CN115637296A - Method for screening rice with low palmitic acid content and special primer thereof - Google Patents
Method for screening rice with low palmitic acid content and special primer thereof Download PDFInfo
- Publication number
- CN115637296A CN115637296A CN202110815769.9A CN202110815769A CN115637296A CN 115637296 A CN115637296 A CN 115637296A CN 202110815769 A CN202110815769 A CN 202110815769A CN 115637296 A CN115637296 A CN 115637296A
- Authority
- CN
- China
- Prior art keywords
- rice
- palmitic acid
- primer
- screening
- low palmitic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for auxiliary screening of low palmitic acid content rice and a special primer thereof, wherein the auxiliary screening of the rice comprises two primers, one primer is an Indel marker based on a functional mutation site, the marker primer consists of two nucleotide sequences of PAL6M2L and PAL6M2R, the other primer is a fluorescent marker based on an SNP mutation site in a gene, and the marker primer consists of a pair of universal fluorescent primers, a pair of SNP allele specific primers and a reverse common primer. The method for selecting the rice with low palmitic acid, high oleic acid and linoleic acid in an auxiliary manner can be used for breeding the rice with low palmitic acid, high oleic acid and linoleic acid contents, shortens the breeding period of the rice, accelerates the breeding speed, reduces the breeding cost, has the advantages of simple operation, low cost and short period, is suitable for popularization and application, and provides a rapid detection method for breeding the rice variety with low palmitic acid, high oleic acid and linoleic acid contents.
Description
Technical Field
The invention relates to the technical field of rice cultivation, in particular to a method for screening rice with low palmitic acid content and a special primer thereof.
Background
The rice is one of the main grain crops in the world, the seeding area of the rice in China is 2800-3200 ten thousand hectares, the seeding area accounts for 27 percent of the grain seeding area in China, the yield per unit of the rice reaches 5.8-6.2 tons/hectare, the total output of the rice is 1.8-2.0 hundred million tons, the total output of the rice accounts for 39 percent of the total grain, the rice production plays an important role in agricultural production and rural economic development in China and is also the basis of grain safety, social stability and national economic development in China, along with the improvement of the living level of substances in recent years, the population of people gradually changes from full to good, meanwhile, the country provides agricultural supply side reform, the grain production improves the quality and increases the efficiency, and therefore, the requirement for cultivating high-quality rice varieties is more urgent;
through whole genome association analysis, 4 genes which are important to natural variation of oil components are cloned in a panicled swallowwort root group, wherein qPAL6 is a main effective gene for positively regulating and controlling the palmitic acid content, the mutation of the gene reduces the palmitic acid content in rice and increases the oleic acid and linoleic acid content, and researches show that the qPAL6 is positioned at the tail end of the short arm of chromosome 6, and a candidate gene of the gene codes acyl carrier protein thioesterase. In view of the fact that the phenotypic identification of the oil component content is complex, the improvement of the oil component content of rice is carried out by utilizing a molecular marker assisted breeding technology, and the improvement is an effective way for breeding good taste quality varieties, and researches show that the qPAL6 genotype can be typed according to whether 62bp insertion or deletion exists at the 5' end of the qPAL6 gene, and the average palmitic acid content of the haplotype of the inserted 62bp is obviously higher than that of the haplotype of the deleted 62 bp.
The existing molecular marker assisted breeding method for detecting the oil content of rice varieties has the following defects:
1. although a plurality of QTLs related to the fat content of rice have been detected at present, most of the QTLs are large in positioning interval and difficult to directly apply to molecular assisted breeding, the existing rice cannot give consideration to the balance of the contents of high saturated fatty acid, namely palmitic acid, and unsaturated fatty acid, namely linoleic acid, and when the content of the palmitic acid in the rice is high, the content of the fat is higher, the glossiness of the rice is higher, the palatability of the rice is better, but the palmitic acid in the rice is saturated fatty acid, and the saturated fatty acid has adverse effects on heart and brain blood vessels of a human body; unsaturated fatty acids containing multiple double bonds are easily oxidized, and affect rice quality under adverse storage conditions.
2. When the existing rice cultivation detection test uses a marking method, the sample detection mainly depends on the traditional agarose gel electrophoresis, and although the detection method is simple and practical, the detection method wastes labor and time under the condition of large sample amount.
Disclosure of Invention
The invention aims to provide a method for screening rice with low palmitic acid content and a special primer thereof, so as to solve the problems in the background technology.
