CN105176895B - A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt - Google Patents
A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt Download PDFInfo
- Publication number
- CN105176895B CN105176895B CN201510742977.5A CN201510742977A CN105176895B CN 105176895 B CN105176895 B CN 105176895B CN 201510742977 A CN201510742977 A CN 201510742977A CN 105176895 B CN105176895 B CN 105176895B
- Authority
- CN
- China
- Prior art keywords
- hmb27634
- bacillus amyloliquefaciens
- verticillium wilt
- cotton
- cotton verticillium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241001123668 Verticillium dahliae Species 0.000 title claims abstract description 60
- 229920000742 Cotton Polymers 0.000 title claims abstract description 49
- 241000193744 Bacillus amyloliquefaciens Species 0.000 title claims abstract description 47
- 230000003405 preventing Effects 0.000 title abstract description 5
- 230000001580 bacterial Effects 0.000 claims abstract description 52
- 230000000813 microbial Effects 0.000 claims abstract description 21
- 230000002265 prevention Effects 0.000 claims abstract description 21
- 238000002360 preparation method Methods 0.000 claims abstract description 19
- 244000005700 microbiome Species 0.000 claims description 18
- 239000007788 liquid Substances 0.000 claims description 13
- 239000000470 constituent Substances 0.000 claims description 7
- HNBDQABBWNOTRU-UHFFFAOYSA-N thalline Chemical compound C1=CC=[Tl]C=C1 HNBDQABBWNOTRU-UHFFFAOYSA-N 0.000 claims description 6
- 101710031899 moon Proteins 0.000 claims 1
- 239000003795 chemical substances by application Substances 0.000 abstract description 16
- 241000894006 Bacteria Species 0.000 abstract description 13
- 201000010099 disease Diseases 0.000 abstract description 12
- 230000000443 biocontrol Effects 0.000 abstract description 9
- 230000003449 preventive Effects 0.000 abstract description 5
- 206010059866 Drug resistance Diseases 0.000 abstract description 3
- 230000002045 lasting Effects 0.000 abstract description 3
- 238000003912 environmental pollution Methods 0.000 abstract description 2
- 230000000857 drug effect Effects 0.000 abstract 1
- 241000196324 Embryophyta Species 0.000 description 18
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 18
- 244000144987 Brood Species 0.000 description 17
- 210000004027 cells Anatomy 0.000 description 17
- FAPWRFPIFSIZLT-UHFFFAOYSA-M sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 16
- 241000193830 Bacillus <bacterium> Species 0.000 description 14
- 230000003321 amplification Effects 0.000 description 14
- 230000000694 effects Effects 0.000 description 14
- 238000003199 nucleic acid amplification method Methods 0.000 description 14
- 239000000843 powder Substances 0.000 description 14
- 239000002068 microbial inoculum Substances 0.000 description 13
- 230000004224 protection Effects 0.000 description 12
- 240000007842 Glycine max Species 0.000 description 10
- 235000010469 Glycine max Nutrition 0.000 description 10
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 10
- 235000005822 corn Nutrition 0.000 description 10
- 235000005824 corn Nutrition 0.000 description 10
- 235000013312 flour Nutrition 0.000 description 10
- 230000002401 inhibitory effect Effects 0.000 description 10
- 239000002609 media Substances 0.000 description 10
- 241000209149 Zea Species 0.000 description 9
- 229920001670 16S ribosomal RNA Polymers 0.000 description 8
- 229920003013 deoxyribonucleic acid Polymers 0.000 description 8
- 239000011780 sodium chloride Substances 0.000 description 8
- 101700013200 gyrB1 Proteins 0.000 description 7
- 101700072042 parE Proteins 0.000 description 7
- 210000004215 spores Anatomy 0.000 description 7
- 240000008371 Bacillus subtilis Species 0.000 description 6
- 229940075615 Bacillus subtilis Drugs 0.000 description 6
- 235000014469 Bacillus subtilis Nutrition 0.000 description 6
- VTYYLEPIZMXCLO-UHFFFAOYSA-L calcium carbonate Chemical compound [Ca+2].[O-]C([O-])=O VTYYLEPIZMXCLO-UHFFFAOYSA-L 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 239000000725 suspension Substances 0.000 description 6
- 229940041514 Candida albicans extract Drugs 0.000 description 5
- 230000000844 anti-bacterial Effects 0.000 description 5
- 229920001690 polydopamine Polymers 0.000 description 5
- 238000010998 test method Methods 0.000 description 5
- 239000012138 yeast extract Substances 0.000 description 5
- 229920001817 Agar Polymers 0.000 description 4
- 230000004913 activation Effects 0.000 description 4
- 239000008272 agar Substances 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 239000003814 drug Substances 0.000 description 4
- 230000000877 morphologic Effects 0.000 description 4
- 230000001717 pathogenic Effects 0.000 description 4
- 238000007747 plating Methods 0.000 description 4
- 238000002791 soaking Methods 0.000 description 4
- 239000004563 wettable powder Substances 0.000 description 4
- 229960003563 Calcium Carbonate Drugs 0.000 description 3
- 240000009176 Dahlia pinnata Species 0.000 description 3
- 235000012040 Dahlia pinnata Nutrition 0.000 description 3
- SQQMAOCOWKFBNP-UHFFFAOYSA-L Manganese(II) sulfate Chemical compound [Mn+2].[O-]S([O-])(=O)=O SQQMAOCOWKFBNP-UHFFFAOYSA-L 0.000 description 3
- 229920001850 Nucleic acid sequence Polymers 0.000 description 3
- 241000082085 Verticillium <Phyllachorales> Species 0.000 description 3
- 229910000019 calcium carbonate Inorganic materials 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 235000013399 edible fruits Nutrition 0.000 description 3
- 239000012530 fluid Substances 0.000 description 3
- 239000001963 growth media Substances 0.000 description 3
- 238000011081 inoculation Methods 0.000 description 3
- 229910000357 manganese(II) sulfate Inorganic materials 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 238000000034 method Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000002689 soil Substances 0.000 description 3
- 238000009331 sowing Methods 0.000 description 3
- 230000004763 spore germination Effects 0.000 description 3
- 230000001954 sterilising Effects 0.000 description 3
- 239000012137 tryptone Substances 0.000 description 3
- 241000726221 Gemma Species 0.000 description 2
- 238000010629 Molecular evolutionary genetics analysis Methods 0.000 description 2
- 240000007594 Oryza sativa Species 0.000 description 2
- 235000007164 Oryza sativa Nutrition 0.000 description 2
- 239000001888 Peptone Substances 0.000 description 2
- 108010080698 Peptones Proteins 0.000 description 2
- 229920002472 Starch Polymers 0.000 description 2
- 230000003042 antagnostic Effects 0.000 description 2
- 239000003899 bactericide agent Substances 0.000 description 2
- 230000000295 complement Effects 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000006916 nutrient agar Substances 0.000 description 2
- 244000052769 pathogens Species 0.000 description 2
- 235000019319 peptone Nutrition 0.000 description 2
- 235000009566 rice Nutrition 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 239000008107 starch Substances 0.000 description 2
- 235000019698 starch Nutrition 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 239000003643 water by type Substances 0.000 description 2
- 241000194108 Bacillus licheniformis Species 0.000 description 1
- 241000194103 Bacillus pumilus Species 0.000 description 1
- 210000000481 Breast Anatomy 0.000 description 1
- 206010011732 Cyst Diseases 0.000 description 1
- 210000004700 Fetal Blood Anatomy 0.000 description 1
- 210000003495 Flagella Anatomy 0.000 description 1
- 241000194105 Paenibacillus polymyxa Species 0.000 description 1
- 210000000496 Pancreas Anatomy 0.000 description 1
- 206010061926 Purulence Diseases 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000002113 chemopreventative Effects 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 235000012343 cottonseed oil Nutrition 0.000 description 1
- 238000003967 crop rotation Methods 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 239000003085 diluting agent Substances 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 229940079593 drugs Drugs 0.000 description 1
- 235000014103 egg white Nutrition 0.000 description 1
- 210000000969 egg white Anatomy 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000855 fermentation Methods 0.000 description 1
- 230000004151 fermentation Effects 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000002068 genetic Effects 0.000 description 1
- 239000004615 ingredient Substances 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 238000009630 liquid culture Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 238000000386 microscopy Methods 0.000 description 1
- 239000002777 nucleoside Substances 0.000 description 1
- 125000003835 nucleoside group Chemical group 0.000 description 1
- 238000004382 potting Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 238000004080 punching Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000003068 static Effects 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000001360 synchronised Effects 0.000 description 1
- 238000004450 types of analysis Methods 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
- 238000005303 weighing Methods 0.000 description 1
Abstract
The invention belongs to Strategies of Agricultural Bio-control fields, specifically disclose a kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27634 for preventing cotton disease, and deposit number is CGMCC No.11455.The invention also discloses using the bacterium prepare microbial bacterial agent and they prevention cotton verticillium wilt on application.Bacillus amyloliquefaciens HMB27634 of the present invention is high to the drug effect of cotton verticillium wilt, and average preventive effect is and with strong points 80.0% or more;Secondly, for microbial bacterial agent of the present invention to people, animal safety, environmental pollution is small;In addition, using present invention prevention cotton verticillium wilt lasting period length, being not likely to produce drug resistance;Preparation method of the present invention is simple, it is at low cost, using simple.
Description
Technical field
The invention belongs to Strategies of Agricultural Bio-control fields, and in particular to a kind of solution starch gemma bar for preventing cotton disease
Bacterium, and the microbial bacterial agent containing the bacillus amyloliquefaciens further relate to their applications on prevention cotton verticillium wilt.
