CN115369043B

CN115369043B - Multifunctional basket strain GYDW-YM101 and application thereof

Info

Publication number: CN115369043B
Application number: CN202111532109.6A
Authority: CN
Inventors: 陶刚; 孟玉; 王涛
Original assignee: Guizhou Minzu University
Current assignee: Guizhou Minzu University
Priority date: 2021-12-14
Filing date: 2021-12-14
Publication date: 2023-06-16
Anticipated expiration: 2041-12-14
Also published as: CN115369043A

Abstract

The invention discloses a strain of a basket fungus and application thereof. The inventor of the invention discovers a strain GYDW-YM101 of the genus Brucella and discovers that the strain has strong functions of dissolving phosphorus, promoting growth and antagonizing plant pathogenic bacteria. After the strain grows for 7d on the inorganic phosphorus and organic phosphorus selective culture medium, SPI values reach 1.04 and 1.23. The strain is particularly suitable for inhibiting pathogenic bacteria of cash crops, namely oil tea anthracnose (Colltotrichum camelliae), botrytis cinerea (Botrytis cinerea), sclerotium sojae (Sclerotinia sclerotiorum) and Fusarium oxysporum (Fusarium oxysporum), has good inhibition effect on the harmful bacteria, and can be used for preparing biocontrol microbial inoculum for agricultural production; the strain can also be used for preparing soil amendment and microbial fertilizer, and has remarkable beneficial effects on growth promotion and ecological soil improvement of plant plants under the condition of keeping activity.

Description

Multifunctional basket strain GYDW-YM101 and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a multifunctional basket fungus strain and application thereof.

Background

Talaromyces C.R.Benj. Belonging to the genus Fungi, ascomycota, ascomycetes, eurotiomycetes, eurotiales, tricholomataceae. The basket fungus is a kind of saprophytic fungus with strong adaptability, and is widely distributed in soil, air, water body, plant leaf and rhizosphere in nature. The basket bacteria are important decomposers in the nature, some species can produce high-activity lignocellulose, some species can produce a large amount of yellow or red pigments with bright colors, and some species can promote mineral absorption, disease resistance, stress resistance and growth of plants. For example, the panus pinophilus can secrete high-efficiency cellulase to hydrolyze plant lignocellulose, so that soil humus is increased, and the panus pinophilus can secrete organic acid to dissolve potassium feldspar to promote plant growth; organic acids secreted by the basket yellow (t.flavus) and basket (t.purphigenius) bacteria can dissolve calcium phosphate and mineralize phosphate esters, making them into plant absorbable phosphate forms; the yellow basket bacteria secrete phosphatases which can mineralize organic phosphorus, such as lecithin and phytic acid, and supplement phosphorus elements for plant growth. Still other species, such as Woltmanni (T.worth manni), secrete volatile organic compounds (Volatile organic compounds, VOCs) into the soil, promote seedling growth and promote disease resistance in certain plants such as oilseed rape. However, some species of basket are opportunistic pathogens of humans and animals, and some are common contaminating bacteria for the food industry.

Phosphorus is an important limiting factor in agricultural production, and phosphate fertilizers are used in large quantities in agriculture as common fertilizers, and the indissolvable phosphorus is continuously accumulated in soil. In the ecological environment of the soil, most of phosphorus elements exist in a form of insoluble inorganic phosphorus or organic phosphorus by being combined with metal cations, and plants are difficult to directly absorb and utilize. In recent years, functional phosphorus-dissolving microorganisms in China have few researches, and especially in the aspects of wide separation and screening of phosphorus-dissolving fungus groups and diversity resources, the phosphorus-dissolving microorganisms among different groups and different species have obvious difference in phosphorus-dissolving effect, so that the industrialized development of the phosphorus-dissolving microbial fertilizer is restricted.

The basket fungus and other common fungus groups such as Trichoderma (Trichoderma Pers.) can promote plant growth and produce disease resistance, stress resistance and other functions by improving the rhizosphere microenvironment of soil through the action of metabolites, so that the application of chemical fertilizers and pesticides can be effectively reduced in the practice of agricultural production, ecological transformation application and the like.

Although research on fungus growth promotion and antagonism functions and related fungus resources are many, most of the fungi have single growth promotion or antagonism effect, and only antagonism of a certain plant pathogenic bacteria, the fungi have fewer multifunctional strain resources such as phosphorus dissolution, antagonism and the like, and cannot meet the actual demands of green agriculture and ecological application practice.

Disclosure of Invention

The purpose of the invention is that: provided is a strain of genus Brucella.

And find the application of the strain in dissolving phosphorus in soil.

Meanwhile, the application of the strain in preparing microbial fertilizer is found.

The strain also finds application in preparing a biocontrol microbial inoculum.

The invention is realized in the following way: the strain of the genus Brucella has the microbiological classification named as the strain GYDW-YM101 of the genus Brucella, latin Wen Xueming Talaromyces sp.GYDW-YM101 and the preservation number of CCTCC No: m20211572.

The application of the strain of the genus basket in dissolving phosphorus in soil.

The application of the strain of the genus Brucella in preparing microbial fertilizer.

The application of the strain of the genus Penicillium in preparing a biocontrol microbial inoculum is aimed at primordium tea-oil tree anthracnose, botrytis cinerea, soybean sclerotium and fusarium oxysporum.

The strain GYDW-YM101 (Talaromyces sp.GYDW-YM 101) of the invention is identified as a fungus of the genus Penicillium, and the fungus is preserved to China Center for Type Culture Collection (CCTCC) in 12 months of 2021, with the preservation number of CCTCC No: m20211572, the address is eight paths of Lopa nationality mountain in Wuchang district of Wuhan, hubei province.

The inventor of the invention discovers a strain GYDW-YM101 of the genus Brucella and discovers that the strain has strong functions of dissolving phosphorus, promoting growth and antagonizing plant pathogenic bacteria. After the strain grows for 7d on the inorganic phosphorus and organic phosphorus selective culture medium, SPI values reach 1.04 and 1.23. The strain is particularly suitable for inhibiting pathogenic bacteria of cash crops, namely oil tea anthracnose (Colltotrichum camelliae), botrytis cinerea (Botrytis cinerea), sclerotium sojae (Sclerotinia sclerotiorum) and Fusarium oxysporum (Fusarium oxysporum), has good inhibition effect on the harmful bacteria, and can be used for preparing biocontrol microbial inoculum for agricultural production; the strain can also be used for preparing soil amendment and microbial fertilizer, and has remarkable beneficial effects on growth promotion and ecological soil improvement of plant plants under the condition of keeping activity. The strain of the invention is a multifunctional strain capable of embodying multifunctional use in future practical applications, and is an unusual species different from that which has been published.

Drawings

FIG. 1 shows the phosphate solubilizing ring of GYDW-YM101 (A-B inorganic phosphate medium front and back, C-D organic phosphate medium front and back);

FIG. 2 shows the growth promoting effect of GYDW-YM101 on cucumber seedlings;

FIG. 3 shows the inhibitory effect of GYDW-YM101 on plant pathogenic bacteria in counter culture;

FIG. 4 shows antagonism of the strain broth against 4 plant pathogens (GYDW-YM 101 broth against pathogens, lower 4 plant pathogens control);

FIG. 5 is a GYDW-YM101 phylogenetic tree.

Detailed Description

Example 1: the strain GYDW-YM101 of the genus Brucella

1.1 test materials

1.1.1 plant rhizosphere soil sample source: plant rhizosphere soil was collected using a "five point sampling method". Setting a point at the position of the plant near the root, shoveling the soil with the surface layer of 1-2cm, taking about 200 g of the soil around the plant root system, mixing and filling the soil into a sample bag, recording the longitude and latitude, date, plant name and other information of a sampling place, and photographing the plant. The soil sample is brought back to the laboratory for preservation at 4 ℃.

Plant name	Acquisition site	Longitude and latitude	Sampling time
				Corn	Party Wu Zhen in Guizhou Guiyang City	E:106°65′N:26°49′	2020.01.08

1.1.2 Medium

(1) Inorganic phosphorus medium (g/L): glucose 10g, (NH) ₄ ) ₂ SO ₄ 0.5g、NaCl 0.3g、KCl 0.3 g、MgSO ₄ 0.3g、MnSO ₄ 0.03g、FeSO ₄ ·7H ₂ O0.03 g, yeast paste 0.5g, ca ₃ (PO ₄ ) ₂ 3g, 16g of agar, 1000mL of distilled water and pH value of 6.8-7.0. Sterilizing at 121deg.C for 30 min.