In order to achieve the purpose, the invention provides the following technical scheme: a method for screening rice with low palmitic acid content and a special primer thereof comprise a screening method and two primers for assisting in screening rice, wherein the screening method comprises the following working steps:
the method comprises the following steps: carrying out PCR amplification on the rice to be detected by using a primer;
step two: detecting the state of the rice to be detected after PCR amplification;
step two: typing the qPAL6 gene of the rice to be tested;
step four: and drawing the result to obtain a corresponding conclusion.
Preferably, the screening method adopts two primers for assisting in screening rice, one is Indel marker based on functional mutation sites, and if the amplification product has a 326bp band, the requirement of low palmitic acid is met;
the other is fluorescent labeling based on SNP mutation sites in the gene, and if the amplified product generates a blue fluorescent signal, the requirement of low palmitic acid is met.
Preferably, the reference substance used in Indel labeling consists of two nucleotide sequences, PAL6M2L and PAL6M 2R.
Preferably, the fluorescent marker of the SNP variation site uses a marker primer consisting of a pair of general fluorescent primers PM-PAL6, a pair of SNP allele-specific primers PAL6-Rc and PAL6-Rt and a reverse common primer PAL 6-F.
Preferably, the primer sequence of PAL6M2L is tgcactgagtgaccaaatt, and the primer sequence of PAL6M2R is gcagcaggaaatcactcatca.
Preferably, the PCR post-amplification reaction system for PAL6M2 marker detection comprises Buffer and dNTPs.
Preferably, 25 parts of rice material is adopted as the Indel marker, products obtained after PCR amplification are separated by electrophoresis in agarose gel, and scanned and photographed under an ultraviolet lamp after being dyed by ethidium bromide.
Preferably, the primer sequence of PAL6-Rc is GAAGGTGACCAAGTTCATGCTATCGCATTCACCTGAAACAGC, the primer sequence of PAL6-Rc is GAAGGTCGGAGTCAACGGATTCATCGCATTCACCTGAACAGT, and the primer sequence of PAL6-F is AAGGAGTGTGGCCGTGACAG.
Preferably, the FAM fluorescent linker of PAL6-Rc is blue, the HEX fluorescent linker of PAL6-Rc is green, and the colors of the FAM fluorescent linker of PAL6-Rc and the HEX fluorescent linker of PAL6-Rc can be changed according to actual needs.
Preferably, the PCR amplification total volume for PAL6M2 marker detection is 15.0. Mu.L, 1. Mu.L (50 ng/. Mu.L) of DNA template, the reaction system contains 1.5. Mu.L of 10 XBuffer (Mg 2+ plus), 0.3. Mu.L of dNTPs (10 mmol/. Mu.L), 0.6. Mu.L of each primer (66 ng/. Mu.L), 0.2. Mu.L of Taq enzyme (5U/. Mu.L), and ddH2O is supplemented to a total volume of 15.0. Mu.L.
Preferably, the Indel labeling PCR amplification procedure comprises:
(1) The pre-denaturation time is 6-8min, and the pre-denaturation temperature is 94 ℃;
(2) The denaturation time range is 20-40s, and the denaturation temperature is 94 ℃;
(3) The renaturation time is 30s, and the renaturation temperature range is 55-60 ℃;
(4) The extension time is 45s, and the extension temperature is 70-75 ℃;
(5) Circulating for 35 times (1) - (4);
(6) Extending for 6-8min at 72 deg.C;
(7) Storing the PCR product at low temperature, wherein the low temperature range is 3-5 ℃;
(8) The concentration of the agarose gel is 1-1.5%.
Preferably, 91 parts of rice material is adopted for fluorescent labeling of the SNP variation sites.
Compared with the prior art, the invention has the beneficial effects that:
1. the invention provides a method for screening rice with low palmitic acid content in an auxiliary manner, which can be used for selectively breeding rice with low palmitic acid, high oleic acid and linoleic acid content on the basis of improving the fatty acid content of the rice and ensuring the palatability of the rice, and can be used for solving the problems that the high saturated fatty acid has adverse effects on human cardiovascular and cerebrovascular vessels by reducing the content of saturated fatty acid, namely palmitic acid, and increasing the content of unsaturated fatty acid, namely oleic acid, and also can be used for solving the problems that the unsaturated fatty acid, namely linoleic acid, is easy to oxidize and is unfavorable to store so as to influence the quality of the rice, shortening the breeding period of the rice, accelerating the breeding speed and reducing the breeding cost.
2. The invention uses an Indel marker sequence and a fluorescence marker sequence as primers for auxiliary screening of low palmitic acid content rice, detects parents and a small amount of breeding materials by InDel markers in the early stage of work, detects samples of hybridization separation generations by fluorescence molecular markers, and has the characteristics of high flux, higher automation degree and low cost in the detection of the fluorescence molecular markers, thereby being suitable for the condition of larger sample amount.
Drawings
FIG. 1 is a schematic view of a flow structure of the present invention;
FIG. 2 is a diagram illustrating data results in an Indel marker embodiment of the present invention;
FIG. 3 is a diagram illustrating the result of fluorescence labeling data of SNP mutation sites according to the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Referring to fig. 1-3, the method for screening rice with low palmitic acid content and the special primers thereof provided by the present invention include a screening method and two primers for assisting in screening rice, wherein the screening method includes the following steps:
the method comprises the following steps: carrying out PCR amplification on the rice to be detected by using a primer;
step two: detecting the state of the rice to be detected after PCR amplification;
step three: typing the qPAL6 gene of the rice to be tested;
step four: and drawing a result to obtain a corresponding conclusion.
Furthermore, the screening method adopts two primers for assisting in screening rice, one is Indel marker based on functional mutation sites, and if the amplification product has a 326bp band, the requirement of low palmitic acid is met;
the other is fluorescent labeling based on SNP variation sites in the gene, and if the amplification product generates a blue fluorescent signal, the requirement of low palmitic acid is met.
Further, the referent used in the Indel labeling consisted of two nucleotide sequences, PAL6M2L and PAL6M 2R.
Furthermore, the fluorescent marker of the SNP variation site uses a marker primer which consists of a pair of general fluorescent primers PM-PAL6, a pair of SNP allele specific primers PAL6-Rc and PAL6-Rt and a reverse common primer PAL 6-F.
Further, the primer sequence of PAL6M2L is TGCACTGAGCTGACCAATTT, and the primer sequence of PAL6M2R is GCAGCAGGAATCACTCATCA.
Further, the PCR amplification reaction system for PAL6M2 marker detection comprises Buffer and dNTPs.
Furthermore, 25 parts of rice material is adopted as the Indel marker, products obtained after PCR amplification are separated by electrophoresis in agarose gel, and scanned and photographed under an ultraviolet lamp after being dyed by ethidium bromide.
Further, the primer sequence of PAL6-Rc is GAAGGTGACCAAGTTCATGCTATCGCATTCACCTGAAACAGC, the primer sequence of PAL6-Rc is GAAGGTCGGAGTCAACGGATTCATCGCATTCACCTGAACAGT, and the primer sequence of PAL6-F is AAGGAGTGTGGCCGTGACAG.
Further, the FAM fluorescent linker of PAL6-Rc is blue, the HEX fluorescent linker of PAL6-Rc is green, and the colors of the FAM fluorescent linker of PAL6-Rc and the HEX fluorescent linker of PAL6-Rc can be changed according to actual needs.
Further, the PCR amplification total volume for PAL6M2 marker detection was 15.0. Mu.L, 1. Mu.L (50 ng/. Mu.L) of DNA template, and the reaction system contained 1.5. Mu.L of 10 XBuffer (Mg 2+ plus), 0.3. Mu.L of dNTPs (10 mmol/. Mu.L), 0.6. Mu.L of each primer (66 ng/. Mu.L), 0.2. Mu.L of Taq enzyme (5U/. Mu.L), and ddH2O was supplemented to a total volume of 15.0. Mu.L.
Further, the Indel labeling PCR amplification program includes:
(1) The pre-denaturation time is 6-8min, and the pre-denaturation temperature is 94 ℃;
(2) The denaturation time range is 20-40s, and the denaturation temperature is 94 ℃;
(3) The renaturation time is 30s, and the renaturation temperature range is 55-60 ℃;
(4) The extension time is 45s, and the extension temperature is 70-75 ℃;
(5) Circulating for 35 times (1) - (4);
(6) Extending for 6-8min at 72 deg.C;
(7) Storing the PCR product at low temperature, wherein the low temperature range is 3-5 ℃;
(8) The concentration of the agarose gel is 1-1.5%.
Further, 91 parts of rice material was used for fluorescent labeling of the SNP mutation site.
Example one
(1) Pre-denaturation at 94 ℃ for 5min;
(2) Denaturation at 94 ℃ for 30s;
(3) Renaturation at 58 ℃ for 30s;
(4) Extension at 72 ℃ for 45s;
(5) Cycling (1) - (4) 35 times;
(6) Extending for 7min at 72 ℃;
(7) Storing the PCR product at 4 ℃;
(8) The PCR product was electrophoretically separated on 1.2% agarose gel, stained with ethidium bromide, scanned under an ultraviolet lamp for photography, and the data of the results were plotted.
Example two
(1) Pre-denaturation at 94 ℃ for 6min;
(2) Denaturation at 94 ℃ for 40s;
(3) Renaturation at 60 ℃ for 30s;
(4) Extension at 70 ℃ for 45s;
(5) Circulating for 35 times (1) - (4);
(6) Extending for 7min at 70 ℃;
(7) Storing the PCR product at 5 ℃;
(9) And (3) carrying out electrophoretic separation on the PCR product in 1% agarose gel, staining the PCR product by ethidium bromide, scanning and photographing under an ultraviolet lamp, and drawing result data.
EXAMPLE III
Genotyping was carried out on 96 rice materials using fluorescent molecular marker PM-PAL 6:
wherein 51 parts are blue fluorescence signals, and the genotype is GG correspondingly;
43 parts of green fluorescent signal, and the genotype is corresponding to AA;
2 parts show 2 different fluorescence signals, and the genotype is heterozygous.
It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.
Claims (12)
1. A method for screening rice with low palmitic acid content and a special primer thereof comprise a screening method and two primers for assisting in screening rice, wherein the screening method comprises the following working steps:
the method comprises the following steps: carrying out PCR amplification on the rice to be detected by using a primer;
step two: detecting the state of the rice to be detected after PCR amplification;
step three: typing the qPAL6 gene of the rice to be tested;
step four: and drawing a result to obtain a corresponding conclusion.
2. The method for screening rice with low palmitic acid content and the special primers thereof according to claim 1, wherein the method comprises the following steps: the screening method adopts two primers for assisting in screening rice, one is Indel marker based on functional mutation sites, and if an amplification product has a 326bp band, the requirement of low palmitic acid is met;
the other is fluorescent labeling based on SNP mutation sites in the gene, and if the amplified product generates a blue fluorescent signal, the requirement of low palmitic acid is met.
3. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 2, wherein the method comprises the following steps: the referent used in the Indel labeling consisted of two nucleotide sequences, PAL6M2L and PAL6M 2R.
4. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 2, wherein the method comprises the following steps: the marker primer used by the fluorescent marker of the SNP variation site consists of a pair of universal fluorescent primers PM-PAL6, a pair of SNP allele specific primers PAL6-Rc and PAL6-Rt and a reverse common primer PAL 6-F.
5. The method for screening rice with low palmitic acid content and the special primers thereof according to claim 3, wherein the method comprises the following steps: the primer sequence of PAL6M2L is TGCACTGAGCTGACCAATTT, and the primer sequence of PAL6M2R is GCAGCAGGAATCACTCATCA.
6. The method for screening rice with low palmitic acid content and the special primers thereof according to claim 5, wherein the method comprises the following steps: the PCR amplification reaction system for PAL6M2 marker detection comprises Buffer and dNTPs.
7. The method for screening rice with low palmitic acid content and the special primers thereof according to claim 2, wherein the method comprises the following steps: the Indel marker is made of 25 parts of rice material, products obtained after PCR amplification are subjected to electrophoresis separation in agarose gel, and scanning and photographing are carried out under an ultraviolet lamp after the products are dyed by ethidium bromide.
8. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 4, wherein the method comprises the following steps: the primer sequence of the PAL6-Rc is GAAGGTGACCAAGTTCATGCTATCGCATTCACCTGAAACAGC, the primer sequence of the PAL6-Rc is GAAGGTCGGAGTCAACGGATTCATCGCATTCACCTGAACAGT, and the primer sequence of the PAL6-F is AAGGAGTGTGGCCGTGACAG.
9. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 8, wherein the method comprises the following steps: the FAM fluorescent linker of PAL6-Rc is blue, the HEX fluorescent linker of PAL6-Rc is green, and the colors of the FAM fluorescent linker of PAL6-Rc and the HEX fluorescent linker of PAL6-Rc can be changed according to actual needs.
10. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 6, wherein the method comprises the following steps: the PCR amplification total volume of PAL6M2 marker detection is 15.0. Mu.L, 1. Mu.L (50 ng/. Mu.L) DNA template, the reaction system contains 1.5. Mu.L 10 XBuffer (Mg 2+ plus), 0.3. Mu.L dNTPs (10 mmol/. Mu.L), 0.6. Mu.L (66 ng/. Mu.L) of each primer, 0.2. Mu.L Taq enzyme (5U/. Mu.L), and ddH2O is supplemented to the total volume of 15.0. Mu.L.
11. The method for screening rice with low palmitic acid content and the special primers thereof according to claim 7, wherein the method comprises the following steps: the PCR amplification program for Indel labeling comprises the following steps:
(1) The pre-denaturation time is 6-8min, and the pre-denaturation temperature is 94 ℃;
(2) The denaturation time range is 20-40s, and the denaturation temperature is 94 ℃;
(3) The renaturation time is 30s, and the renaturation temperature range is 55-60 ℃;
(4) The extension time is 45s, and the extension temperature is 70-75 ℃;
(5) Cycling (1) - (4) 35 times;
(6) Extending for 6-8min at 72 deg.C;
(7) Storing the PCR product at low temperature, wherein the low temperature range is 3-5 ℃;
(8) The concentration of the agarose gel is 1-1.5%.
12. The method for screening rice with low palmitic acid content and the special primer thereof according to claim 2, wherein the method comprises the following steps: 91 parts of rice materials are adopted for fluorescent labeling of SNP variation sites.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815769.9A CN115637296A (en) | 2021-07-19 | 2021-07-19 | Method for screening rice with low palmitic acid content and special primer thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815769.9A CN115637296A (en) | 2021-07-19 | 2021-07-19 | Method for screening rice with low palmitic acid content and special primer thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115637296A true CN115637296A (en) | 2023-01-24 |
Family
ID=84940222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110815769.9A Pending CN115637296A (en) | 2021-07-19 | 2021-07-19 | Method for screening rice with low palmitic acid content and special primer thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115637296A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117568515A (en) * | 2023-12-01 | 2024-02-20 | 海南大学三亚南繁研究院 | SNP locus related to rice linoleic acid content and application thereof |
-
2021
- 2021-07-19 CN CN202110815769.9A patent/CN115637296A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117568515A (en) * | 2023-12-01 | 2024-02-20 | 海南大学三亚南繁研究院 | SNP locus related to rice linoleic acid content and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113293227B (en) | SNP molecular marker primer for identifying color traits of waxberry fruits and application thereof | |
| CN111286541B (en) | Haplotype marker related to lambing number in 3' UTR of goat ZBP1 gene and application thereof | |
| CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN105969879B (en) | Primer group for high-throughput detection of AhFAD2A gene mutation site typing and detection method | |
| CN109593876A (en) | The KASP label serotype specific primer group and its application of high throughput detection AhFAD2B gene mutation site | |
| CN107881246B (en) | Litopenaeus vannamei EST-STR marker and amplification primer, detection method and application thereof | |
| CN113621734B (en) | Molecular marker primer combination for rapidly identifying super-large fruit type characters of waxberries and application thereof | |
| CN111961747A (en) | Method for assisting in identifying sugar content of watermelon fruit, SNP marker and KASP marker | |
| CN115637296A (en) | Method for screening rice with low palmitic acid content and special primer thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN109295253A (en) | High oleic acid peanut is quickly chosen seeds kit | |
| CN109182557A (en) | A kind of SNP marker and its application for identifying Pelteobagrus vachelli low dissolved oxygen tolerance and coefficient of condition | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN115094158A (en) | KASP marker development of rice blast resistance gene Pid4 and application thereof | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN116555469B (en) | Application of SNP molecular marker closely linked with purple-weed trait gene locus of rape in breeding new variety of dual-purpose purple-weed rape with weed oil | |
| CN115181804B (en) | Molecular marker related to sheep growth traits, detection method and application thereof | |
| CN116411127B (en) | Molecular marker primer combination for rapidly identifying mature-period characters of peach fruits and application thereof | |
| CN114525362B (en) | Primer combination for identifying Apostichopus japonicus population of Anyuan No. 1 and application thereof | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof | |
| CN116334233A (en) | Molecular marker related to sheep tail fat deposition, detection method and application thereof | |
| CN117248037A (en) | SNP (Single nucleotide polymorphism) marker related to high glycogen content of Haliotis discus hand-held and application thereof | |
| Saito et al. | Allele-Specific Mutation Genotyping with Mismatches in Primer Design |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |