of the major bottlenecks in cellulose biorefinery, so that new methods need to be developed continuously to improve the expression of cellulase and reduce the application cost.

In trichoderma reesei, cellulase expression is affected by a number of regulatory pathways. The main regulation and control are performed at the transcription level and comprise main activating factors Xyr1, ACEII and Hap2/3/5, inhibitory factors Cre1 and ACEI, and other newly discovered synergistic regulation and control of each transcription factor of Ace3, vib1, azf, rce1 and the like. In recent decades, only a few transcription factors with significant effects on transcriptional regulation and modification have been discovered. In addition, there are few reports of other genes regulating cellulase expression. Therefore, it is particularly important to continue to excavate novel regulatory genes of trichoderma reesei and to perform genetic engineering modification on the novel regulatory genes so as to improve the expression of cellulase.

More than 500 transcription factors of trichoderma reesei are divided into 60 types. Wherein, the proportion of the Zn (2) -Cys (6) binuclear cluster structure domain, the fungus specific transcription factor structure domain and the zinc finger structure C2H2 type is the highest, and the NDT80/PhoG dnas combined family type transcription factors are 3. Currently, it has been shown that Vib1 is a member of the NDT 80/PhoG-like transcription factor family and is involved in the regulation of a variety of metabolic processes, including meiosis, biofilm formation and nutritional stress.

Disclosure of Invention

The invention aims to provide a transcription factor capable of improving cellulase expression28781。

It is still another object of the present invention to provide the above transcription factor for improving cellulase expression28781The use of (1).

The invention also aims to provide a method for improving the cellulase expression quantity and the enzyme activity in the trichoderma reesei.

Regulatory genes according to the invention28781，The coding amino acid sequence is shown as SEQ ID NO: 1.

Regulatory genes according to the invention28781，The nucleotide sequence is shown in SEQ ID NO. 2.

The method for improving the cellulase expression quantity and the enzyme activity in the trichoderma reesei comprises the step of interfering the transcription factor in the trichoderma reesei28781And (3) expression.

The method for improving the expression quantity and the enzyme activity of the cellulase in the trichoderma reesei comprises the step of introducing a transcription factor into the trichoderma reesei28781The step of plasmid of interference sequence of (1).

The method for improving the cellulase expression amount and the enzyme activity in the trichoderma reesei, disclosed by the invention, is characterized in that the transcription factor28781The amino acid sequence of the interference sequence of (1) is shown in SEQ ID NO 1.

In accordance with a particular embodiment of the present invention,28781the nucleotide sequence of the gene is shown in SEQ ID NO. 2.

In accordance with a particular embodiment of the present invention,28781the sequence of the interference part gene is shown in SEQ ID NO. 3.

The method for improving the cellulase expression quantity and the enzyme activity in the trichoderma reesei comprises a regulation gene28781The interfering sequence of (a) includespdc1A promoter,28781an interfering gene 447 bp,eno1the promoters are spliced in series in a seamless splicing mode.

According to an embodiment of the present invention, the above interference expression28781The gene can improve the cellulase enzyme activity expression of the trichoderma reesei.

The invention also provides a host bacterium for producing the cellulase, wherein the cellulase in the host bacterium expresses related transcription factors28781Is down-regulated. Specifically, the host bacterium includes Trichoderma reesei.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention provides a transcription factor related to the expression of the cellulase28781Has regulating effect on the activity expression of cellulase, and inhibits transcription factor in host bacteria by constructing interference plasmid of the gene and transforming the host bacteria with the interference plasmid28781The expression of the strain can improve the protein expression quantity of host bacteria and the enzyme activity of cellulase. The invention enriches the transcription regulation network of the Trichoderma reesei cellulase, and improves a new way for improving the yield of the cellulase, reducing the cost of the cellulase and realizing the effective utilization of the cellulose.

Drawings

FIG. 1 is a plasmid map of the interference plasmid p28781 i.

FIG. 2 shows PCR confirmation of plasmid introduction for p28781 i.

FIG. 3 shows extracellular protein comparison of Trichoderma reesei 28781i-T strain with TU-6 strain.