(2) Organophosphorus Medium (g/L): glucose 10g, (NH) ₄ ) ₂ SO ₄ 0.5g、NaCl 0.3g、KCl 0.3 g、MgSO ₄ 0.3g、MnSO ₄ 0.03g、FeSO ₄ ·7H ₂ O0.03 g, yeast extract 0.4g, lecithin 0.2g, caCO ₃ 5g, 16g of agar, 000mL of distilled water, and pH value of 7.0-7.2. Sterilizing at 121deg.C for 30 min.

1.2 isolation and screening of phosphorus-dissolving fungi

(1) 10g of soil sample is weighed into 90mL for sterilizationShake culturing in water at 28deg.C in shaking table for 30min at 150r/min; (2) Adopting a gradient dilution method, and sequentially diluting the concentration of the soil suspension into 10 ^-3 、10 ^-4 And 10 ^-5 Sequentially taking 100 mu L of the mixture and respectively coating the mixture on an inorganic phosphorus culture medium plate and an organic phosphorus culture medium plate, repeating the steps for 3 times, and culturing the mixture in an inverted incubator at a constant temperature of 28 ℃;

(2) After 5-7d of culture, single colony with a phosphorus dissolving ring is selected to carry out purification verification on an inorganic phosphorus solid flat plate and an organic phosphorus solid flat plate, each single colony is repeated for 2 times, and the culture is carried out in an inversion way at the constant temperature of 28 ℃;

(3) And (5) after purification, combining and preserving strains with similar morphology in the same crop.

1.3 determination of the phosphate solubilizing Capacity of the Flat plate

The purified phosphate-solubilizing fungi were inoculated on inorganic phosphorus and organic phosphorus medium plates by plate assay, cultured upside down at constant temperature of 28℃and the diameter (D) of the colonies and the diameter (D) of the phosphate solubilizing ring were measured by crisscross method at 5-7D, and the phosphate solubilizing index (SPI) was calculated, SPI= (colony diameter+phosphate solubilizing ring diameter)/colony diameter.

1.4 test for growth promotion of fungal Strain

1.4.1 test tube cucumber seedling growth promotion evaluation experiment

The experimental strain is inoculated to a PDA culture plate for activation, and after the experimental strain is cultured for 5 days at the temperature of 28 ℃, the culture plate is fully paved with bacterial strain hypha and spores for standby.

Selecting full cucumber seeds of Zhongnong No. 6, sterilizing with 10% sodium hypochlorite for 5 minutes, and washing with sterile water for 5 times; dipping the washed seeds with 1% CMC (sodium carboxymethylcellulose), and then dipping spores of the strain respectively; placing the seeds dipped with spores in a culture dish (sterilized by gauze and culture dish) paved with gauze according to 10 grains/dish, dripping sterilized water for moisturizing, culturing for 4 days at 28 ℃ in a culture box, growing cotyledons and roots, and then culturing for 24 hours under illumination for later use.

The test tubes were placed on a tube rack and half of the 1/8MS medium was added using 150X 15mm test tubes, sterilized, and sterilized in 1/8MS medium. Transplanting the cucumber seedlings into test tubes, 1 strain/tube, 5 repetitions of each strain, culturing in a greenhouse at 25-28 ℃, alternately illuminating and dark culturing at daytime and night by a tissue culture lamp, and harvesting and measuring the fresh weight and the dry weight after 15-20 days.

1.4.2 analysis of experimental data

The data were collated with Excel software, and LSD was selected to check for significance of differences between the different treatments (p < 0.05), DPS software for analysis of variance. The growth promotion rate of the experimental strain on the plant height of the cucumber test-tube plantlet is calculated by the formula, and the fresh weight and the dry weight are the same:

growth promotion rate (%) = (weight of treated test tube seedling-weight of control test tube seedling)/(weight of control test tube seedling) ×100% of experimental strain

1.5 Strain antagonistic test

1.5.1 test pathogenic bacteria

The crop pathogenic bacteria tea-oil tree anthrax (Colltotrichum camelliae), botrytis cinerea (Botrytis cinerea), sclerotium rolfsii (Sclerotinia sclerotiorum) and Fusarium oxysporum (Fusarium oxysporum) are provided by China national academy of agricultural sciences plant protection institute Li Shidong laboratory.

1.5.2 plate counter method test method

Inoculating an experimental strain to be tested to a PDA culture plate for activation, culturing for 5 days at 28 ℃, respectively taking pathogenic bacteria and a bacterial cake to be tested by using a puncher, inoculating the two bacteria to the same PDA plate at a distance of 4cm, repeating each group of bacteria by 3 times, taking the single pathogenic bacteria as a control, culturing at 28 ℃, measuring the colony radius of the pathogenic bacteria towards the experimental strain after 7 days, and calculating the inhibition rate.

Inhibition ratio (%) = (control pathogen colony radius-treated pathogen colony radius)/(control pathogen colony radius) ×100%

1.5.3 fermentation broth antagonism test method

The experimental strain is inoculated on a PDA culture medium for culturing for about 7 days, 8 bacterial cakes with the diameter of 5mm are inoculated on a PDB liquid culture medium from a culture plate full of bacterial colonies, the bacterial strains are cultured for 4 days by shaking culture at the temperature of 28 ℃ by a shaking table with the speed of 200r/min, spores and mycelia of the bacterial strains are removed by filtration of a sterilizing filter paper, centrifugation is carried out for 10min at the normal temperature of 7830r/min, and a filter membrane with the diameter of 0.22 mu m is used for filtering supernatant to prepare sterile filtrate. After cooling to about 50℃10mL of sterile filtrate of the experimental strain was added to 90mL of the medium, and the mixture was poured into a plate. Inoculating plant pathogenic bacteria to the right center of the plate, and culturing in a constant temperature dark box at 28deg.C for 7 days. The bacterial colony radius of pathogenic bacteria is measured by a crisscross method to calculate the antibacterial effect. The data were collated with Excel 2010 software, and LSD was selected to check for significance of differences between the different treatments (p < 0.05), DPS software for analysis of variance. The inhibition rate against plant pathogenic bacteria was calculated by the formula of 1.5.2.

1.6 molecular phylogenetic identification of strains

(1) After the activated experimental strain grows to be fully paved on a culture plate, scraping hypha by using a sterilization scalpel, collecting the hypha, and extracting genome DNA by using a 2% CTAB method;

(2) ITS using fungal ITS universal primers ₁ (5'-TCCGTAGGT GAACCTGCGG-3') and ITS ₄ (5'-TCCTCCGCTTATTGATATGC-3') PCR amplification was performed. PCR reaction System (25. Mu.L): 2X Es Taq Master Mix (Beijing Tiangen Biotechnology Co., ltd.) 12.5 mu. L, DNA template 1. Mu.L, universal primers ITS1 and ITS ₄ 1 mu L of each and dd H ₂ O9.5. Mu.L, dd H was added to the control ₂ O replaces the DNA template. PCR amplification conditions: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 56℃for 30s, elongation at 72℃for 1 min,35 cycles; extending at 72 ℃ for 10min and 8 ℃ in infinity. Detecting the amplified product by 1.2% agarose gel electrophoresis, and sending to Shanghai Biotechnology company for sequencing;

(3) Comparing the sequencing result with ITS sequences in GenBank of NCBI, selecting a reference sequence with higher sequence similarity, comparing the sequences by using BioEdit software (version 7.0.9) and manually correcting, comparing the processed data with the sequence by using MEGA6.0 software and the sequencing sequence, manually cutting the corrected sequence, constructing a molecular phylogenetic Tree by using an adjacent method (Neighbor-Joining Tree), and identifying the classification status of the trichoderma strain. And constructing a phylogenetic tree.

2. Results

2.1 The GYDW-YM101 strain has strong capability of dissolving inorganic phosphorus and organic phosphorus, and SPI value reaches 1.04 and 1.23 (figure 1).

2.2 Growth promoting effect of GYDW-YM101 strain

TABLE 1 influence of GYDW-YM101 on cucumber seedling growth

Note that: the lower case letters after the same column of numbers represent significant differences (P.ltoreq.0.05)

TABLE 2 growth promoting rate of GYDW-YM101 on cucumber seedlings

2.3 Antagonism of GYDW-YM101 against 4 plant pathogens

TABLE 3 inhibition of phytopathogens by counter cultures

TABLE 4 diameter (mm) and inhibition ratio (%)

Pathogenic bacteria	Tea-oil camellia anthrax	Botrytis cinerea	Sclerotinia sojae	Fusarium oxysporum
					Colony diameter (mm)	41±0.58	32.67±1.33	44.67±2.03	51.33±1.2
CK	45.67±2.33	71±0.58	35±1.73	59.33±2.33
					Inhibition ratio (%)	42.25％±0.008	6.67％±0.038	24.72％±0.034	20.62％±0.018

2.4 Molecular biological identification of GYDW-YM101 strain

2.4.1 ITS rDNA sequencing sequence

GYDW-YM101[ ITS sequence ]

CGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCG GGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTC TGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAA CAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT GTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGC ATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGT TGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCC TCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCA CCATGTTTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGC ATATCA

2.4.2 molecular phylogenetic characterization

The strain GYDW-YM101 was collected as a branch with the Talaromyces species (T.tumuli, T.adpress) of the genus Brucella, and was identified as a similar species (FIG. 5), and GYDW-YM101 was initially identified as a Brucella species.

From the experiment, the SPI values of the strain reach 1.04 and 1.23 after the strain grows for 7d on an inorganic phosphorus and organic phosphorus selection medium; the test tube seedling evaluation test results show that the fresh weight and the dry weight of the cucumber seedlings are respectively increased by 18.3 percent and 13.5 percent; the results of the plate antagonism test show that the bacteriostasis rates of the bacillus anthracis, the botrytis cinerea, the soybean sclerotinia and the fusarium oxysporum respectively reach 54.17 percent, 34.15 percent, 48.81 percent and 59.85 percent; the results of the antagonism experiment of the strain fermentation broth show that the inhibition rates of the 4 pathogenic bacteria are 42.25%, 6.67%, 24.72% and 20.62%, respectively.

Proved that the strain of the invention has strong functions of dissolving phosphorus, promoting growth and antagonizing plant pathogenic bacteria, and can be used for soil phosphorus dissolving and modifying agent and preparing microbial fertilizer and biocontrol microbial inoculum.

Sequence listing

<110> university of national institute of Guizhou

<120> a multifunctional basket strain GYDW-YM101 and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 523

<212> DNA

<213> genus basket (Talaromyces)

<400> 1

cgcggcccaa cctcccaccc ttgtctctat acacctgttg ctttggcggg cccaccgggg 60

ccacctggtc gccgggggac gcacgtcccc gggcccgcgc ccgccgaagc gctctgtgaa 120

ccctgatgaa gatgggctgt ctgagtacta tgaaaattgt caaaactttc aacaatggat 180

ctcttggttc cggcatcgat gaagaacgca gcgaaatgcg ataagtaatg tgaattgcag 240

aattccgtga atcatcgaat ctttgaacgc acattgcgcc ccctggcatt ccggggggca 300

tgcctgtccg agcgtcattt ctgccctcaa gcacggcttg tgtgttgggt gtggtccccc 360

cggggacctg cccgaaaggc agcggcgacg tccgtctggt cctcgagcgt atggggctct 420

gtcactcgct cgggaaggac ctgcgggggt tggtcaccac catgttttta ccacggttga 480

cctcggatca ggtaggagtt acccgctgaa cttaagcata tca 523

Claims

1. A strain of a genus basket, characterized in that: the microbiological classification is named as a strain GYDW-YM101 of the genus Brucella, latin Wen Xueming Talaromyces sp.GYDW-YM101, and the preservation number is CCTCC M20211572.

2. Use of the strain of the genus basket of claim 1 in soil phosphorus solubilization.

3. Use of a strain of the genus basket of claim 1 for the preparation of a microbial fertilizer.

4. Use of the strain of the genus basket of claim 1 for the preparation of a biocontrol agent, characterized by: the biocontrol microbial inoculum is aimed at primordium tea-oil tree anthracnose, botrytis cinerea, soybean sclerotinia and fusarium oxysporum.