Background technology
Cotton verticillium wilt is that the harm caused by dahlia Verticillium dahliae (Verticillium dahaliae) is serious and difficult
With the soil-borne disease of prevention.Cotton verticillium wilt is in China's population outbreak regularly, the sown areas of cotton being affected by it every year
At 40,000,000 mu or more, cotton underproduction 10%-20% or so, disease is caused serious plot to occur, the underproduction is caused to may be up to throughout the year
60%-70%.
The method of prevention cotton verticillium wilt mainly has:When chemical prevention, but chemopreventive effects are poor, and be easy
Environmental pollution is caused, the ecological balance in farmland is destroyed;Second is that crop rotation, but under the conditions of previous specific agricultural environment, the more ground of people
Less and the high price crop species of replacement cotton are deficient, it is difficult to promote and apply.Third, biological control, biological control is due to environment
Pollute it is small, to safety of human and livestock, specialization is strong, be not likely to produce drug resistance, the effect lasting period is long, can effective protection natural enemy, be produced into
This low advantage is increasingly subject to the favor of people.
Bacillus (Bacillius sp) is wide with its distribution, easily separated culture, can generate the stronger brood cell of resistance, storage
The features such as Tibetan phase is grown and is easy to use, becomes a kind of ideal Biocontrol microorganism.Because bacillus can generate in sprout born of the same parents, have pole
Strong anti-adversity ability compares other kinds of bio-control factors, is more advantageous to the production of microbial inoculum, survive in formulation environment,
It colonizes and breeds.Therefore, screening the bacillus inhibited to pathogen is prevented in relation to the most effective of plant disease
One of method.
The bacillus for being presently used for prevention crop verticillium wilt mainly has bacillus subtilis, bacillus licheniformis, A Sa
Er Jiya bacillus, bacillus pumilus, bacillus amyloliquefaciens, bacillus polymyxa etc. achieve significant prevention effect
Fruit.But due to the diversity of pathogen and synchronous evolution, it is still necessary to find new bacterial strain and be applied to prevention cotton verticillium wilt.
Through retrieval, the report in relation to Bacillus amyloliquefaciens strain HMB27634 of the present invention is not found.
Invention content
Present invention aims at provide a kind of Bacillus amyloliquefaciens strain for preventing cotton verticillium wilt, bacterial strain tool
There is efficient, broad spectrum antibacterial activity.
The present invention second is designed to provide the microbial bacterial agent using the production of above-mentioned bacillus amyloliquefaciens.
Third of the present invention is designed to provide the preparation method of mentioned microorganism microbial inoculum.
The present invention the 4th is designed to provide purposes of the above-mentioned Bacillus amyloliquefaciens strain on prevention cotton verticillium wilt.
The present invention the 5th is designed to provide purposes of the mentioned microorganism microbial inoculum on prevention cotton verticillium wilt.
The present invention the 6th is designed to provide the identification method of above-mentioned Bacillus amyloliquefaciens strain.
The present invention the 7th is designed to provide the identification method of mentioned microorganism microbial inoculum.
The invention is realized by the following technical scheme:
A kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27634, oneself was in 2015
September is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on the 29th, and (preservation address is:Beijing's southern exposure
No. 3 Institute of Microorganism, Academia Sinica of institute of area North Star West Road 1), deposit number is CGMCC No.11455.
The microbial bacterial agent produced using above-mentioned bacillus amyloliquefaciens HMB27634, active constituent are HMB27634 bacterium
Body.
Mentioned microorganism microbial inoculum can be liquid preparation.
Mentioned microorganism microbial inoculum, the viable count containing HMB27634 are more than 15.0 × 108cfu/mL。
The preparation method of mentioned microorganism microbial inoculum, includes the following steps:
(1) actication of culture:The HMB27634 bacterial strains of Cord blood are activated on LB plating mediums, picking single bacterium colony exists
It is cultivated 10~16 hours for 25~35 DEG C on LB slant mediums, obtains the bacterial strain of activation;
(2) prepared by seed liquor:The inoculation of a ring step (1) activation is scraped to 100mL LB liquid with sterile oese
In body culture medium, in 25~35 DEG C, shaking speed to be cultivated 10~16 hours under conditions of 150~220rpm, seed liquor is obtained;
(3) fermented and cultured:The seed liquor of step (2) is linked into corn flour soya bean by the ratio for being 1~3% according to volume ratio
In powder culture medium, fermented and cultured 40-50h under conditions of temperature is 25~35 DEG C, shaking speed is 150~220rpm must be sent out
Zymotic fluid;
(4) thalline and brood cell's quantity in zymotic fluid are detected, waits in zymotic fluid that ripe brood cell accounts for brood cell and thalline sum
Stop fermented and cultured when 90%;Gained is the liquid preparation of HMB27634 bacterial strains.
LB plating mediums, LB slant mediums and the LB liquid medium is conventionally prepared.