FIG. 4 shows cellulase enzyme activities of Trichoderma reesei 28781i-T strain compared to TU-6 strain.

Detailed Description

The experimental methods in the following examples, which are not specified under specific conditions, are generally carried out under conventional conditions. The Trichoderma reesei TU-6 strain used in the invention is uracil-deficient mutant, and the number is ATCC (MYA-256).

Example 1 construction of plasmid p28781i

The p28781i plasmid includespdc1A promoter,28781an interfering gene fragment 447 bp,eno1promoter, ampr + ori, in four parts. Amplifying an ampr + ori part by using a plasmid APA-GOD as a template and using primers amprF and oriR; amplification with primers pdc1F and pdc1R using Trichoderma reesei genome as templatepdc1Amplification with promoter 1000 bp, primers 28781F and 28781R28781Interfering gene fragment 447 bp, primers eno1F and eno1R for amplificationeno1And (3) carrying out electrophoresis on the promoter 1000 bp, recovering the 4 fragments, and constructing an interference plasmid vector by adopting a homologous recombination method. Escherichia coli Trans1-T1 competent cells are transformed, coliform colonies growing on a plate are subjected to colony PCR, coliform colonies identified as positive by the PCR are sent to be sequenced, and a plasmid with correct sequencing is named as p28781i as shown in figure 1. The primers are as follows:

amprF (SEQ ID NO:4)、oriR(SEQ ID NO:5)；

pdc1F(SEQ ID NO:6)、pdc1R(SEQ ID NO:7)；

28781F(SEQ ID NO:8)、28781R(SEQ ID NO:9)；

eno1F(SEQ ID NO:10)、eno1R(SEQ ID NO:11)。

example 2 introduction of plasmid p28781i

(1) P28781i plasmid transformation of Trichoderma reesei TU-6

The trichoderma reesei TU-6 is inoculated on a potato culture medium (PDA) plate, standing culture is carried out at 28 ℃ for 7 d until spores are produced, the spores are scraped and inoculated in a 100 ml PDB culture medium containing uracil, and shaking culture is carried out at 28 ℃ and 160 rpm for overnight. Sieving, collecting germinated hypha, adding 10 mg/ml cellulase, and digesting at 30 deg.C for 2-3 hr. After collecting protoplasts, the plasmid p28781i was usedSsp1 enzyme cutting and transforming the Trichoderma reesei host cell.

(2) PCR verification of the introduction of the p28781i plasmid into the Trichoderma reesei genome

Individual transformants were picked, inoculated into 24-well plates containing MM-glucose medium, and cultured at 28 ℃ for 5 to 7 days. Genomic DNA was extracted and the introduction of the plasmid p28781i into the genome of Trichoderma reesei was verified. Transformants that fit the expected band were sporulated with PDA.

Example 3 interference28781Effect of genes on protein expression

(1) Interference28781Shake flask induction of transformants of (1)

Interference28781The transformant and the starting strain of (2X 10) were inoculated separately ⁷ Spores were cultured in 50 ml of MM-glucose medium at 28 ℃ and 160 rpm for 2 days. Transfer to 50 ml MM +2% Avicel medium at an inoculum size of 10% to induce expression of cellulase. Samples were taken every 24 h, beginning on day 3, and continued for up to 7 days.

Individual transformants were picked, inoculated into 24-well plates containing MM-glucose medium, and cultured at 28 ℃ for 5 to 7 days. The gene transfer was confirmed by extracting genomic DNA and amplifying a fragment of about 750 bp. The PCR products were electrophoresed on a 1% agarose gel, and the occurrence of a band identical to that expected was sporulated (FIG. 2).

(3) Interference28781Determination of protein concentration of transformant and endo-cellulase

Protein quantification is carried out by a Coomassie brilliant blue method, after adding 250. Mu.l of 1 × dye reagent dye and 10. Mu.l of protein standard, after reacting for 10 minutes at room temperature, the light absorption value of 595 nm is determined, and the result is shown in FIG. 3. On the 5 th day of fermentation, the protein concentration of Trichoderma reesei TU-6 was 0.027 mg/ml,28781the protein concentration of the interference transformant (28781 i-T) is 0.062 mg/ml, which is improved by 1.3 times.

The measurement of endo-cellulase was carried out using sodium carboxymethyl cellulose (1.5% CMC-Na) as a substrate. Prepared with citric acid-disodium hydrogen phosphate buffer (0.05M, pH 5.0). Adding 100 mul of enzyme solution which is diluted properly into 900 mul of CMC-Na substrate, oscillating and mixing uniformly, preserving heat for 30 min in a water bath at 50 ℃, adding 1.5 ml of DNS reagent into each test tube when the reaction is ended, boiling for 5 min in boiling water, rapidly cooling, and measuring the absorbance of 540 nm. 1 ml liquid enzyme, the amount of enzyme required to hydrolyze sodium carboxymethylcellulose at 50 deg.C, pH 5.0, per minute to produce 1. Mu. Mol of reducing sugar (in terms of glucose) is defined as one enzyme activity unit (U), and the results are shown in FIG. 4. Of Trichoderma reesei TU-6 on day 5 of fermentationThe enzyme activity of the endo-cellulase is 1.42U/ml,28781the enzyme activity of the endo-cellulase for interfering the transformant (28781 i-T) is 3.22U/ml, which is improved by 1.3 times.

It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Sequence listing

<110> Beijing animal husbandry and veterinary institute of Chinese academy of agricultural sciences

Application and method of <120> regulatory gene 28781 for improving trichoderma reesei cellulase expression level and enzyme activity

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 466

<212> PRT

<213> Trichoderma reesei (Trichoderma reesei)