LB plating mediums described in above-mentioned preparation method step (1) or LB slant mediums, constituent and its
Weight ratio is:8~12g of tryptone, 4~6g of yeast extract, 4~6g of sodium chloride, 12~18g of agar powder, water 1000mL.
LB liquid medium described in above-mentioned preparation method step (2), constituent and its weight ratio are:Tryptose
8~12g of peptone, 4~6g of yeast extract, 4~6g of sodium chloride, water 1000mL.
The corn flour soybean powder medium described in above-mentioned preparation method step (3), constituent and its again
Measuring percentage is:Corn flour 1.0~3.0%, analysis for soybean powder 1.0~3.0%, NaCl 0.1~1.0%, MnSO4·H2O 0.5~
1.0%, remaining is water;PH value is 7.0.
The preparation method of the corn flour soybean powder medium, according to weight percent by corn flour, analysis for soybean powder, NaCl
And MnSO4·H2O is mixed, and is added water, and is adjusted pH and is stirred evenly.
Applications of the above-mentioned bacillus amyloliquefaciens HMB27634 on prevention cotton verticillium wilt.
Application of the mentioned microorganism microbial inoculum on prevention cotton verticillium wilt.
The application method of mentioned microorganism microbial inoculum:Above-mentioned gained microbial bacterial agent, which is diluted with water to viable bacteria body number, is
108Cfu/mL is adsorbed with calcium carbonate by cotton seeds seed soaking half an hour or by above-mentioned gained microbial bacterial agent before sowing, is made
At bacillus amyloliquefaciens HMB27634 pulvis, according to pesticide-seeds ratio 1 before sowing cotton seed:10 seed dressings, can reach and prevent cotton
The purpose that verticillium wilt occurs.
The screening separation process of HMB27634 bacterial strains
HMB27634 bacterial strains are Cotton Soil of the Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie from Jingzhou City of Hubei Province
In it is isolated.In April, 2013, Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's Plant Protection Institute was adopted for 5 points from Jingzhou City of Hubei Province cotton field
Collect soil sample, weighing 1g after mixing is put into the sterilizing triangular flask of 250mL, and 100mL sterile waters are added, are put on shaking table, 170r/
Min vibrates 30min, stands 2h, and supernatant 10mL is taken to be added in 50mL sterile centrifugation tubes, in 80 DEG C of waters bath with thermostatic control 30 minutes, so
After take 1mL to add sterile water 9mL, 10mL10-3Times edaphon suspension, is then diluted to 10 by soil supension-4、10-5、
10-6Times dilution, takes each 200 μ L of concentration microorganism suspension to be applied on LB culture medium flat plates, each concentration is repeated 3 times, at 30 DEG C
Constant temperature incubation 1d-3d carries out the separation and purifying of bacterium.And using cotton verticillium wilt as target, tried by double-layer agar technique, potting
It tests method and field plot trial carries out the screening of biocontrol microorganisms.As a result therefrom filter out one has apparent prevention to cotton verticillium wilt
The bacterial strain of effect is named as HMB27634.
The taxonomic identification of HMB27634 bacterial strains:
(1) identification by morphological characters
It is rod-shaped that thalline is cultivated on LB culture mediums, and brood cell is generated after cultivating 10h, raw in brood cell, ellipse, and cyst is not swollen
Greatly, acid-fast stain is negative, and no parasporal crystal can move, flagellum Zhousheng.On nutrient agar panel, the light breast of Initial stage of culture bacterium colony
White, purulence shape is round, neat in edge, and bacterium colony protuberance is in steamed bun shape, surface wettability;Late stage of culture bacterium colony is faint yellow, and edge is not whole
Together, dry tack free has fold;It crosses and cultivates on nutrient agar slopes, it is linear;Static gas wave refrigerator in liquid medium, table
Face forms white mycoderm.These morphological features with《Common bacteria system identification handbook》(east show pearl etc. writes Science Presses
.2001 year) described in bacillus morphological feature it is almost the same, tentatively judge that bacterial strain HMB27634 belongs to bacillus
(Bacillus)。
(2) 16S rDNA Sequence Identifications are utilized to classify
Using the genomic DNA of HMB27634 as template, PCR amplification is carried out by primer pair 16S rDNA of F27 and R1492,
The primer sequence is:
F27:5’AGAGTTTGATCATGGCTCAG3’;(SEQ ID No:1)
R1492:5’GGCTACCTTGTTACGACTT3’;(SEQ ID No:2)
The amplification reaction system of 16S rDNA is 50 μ L:10×PCR Buffer(Mg2+)5μL;dNTP Mixture
(2.5mM)5μL;Taq (5U/ μ L) 1 μ L, F27 (10 μm of ol/L) 1 μ L, R1492 (10 μm of ol/L) 1 μ L;The genome of HMB27634
DNA 50ng;ddH2O complements to 50 μ L.The reaction condition of PCR is 95 DEG C of 5min;95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min,
30 cycles;72℃10min.Gained pcr amplification product is subjected to gel electrophoresis, delivers Shanghai Sheng Gong bioengineering Co., Ltd
Sequencing, obtains the 16S rDNA sequences of HMB27634 (see SEQ ID No:3).The 16S rDNA sequences of gained HMB27634 are existed
Carry out tetraploid rice in Genbank, the 16S rDNA homologys of results strain HMB27634 and bacillus reach 99%;
Phylogenetic tree construction (see Fig. 1), HMB27634 are aggregated to together with bacillus, illustrate that HMB27634 belongs to bacillus
Belong to (Bacillus).
(3) the identification classification of gyrB gene orders is utilized
Using HMB27634 genomic DNAs template, bacillus gyrB gene degenerate primers gyrB-F and gyrB-R are utilized
PCR amplification is carried out for primer, obtains pcr amplification product;The sequence of the wherein described gyrB-F and gyrB-R primers is:
gyrB-F:5’TTGRCGGHRGYGGHTATAAAGT3’;(SEQ ID No:4)
gyrB-R:5’TCCDCCSTCAGARTCWCCCTC3’;(SEQ ID No:5)
The pcr amplification reaction system of gyrB is 50 μ L:10×PCR Buffer(Mg2+)5μL;dNTP Mixture
(2.5mM)5μL;Taq(5U/μL)1μL;GyrB-F (10 μm of ol/L) 1 μ L, gyrB-R (10 μm of ol/L) 1 μ L;HMB27634 genes
Group DNA 50ng;ddH2O complements to 50 μ L.The reaction condition of PCR is 95 DEG C of 5min;95 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 1min,
30 cycles;72℃10min.Amplified production is delivered into the sequencing of Shanghai Sheng Gong bioengineering Co., Ltd, obtains HMB27634 bacterial strains
GyrB gene orders (see SEQ ID No:6).By the gyrB gene orders of the HMB27634 bacterial strains of acquisition in Genbank into
Row tetraploid rice, at the same using MEGA softwares (Molecular Evolutionary Genetics Analysis, molecule into
Change genetic analysis) phylogenetic tree construction.As a result, it has been found that the gyrB gene orders of HMB27634 and bacillus amyloliquefaciens are homologous
Property highest, reaches 99.29%;Phylogenetic tree construction (see Fig. 2), HMB27634 bacterial strains are aggregated to one with bacillus amyloliquefaciens
It rises, illustrates that HMB27634 is bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and be a new strains.
In summary morphological feature, 16S rDNA and gyrB gene homology comparative analyses as a result, understanding
HMB27634 belongs to bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and with existing solution starch gemma
Bacillus strain is different, is a new strains.
The identification method of above-mentioned bacillus amyloliquefaciens HMB27634 bacterial strains includes being with the genomic DNA of strain to be tested
Template carries out PCR amplification by primer of F27 and R1492, if gained pcr amplification product is SEQ ID No:Nucleosides shown in 3
Acid sequence, as HMB27634 bacterial strains.
The identification method of above-mentioned bacillus amyloliquefaciens HMB27634 bacterial strains includes being with the genomic DNA of strain to be tested
Template carries out PCR amplification by primer of gyrB-F and gyrB-R, if gained pcr amplification product is SEQ ID No:Shown in 6
Nucleotide sequence, as HMB27634 bacterial strains.
The identification method of mentioned microorganism microbial inoculum, include using the genomic DNA in microbial inoculum to be measured as template, with F27 and
R1492 is that primer carries out PCR amplification, if gained pcr amplification product is SEQ ID No:Nucleotide sequence shown in 3, as
HMB27634 microbial bacterial agents.
The identification method of mentioned microorganism microbial inoculum, include using the genomic DNA in microbial inoculum to be measured as template, with gyrB-F and
GyrB-R is that primer carries out PCR amplification, if gained pcr amplification product is SEQ ID No:Nucleotide sequence shown in 6, as
HMB27634 microbial bacterial agents.
The present invention has the advantage that and advantageous effect:(1) present invention provides one efficiently for prevention cotton verticillium wilt
Microorganism opens an effective controlling way;(2) medicines of the bacillus amyloliquefaciens HMB27634 of the present invention to cotton verticillium wilt
Effect is high, and average preventive effect is and with strong points 80.0% or more;(3) microbial bacterial agent of the present invention is to people, animal safety, without environment
Pollution;(4) it prevents cotton verticillium wilt lasting period length using the method for the present invention, be not likely to produce drug resistance;(5) preparation method of the present invention
Simply, at low cost, using simple.
Description of the drawings
Fig. 1 are the systematic growth tree graph of the HMB27634 bacterial strains obtained according to 16S rDNA sequences.
Fig. 2 are the systematic growth tree graph of the HMB27634 bacterial strains obtained according to gyrB gene orders.
Specific implementation mode
The present invention is further clearly explained with specific embodiment below, but is not constituted in any way to the present invention
Limitation.Test method in following embodiments is unless otherwise instructed conventional method;Percentage in following embodiments contains
Amount, is weight percentage unless otherwise instructed.
The preparation of embodiment 1HMB27634 microbial bacterial agents
It carries out in accordance with the following steps:
(1) actication of culture:By be stored in -80 DEG C bacterial strain HMB27634 (Bacillus amyloliquefaciens strain HMB27634 oneself
It was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center in 29th in September in 2015, deposit number is
CGMCC No.11455) in LB plating mediums, (its constituent and its weight ratio are:Tryptone 10g, yeast extract
5g, sodium chloride 5g, agar powder 15g, water 1000mL) on activated at 30 DEG C, picking single bacterium colony is in LB slant mediums (its group
It is at ingredient and its weight ratio:Tryptone 10g, yeast extract 5g, sodium chloride 5g, agar powder 15g, water 1000mL) on
It is cultivated 12 hours at 30 DEG C, obtains the bacterial strain of activation;
(2) prepared by seed liquor:Making LB liquid medium according to a conventional method, (its constituent and its weight ratio are:Pancreas egg
White peptone 1g, yeast extract 0.5g, sodium chloride 1g, water 1000mL), LB culture solution 100mL are packed into 250mL triangular flasks, it is high
Moist heat sterilization is pressed, after temperature drops to room temperature, the above-mentioned activated bacterial strain of an oese in step (1) is accessed in every bottle, 30
DEG C, shaken cultivation is carried out under conditions of shaking speed 190rpm 12 hours, obtain seed liquor;
(3) preparation of corn flour soybean powder medium:According to weight percent by corn flour 1.5%, analysis for soybean powder 2.0%,
NaCl 0.5%, MnSO4·H2O 0.6% is added to the water, and is uniformly mixed to get corn flour soybean powder medium;It is sub-packed in
In 500mL triangular flasks, every bottle of 200mL;Sterilizing 30 minutes is carried out to corn flour soybean powder medium at 121 DEG C, then cools to 30
It is DEG C spare;
(4) fermented and cultured:Into every bottle of corn flour soybean powder medium 200mL obtained by step (3) obtained by inoculation step (2)
Seed liquor 2mL;Fermented and cultured 36 hours is carried out under the conditions of 30 DEG C, shaking speed 180rpm, later every 30 minutes from triangle
Bottle in sampling carry out microscopy, in the visual field brood cell and total thalline number count, and calculate brood cell lead (brood cell lead (%)=at
Ripe brood cell's number/(ripe brood cell's number+thalline number) × 100);Brood cell, which leads, stops fermented and cultured when reaching 90%;Common fermentation culture 48
Hour, obtain the liquid preparation of bacillus amyloliquefaciens HMB27634.
Inhibiting effect of the 2 bacillus amyloliquefaciens HMB27634 of embodiment to Verticillium Dahliae spore germination
(1) test period and place:In June, 2013 is in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's plant disease
It is carried out in biological control laboratory.
(2) test method:
(1) for examination Verticillium Dahliae source:Verticillium Dahliae WX-1 bacterial strains pick up from Xingtai City Wei County, Hebei province cotton yellow and wither
Diseased plant isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, Plant Protection College, Hebei Agricultural Univ. plant
Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) tablet measures experiment:
Verticillium Dahliae WX-1 is activated on PDA plate first, in colony edge region picking 4-5 blocks after cultivating 7 days
Mycelia block (irregular shape, about 15mm2), it accesses in PDB culture solutions, 4 is cultivated under the conditions of on constant-temperature table in 25 DEG C, 170rpm
It.Liquid culture is used into double-layer sterile filtered through gauze in aseptic operating platform, obtains Verticillium Dahliae spore suspension (108It is a
Spore/milliliter).2mL Verticillium Dahliae spore suspensions are added in 100mL PDA culture mediums (45-50 DEG C), it is made after mixing
Make PDA plate.Point connects the HMB27634 bacterial strains of the activation of embodiment 1 on PDA plate, and culture observes the transparent journey of inhibition zone after 3 days
Degree (+++ it indicates fully transparent;++ it indicates translucent;+ indicate opaque) and measure inhibition zone size.
As a result the bacillus amyloliquefaciens HMB27634 that (is shown in Table 1) makees Verticillium Dahliae spore germination with strong inhibition
With generating bright inhibition zone, antibacterial circle diameter 2.0mm.Illustrate that bacillus amyloliquefaciens HMB27634 has Verticillium Dahliae
There is apparent inhibiting effect, there is the Biocontrol Potential of prevention cotton verticillium wilt.
Inhibiting effect test result of the 1 HMB27634 bacterial strains of table to Verticillium Dahliae spore germination
Strain name | Transparent circle brightness | Transparent loop diameter (mm) |
HMB27634 | +++ | 2.0 |
3 bacillus amyloliquefaciens HMB27634 of embodiment tests the inhibiting effect that Verticillium Dahliae mycelia grows
(1) test period and place:In July, 2013 is in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's plant disease
It is carried out in biological control laboratory.