<400> 1

Arg Asn Thr Val Leu Pro His Leu Ala Ala Gln Val Ser Thr Arg Glu

1 5 10 15

Gln Tyr Ser Thr Thr Thr Pro Ser Phe Arg Arg Ala Ser Glu His Pro

20 25 30

Val Arg Ser Pro Ser Phe Pro Gly Val His Val Arg Arg Val Pro Leu

35 40 45

Ser Pro Asp His Ser Pro Leu Asn Ser Tyr Val Ala Pro Ala Gly Arg

50 55 60

Met Glu Ala Gly Gln Phe Gln Asn Arg Pro Ser Ala Thr Ala Val Pro

65 70 75 80

Pro Leu Met Ser Val Gln Thr Ser Gly Ser Leu Gln Tyr Glu Thr Gly

85 90 95

Thr Pro Ile Lys Ile Asp Ile Thr Gly Thr Val Asp Lys Gly Phe Phe

100 105 110

Leu Ala Glu Gly Glu Trp Thr Cys Tyr Arg Arg Asn Tyr Met Thr Cys

115 120 125

Ala Cys Ser Tyr Ser Leu Gln Pro His Tyr Pro Gly Thr Ile Val His

130 135 140

Phe Ile Pro Gln Gly Ser Ser Gln Pro Tyr Gln Val Tyr Gly Leu Tyr

145 150 155 160

Met Ser Ile Ser Ala Val Val Ala Asp Asn Asp Gln Gln Thr Ile Glu

165 170 175

Leu Val Gln His Thr Pro Lys Arg Asp Lys Gly Pro Thr Ser Lys Pro

180 185 190

Glu Lys Val Leu Leu Leu Pro Lys Asn Ser Val Pro Ser His His Val

195 200 205

Gly Met Tyr Asn Asp Asn Thr Ser Ala Ser Gly Ala Arg Ala Val Tyr

210 215 220

Gln Asp Gly Tyr Gly Gly Gln Gly Gly Gly Gln Pro Pro Thr Glu His

225 230 235 240

Thr Phe Glu Arg Ile Gln Phe Lys Gln Ala Thr Gln Asn Asn Gly Lys

245 250 255

Arg Arg Ala Ala Gln Gln Tyr Tyr His Leu Met Val Glu Leu Trp Ala

260 265 270

Asp Leu Gly Ser Ser Ser Ala Asp Lys Phe Val Lys Ile Ala Tyr Arg

275 280 285

Lys Ser Glu Lys Met Ile Val Arg Gly Arg Ser Pro Gly His Tyr Gln

290 295 300

Ser Glu Lys Arg Arg Ser His Ser Gly Gly Pro Gly Gly Ser Ser Gly

305 310 315 320

Thr Leu Gly Ser Tyr Gly Ala Leu Gly Ile Ser Asp Phe Ser His Ser

325 330 335

Gly Leu Leu Gly Gly Ser Ser Thr Tyr Asn Gly Ser Tyr Asp Pro Arg

340 345 350

Gly Ser Val Tyr Gly Thr Pro Arg Ser His Asp Val Pro Ala Glu Ser

355 360 365

Asn Met Ala Ser Glu Asp Asp Lys Ser Leu Gly His Asn Lys Gly Tyr

370 375 380

Leu Tyr Tyr Pro Gly Ser Met Tyr Asp Gly Ser Gln Ser Arg Pro Leu

385 390 395 400

Asp Met Phe Ala Ser Arg Asn Asp His Glu Thr Pro Pro Ala Gln Ser

405 410 415

Ser Thr Asp Thr Lys Val Lys Ser Glu Tyr Asp Ile Thr Pro Arg Val

420 425 430

Phe Gln Pro Pro Leu Gly Glu Ser Arg Arg Pro Pro Ala Pro Phe Glu

435 440 445

Ala Arg Thr Thr Ser Gly Gly Tyr Tyr Pro Thr Ile Leu Ser Ser Pro

450 455 460

Ser Thr

465

<210> 2

<211> 1397

<212> DNA

<213> Trichoderma reesei (Trichoderma reesei)

<400> 2

cgcaacactg tattgccgca tctggcagct caagtaagca ccagagagca atactctacc 60

accactccct catttcgaag ggcttcggag catcctgtca ggtctccgtc atttccgggc 120

gtgcatgtgc gccgcgtgcc actgtcgcca gaccatagcc cactcaactc ctatgtcgct 180

ccggccggga ggatggaagc tggccagttc caaaacagac cctccgcaac tgcagtgcct 240

cccctcatgt ctgtccagac ttccggctct ctccagtatg aaactgggac gcccatcaag 300

attgatatca ccggcacagt cgacaagggg ttcttcctag ccgagggcga gtggacttgc 360

taccgccgca actacatgac ctgcgcgtgc tcatactcgc tccaaccaca ctacccgggc 420

actatcgtgc attttattcc ccaagggtct tcccaaccct atcaagtcta cgggctctac 480

atgtcaatat ctgccgtcgt ggcagacaat gaccagcaga ccatcgagct tgtccagcac 540

acccccaaga gggacaaggg tcccacctcc aaacctgaga aggttctgct gctgcccaag 600

aactcggtgc cgtcgcacca tgttggcatg tacaacgaca atacgagcgc atccggtgcc 660

agggcagtgt accaagatgg ctacggcggc caaggaggcg gccaaccccc gactgagcat 720

acgtttgagc gcatccagtt caagcaggct actcagaaca atggcaaacg gagggctgcg 780

cagcagtact atcacctcat ggttgagctg tgggctgacc tgggctcgtc cagcgccgac 840

aagttcgtca agattgcgta cagaaagtcg gagaagatga ttgtccgtgg ccgctcccct 900

ggccattatc agagcgaaaa gcgacgcagc cacagtggtg gtccaggagg atcctcgggg 960

actcttggaa gctacggggc cctgggaatc tcggattttt ctcactcggg tctgcttggg 1020

gggagcagca cgtacaacgg ttcctacgat ccgagaggct cggtgtacgg gacacccagg 1080

agccatgacg ttcctgccga aagcaacatg gcttccgaga tgataagtcg cttggccaca 1140

acaagggcta cttatactac cctggatcca tgtacgacgg ctcacagtct cggcccctcg 1200

atatgtttgc ctcgcgcaat gatcatgaga ccccgccggc gcaatcgtca accgacacga 1260

aggtgaagag cgagtatgat ataacgcctc gcgtcttcca gccgccgctg ggagagagtc 1320

gtcgtccacc ggcaccgttt gaagctagaa ctacctcggg aggttactac cctaccatcc 1380

tgtcctctcc cagcaca 1397

<210> 3

<211> 447

<212> DNA

<213> Trichoderma reesei (Trichoderma reesei)

<400> 3

gacaatgacc agcagaccat cgagcttgtc cagcacaccc ccaagaggga caagggtccc 60

acctccaaac ctgagaaggt tctgctgctg cccaagaact cggtgccgtc gcaccatgtt 120

ggcatgtaca acgacaatac gagcgcatcc ggtgccaggg cagtgtacca agatggctac 180

ggcggccaag gaggcggcca acccccgact gagcatacgt ttgagcgcat ccagttcaag 240

caggctactc agaacaatgg caaacggagg gctgcgcagc agtactatca cctcatggtt 300

gagctgtggg ctgacctggg ctcgtccagc gccgacaagt tcgtcaagat tgcgtacaga 360

aagtcggaga agatgattgt ccgtggccgc tcccctggcc attatcagag cgaaaagcga 420

cgcagccaca gtggtggtcc aggagga 447

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcctctgcgg tatttgagaa tacggttatc cacagaatca gggg 44

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcggccgctt ctttgtttga aaaa 24

<210> 6

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaaacaaag aagcggccgc cgatgaaagc cttgcaactg tggt 44

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaattcgatt gtgctgtagc tgcgctgctt 30

<210> 8

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctacagcac aatcgaattc gacaatgacc agcagaccat cgag 44

<210> 9

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

actagttcta gatcctcctg gaccaccact gtggc 35

<210> 10

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

caggaggatc tagaactagt tttgaagcta tttcaggtgg ctgg 44

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttctcaaata ccgcagaggc gaca 24

<210> 12

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcctctgcgg tatttgagaa tacggttatc cacagaatca gggg 44

Claims

1. A method for improving the expression quantity and the enzyme activity of Trichoderma reesei cellulase, which is characterized in that the method comprises interfering Trichoderma reesei transcription factor28781A step of expression of the Trichoderma reesei transcription factor28781The coding amino acid sequence is shown as SEQ ID NO: 1.

2. The method for improving the expression level and the enzyme activity of the Trichoderma reesei cellulase according to claim 1, wherein the Trichoderma reesei transcription factor28781The nucleotide sequence of (a) is shown as SEQ ID NO:2, respectively.

3. The method for improving the expression level and the enzyme activity of the Trichoderma reesei cellulase according to claim 1, wherein the Trichoderma reesei-containing transcription factor is constructed28781The plasmid of the interference fragment is introduced into the trichoderma reesei to realize the interference of the trichoderma reesei transcription factor28781Expression of (2).

4. The method for improving the expression quantity and the enzyme activity of the trichoderma reesei cellulase according to claim 3, wherein the trichoderma reesei transcription factor is obtained by amplification of primers 28781F and 28781R by taking a trichoderma reesei genome as a template28781The sequences of the primers 28781F and 28781R are as follows:

28781F：GCTACAGCACAATCGAATTCGACAATGACCAGCAGACCATCGAG，

28781R：ACTAGTTCTAGATCCTCCTGGACCACCACTGTGGC。

5. trichoderma reesei transcription factor28781The application of improving the expression quantity and the enzyme activity of the Trichoderma reesei cellulase is characterized in that the expression quantity and the enzyme activity of the Trichoderma reesei cellulase are improved by interfering the Trichoderma reesei transcription factor28781The expression of the Trichoderma reesei transcription factor improves the expression quantity and the enzyme activity of the Trichoderma reesei cellulase28781The coding amino acid sequence is shown as SEQ ID NO: 1.

6. The Trichoderma reesei transcription factor of claim 528781The application of improving the expression quantity and the enzyme activity of the Trichoderma reesei cellulase is characterized in that the Trichoderma reesei transcription factor28781The nucleotide sequence of (a) is shown as SEQ ID NO:2, respectively.