(2) test method:
(1) for examination Verticillium Dahliae source:Verticillium Dahliae WX-1 bacterial strains pick up from Xingtai City Wei County, Hebei province cotton yellow and wither
Diseased plant isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, Plant Protection College, Hebei Agricultural Univ. plant
Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) tablet measures experiment:
Verticillium Dahliae WX-1 is activated on PDA plate first, in colony edge region after cultivating 7 days, uses card punchBacterium piece is made in punching, by the switching of Verticillium Dahliae bacterium piece in another PDA plate center, then by 1 step of embodiment
Suddenly the bacillus amyloliquefaciens HMB27634 points activated in (1) are connected on away from 2.0 centimeters of indicator bacteria bacterium piece, if blank control is (no
Point connects the Verticillium Dahliae growing state of HMB27634 bacterial strains).25 DEG C of constant temperature incubations wait for that blank control will cover with entire culture
When ware, control increment (colony radius) and (the inhibition life after inoculation HMB27634 of processing increment of Verticillium Dahliae are measured
Major radius), antagonism is indicated with bacteriostasis rate;Calculation formula is:
Bacteriostasis rate (%)=(control increment-processing increment)/control increment × 100.
As a result (2 are shown in Table):Bacillus amyloliquefaciens HMB27634 is to the inhibiting rate of Verticillium Dahliae up to 83.33%;It is transparent
10.0 millimeters of antibacterial bandwidth;Illustrate that bacillus amyloliquefaciens HMB27634 significantly inhibits Verticillium Dahliae,
Biocontrol Potential with prevention cotton verticillium wilt.
Antagonism test result of the 2 HMB27634 bacterial strains of table to Verticillium Dahliae
Strain name | Compare increment (mm) | Handle increment (mm) | Bacteriostasis rate (%) |
HMB27634 | 30.0 | 5.0 | 83.33 |
4 bacillus amyloliquefaciens HMB27634 of embodiment tests the control effect of cotton verticillium wilt
(1) test process:
(1) microbial bacterial agent:HMB27634 liquid preparations prepared by embodiment 1;It is diluted with water 100 times.
(2) medicament compares:1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd);It is diluted with water 100 times.
(3) blank control:Clear water
(2) test method:This experiment in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's disease flocking biocontrol laboratory into
Row.Cotton variety selects Jifeng 106, the 100 times of water diluent seed soaking of HMB27634 liquid preparations prepared with embodiment 1 before sowing
Half an hour;Using " 1,000,000,000 work brood cell/gram bacillus subtilis wettable powder " 100 times of seed soaking half an hour of dilution as chemical agent
Control;Using Seed soaking half an hour as blank control.After planting normal culture.When cotton seedling grows to two panels true leaf, root is cut
It is inoculated with the spore suspension (10 of Verticillium Dahliae WX-1 bacterial strains7A spore/milliliter).Continue culture fully to fall ill to blank control
When investigate disease index, calculate control effect.
As a result the bacillus amyloliquefaciens HMB27634 of the present invention that (is shown in Table 3) there is prevention well to imitate cotton verticillium wilt
Fruit, for preventive effect up to 69.71%, the effect (71.54%) that cotton verticillium wilt is prevented with the microbial bactericide of formal registration is suitable.
Illustrate that bacillus amyloliquefaciens HMB27634 and its microbial bacterial agent of the present invention have good control effect to cotton verticillium wilt.
3 bacillus amyloliquefaciens HMB27634 of table is to cotton verticillium wilt efficiency test result
Processing | Disease index | Preventive effect (%) |
HMB27634 | 25.21b | 69.71 |
1000000000 work brood cell/gram bacillus subtilis wettable powders | 23.69b | 71.54 |
Blank control | 83.23a | -- |
5 bacillus amyloliquefaciens HMB27634 of embodiment tests the control effect of cotton verticillium wilt
(1) test process:
(1) microbial bacterial agent:HMB27634 liquid preparations prepared by embodiment 1;According to 1:1 Billy adds calcium carbonate, system
Standby HMB27634 pulvis.
(2) medicament compares:1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd).
(3) blank control:Clear water
(2) test method:This experiment in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's disease flocking biocontrol laboratory into
Row.HMB27634 liquid preparations prepared by embodiment 1 are according to 1:1 ratio adds calcium carbonate, prepares HMB27634 pulvis.Cotton
Variety adoption Jifeng 106 sows the HMB27634 pulvis of preceding preparation according to pesticide-seeds ratio 1:10 seed dressings;With " 1,000,000,000 work brood cells/gram
Bacillus subtilis wettable powder " is according to pesticide-seeds ratio 1:10 seed dressings are compareed as medicament;Not handle seed as blank pair
According to.After planting normal culture.When cotton seedling grows to two leaves, one new film true leaf, the spore of piece-root grafting kind Verticillium Dahliae WX-1 bacterial strains is cut
Sub- suspension (107A spore/milliliter).Continue to investigate disease index when culture is fully fallen ill to blank control, calculates prevention effect
Fruit.
As a result (4 are shown in Table):Seed dressing test result shows that bacillus amyloliquefaciens HMB27634 has very cotton verticillium wilt
Good control effect, preventive effect prevent the effect of cotton verticillium wilt with the microbial bactericide of formal registration up to 71.51%
(69.67%) quite.Illustrate that bacillus amyloliquefaciens HMB27634 and its microbial bacterial agent of the present invention have cotton verticillium wilt
Good control effect.
4 bacillus amyloliquefaciens HMB27634 of table is to cotton verticillium wilt efficiency test result
Claims (5)
1. a kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27634, oneself was in 2015 9
The moon is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCC on the 29th
No.11455。
2. utilizing the microbial bacterial agent of bacillus amyloliquefaciens HMB27634 productions described in claim 1, it is characterised in that its
Active constituent is HMB27634 thalline.
3. microbial bacterial agent according to claim 2, it is characterised in that the microbial bacterial agent is liquid preparation.
4. applications of the bacillus amyloliquefaciens HMB27634 described in claim 1 on prevention cotton verticillium wilt.
5. application of the microbial bacterial agent on prevention cotton verticillium wilt described in claim 2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510742977.5A CN105176895B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510742977.5A CN105176895B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105176895A CN105176895A (en) | 2015-12-23 |
CN105176895B true CN105176895B (en) | 2018-08-21 |
Family
ID=54899329
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510742977.5A Active CN105176895B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its application for preventing cotton verticillium wilt |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105176895B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111647518A (en) * | 2019-12-26 | 2020-09-11 | 浙江泰达作物科技有限公司 | Bacillus belgii microbial agent and preparation method thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102586142A (en) * | 2012-02-09 | 2012-07-18 | 河北省农林科学院植物保护研究所 | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof |
WO2012171914A1 (en) * | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
CN104531559A (en) * | 2014-12-08 | 2015-04-22 | 山西省农业科学院生物技术研究中心 | Bacillusamyloliquefaciens subsp Lh-1 and application thereof |
-
2015
- 2015-11-03 CN CN201510742977.5A patent/CN105176895B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012171914A1 (en) * | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
CN102586142A (en) * | 2012-02-09 | 2012-07-18 | 河北省农林科学院植物保护研究所 | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof |
CN104531559A (en) * | 2014-12-08 | 2015-04-22 | 山西省农业科学院生物技术研究中心 | Bacillusamyloliquefaciens subsp Lh-1 and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN105176895A (en) | 2015-12-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111304132B (en) | Microbial agent YF beneficial to growth of saline-alkali soil corns and application thereof | |
CN101993836B (en) | Bacillus subtilis strain YB-81, fungicide and preparation method and application thereof | |
CN102586142B (en) | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof | |
CN105199996B (en) | A kind of bacillus amyloliquefaciens and its application for preventing graw mold of tomato | |
CN105176894B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention graw mold of tomato | |
CN111172080B (en) | Bacillus belgii and application thereof | |
CN111100820B (en) | Bacillus belgii HMB28023 and application thereof | |
CN106399177B (en) | Bacillus amyloliquefaciens and its microbial inoculum with degradation Phos and bacteriostasis | |
CN108192838B (en) | Bacillus amyloliquefaciens with dual functions of inorganic phosphorus degradation and disease prevention | |
CN106399178B (en) | Bacillus amyloliquefaciens and its application with degradation Phos and bacteriostasis | |
CN108034618A (en) | Siam's Bacillus strain and its application | |
CN106939290A (en) | Bacillus subtilis HMB26553 and its application | |
CN106244504B (en) | Bacillus subtilis and its microbial inoculum with degrading organic phosphor and bacteriostasis | |
CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
CN105199997A (en) | Bacillus subtilis for controlling cotton rhizoctonia and application of bacillus subtilis | |
CN109468243A (en) | One plant of Siam bacillus and its application | |
CN105176893B (en) | A kind of bacillus amyloliquefaciens and its application for preventing crop damping-off | |
CN108841744A (en) | A kind of bacillus subtilis with diseases prevention and degradation Phos double action | |
CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
CN102747005B (en) | Bacillus atrophaeus for prevention and control of cotton boll blight, and microbial agent thereof | |
CN112094768B (en) | Bacillus licheniformis ZF480 and application thereof | |
CN108641989A (en) | One plant of Methylotrophic bacillus and its application | |
CN105462882B (en) | A kind of pseudomonas aeruginosa and its application for preventing crop verticillium wilt | |
CN102586143B (en) | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew | |
CN107043721A (en) | Bacillus subtilis HMB28948 and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |