CN115261390A

CN115261390A - Cell line for over-expressing PIGR protein and preparation method and application thereof

Info

Publication number: CN115261390A
Application number: CN202210726320.XA
Authority: CN
Inventors: 王英英; 王庆; 李波; 郑树城; 尹纪元; 李莹莹; 莫绪兵; 石存斌
Original assignee: Pearl River Fisheries Research Institute CAFS
Current assignee: Pearl River Fisheries Research Institute CAFS
Priority date: 2022-06-24
Filing date: 2022-06-24
Publication date: 2022-11-01
Anticipated expiration: 2042-06-24
Also published as: CN115261390B

Abstract

The invention discloses a cell line over-expressing PIGR protein, a preparation method and application thereof, wherein the cell line over-expressing PIGR protein is classically named as Tilapia polyimmunoglobulin over-expressing brain cell line TiBC-PIGR⁺And the gene is preserved in China center for type culture Collection with the preservation number of C2022162. It expresses the PIGR protein in an amount 12.43 times that of normal TiBC cells. The cell is a cell line which is immortalized and over-expresses the PIGR protein, and the high expression of the PIGR protein is still maintained after 10 continuous passages. Moreover, the cell line of the invention can obviously influence virus multiplication when culturing tilapia lake virusThe value titer is significant for the efficient culture of the virus and the production of the inactivated vaccine thereof, and the cell line has good application prospect in the culture of tilapia lake virus.

Description

Cell line for over-expressing PIGR protein and preparation method and application thereof

Technical Field

The invention belongs to the field of biotechnology and cytology, and particularly relates to a cell line for over-expressing PIGR protein, and a preparation method and application thereof.

Background

The poly immunoglobulin receptor (pIgR) is a type I transmembrane glycoprotein belonging to an immunoglobulin superfamily, guides trans-epithelial cell transportation of secretory antibodies IgA and IgM in animal mucosa-related immune tissues, and is secreted to the mucosal surface after enzyme digestion to play a role in inhibiting adhesion and invasion of pathogenic microorganisms. The pIgR molecule of mammals consists of three parts, namely a cytoplasmic region, an extracellular ligand binding region and a transmembrane region, wherein the extracellular ligand binding region comprises 5 Immunoglobulin-like functional domains (ILD 1-ILD 5), and the amino acid sequences of ILD1, ILD4 and ILD5 are highly conserved in mammals. ILD1 is an important domain that binds to polyimmunoglobulin (pIg). In other vertebrates, the number of ILDs varies, e.g. the extracellular region of avian and amphibian plgr molecules contains 4 ILDs, corresponding to mammalian ILDs 1, LD3, ILD4 and ILD5, respectively, whereas the fish plgr molecule only finds two immunoglobulin-like domains corresponding to mammalian ILDs 1 and ILD 5.

In the related art, the immunological function research of pIgR mainly focuses on the aspects of regulating the expression of pIg in mucosal epithelial cells, the binding of ligand to pIgR, the intracellular transport of pIg and the intracellular neutralization of pIgA in pathogens and antigens, the surface cleavage of pIg into SC, and the new function of dissociating SC and SIgA in epithelial surface and external secretion. In fish research, the pIgR is mainly involved in the regulation and control of the bacterial infection process. Researches find that the pIgR expression level of various fishes, such as loaches, crucians, carps, zebra fishes, grass carps, turbots and the like infected with bacteria has obvious difference compared with that of healthy fishes. The pIgR in the rainbow trout and the sea bass plays a role in inhibiting the proliferation of pathogenic bacteria by combining with symbiotic bacteria and pathogenic bacteria thereof, and the pIgR plays an important role in maintaining a microflora and resisting the invasion of the pathogenic bacteria on the surface of a mucous membrane. pIgR as cell surface receptor plays a role in the mucosal immune process and is hijacked by partial virus as cell receptor invading cells, such as white spot syndrome virus, porcine epidemic diarrhea virus, murine norovirus and the like.

In the related art, the reports of the research of PIGR in aquatic animals are very limited, and the research on the role of PIGR in resisting virus invasion in the aquatic animals is clear about PIGR (MjpIgR) of penaeus japonicus and White Spot Syndrome Virus (WSSV). After VP24 of WSSV is combined with the extracellular part of MjpIgR, the intracellular part of MjpIgR works with calmodulin to recruit clathrin and AP-2 complex to promote WSSV to enter cells to complete self-proliferation. These results demonstrate that PIGR has an important regulatory role for viral proliferation.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a cell line for over-expressing PIGR protein and a preparation method and application thereof, and the cell line for the immortalized over-expressing PIGR protein is obtained by constructing PIGR over-expression plasmid and transfecting the PIGR over-expression plasmid into tilapia brain cells (TiBC)⁺. The cell strain is easy to culture, high in proliferation speed, unlimited in expansion, stable in property, easy to store, mature in method technology, strong in repeatability, capable of being completed by general researchers, and stable in heredity.

In a first aspect of the invention, there is provided SEQ ID NO:4 or SEQ ID NO:3 in the preparation of PIGR overexpression vector.

In the invention, the inventor constructs a PIGR overexpression vector based on the complete ORF (SEQ ID NO: 4) of the PIGR gene, and finds that the vector can stably transfect tilapia brain cells (TiBC), thereby obtaining a cell line for overexpressing PIGR protein.

SEQ ID NO:4 is as follows: <xnotran> 5'-ATGAGAGAGTTCTGCACCAGCTTGGCTCG AACTGACGAGACCTCCTCGACCAATCCAAGTAAAGACAAAGTGAGCATTTTTGATGACC CGGCCCAGGAGATGTTCACAGTGACCATGAACAACCTGAAAGAGACGCAGTCTGGGTG GTACTTGTGTGGTGTGGAATTAGGTAACGGGTGGAAGGCCGATGATGTTGCTTACACTA AAGTGAAAGTCATTCACGGTGTGTCAGTCGTGAACAGCATGGTGAGTGGGGAAGAAGG AAGTAGTGTCACGGTTCAGTGCCTTTACAGTGAAAGATTCAGAGAAAGTGAGAAGAAG TGGTGTCGGAGCGGAGGCTGGAGCTCCTGTCTGTCGACGGGTTCTGAAGGGAGTTACG AAGATACTTCAGTGGCCATCAGCGATGACAGAACTGGGACTTTCACTGTAACCTTAAAG AAGCTGCAGATGAGAGATGCTGGCTGGTATTTATGTTCTGCAGGGCAGCAGCAAGTAGC CGTACAGGTTCAGGTCAGACCACGCGCCTCTACTACGACAGAGCCTGTGACATCCCCAC CTACTCCGAGTCAGTCTGCTGTGTACCTCCCTCCACCCAAACCCATCACTAAGGAGTCCT GGAACAGTCACCGTTACATGTTGGAGTCTATAGCGGTGTGTTCGTCTCTCCTGCTCCTTG TGGGCTTGGCTGTATTGGCAAGAAAGTTGTGGATACTGCACAAGGAGGATTCTGAACTT AGACACTTTAAGGAGATGAAAGAGAGATTCCCTGATAATCCATCGGGCATGAGTGACCT GCAATATGTTCCTATTGCTTTCCATAACAAAGCTACCATGGACGTACGTGCTTACCAGGTA CCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAG-3' (SEQ I D NO: 4). </xnotran>

In a second aspect of the invention, there is provided a PIGR overexpression vector, comprising the nucleotide sequence of SEQ ID NO: 4.

In some embodiments of the invention, the nucleotide sequence of the vector is as set forth in SEQ ID NO:3, respectively.

In the invention, the inventors sequence the PIGR overexpression vector obtained by construction, and find that the sequence is shown in SEQ ID NO:3, respectively.

In a third aspect of the present invention, there is provided a method for preparing a PIGR overexpression vector according to the second aspect of the present invention, comprising the steps of:

and (3) carrying out PCR amplification on the cDNA sequence of the PIGR protein to obtain a target fragment, and inserting the target fragment into a eukaryotic expression plasmid to obtain the PIGR protein.

In some embodiments of the invention, the nucleotide sequence of the primers used for the PCR amplification are as follows:

an upstream primer PIGR-F of 5;

the downstream primer PIGR-R is 5.

In some embodiments of the invention, the primer is designed according to the tilapia pIgR nucleotide sequence in NCBI GenBank (MK 061423.1) database.

In some embodiments of the invention, the cDNA sequence is based on total RNA reverse transcription from TiBC cells.

In some embodiments of the invention, the PIGR overexpression vector is prepared by a method comprising: and carrying out PCR amplification on a cDNA sequence of the PIGR protein to obtain a target fragment, carrying out enzyme digestion on the target fragment and an empty vector by using restriction enzymes EcoRI and KpnI, connecting the enzyme digested target fragment and the empty vector, and screening by using a kanamycin-resistant plate to obtain the PIGR over-expression vector.

In some embodiments of the invention, the empty vector is a pEGFP-N1 vector.

In a fourth aspect of the invention, there is provided the use of a PIGR overexpression vector according to the second aspect of the invention in the manufacture of a product overexpressing a PIGR protein.

In the present invention, the inventors found that based on the aforementioned PIGR overexpression vector, PIGR can be stably expressed after transfection into cells, and the expression amount is significantly higher than that of cells transfected with an empty vector.

In a fifth aspect of the present invention, an immortalized PIGR overexpression cell line is provided, wherein the cell line is preserved in China Center for Type Culture Collection (CCTCC) at 6 months and 3 days 2022, and the preservation addresses are as follows: the taxonomic name of the university of Wuhan, wuhan and China is Tilapia polyimmunoglobulin overexpression brain cell line TiBC-PIGR⁺The preservation number is CCTCC NO: C2022162.

In the specific operation of preparing the PIGR protein cell line, the cell uptake, integration and expression of exogenous genes are all small-probability events, and the small-probability events can be improved only under specific operation conditions; in addition, the probability of integrating the foreign gene into the genome is small, and the foreign gene is randomly integrated into the genome, so that the amount of the target protein expressed by different transfected cells is greatly different, and as the culture time continues, the cells losing the foreign gene and expressing the target gene rarely are dominant, and the cells strongly expressing the target protein are fewer. In the invention, the technical defects in the traditional method are effectively optimized by the inventor through a special construction method, the incidence rate of a gene recombination cell line is obviously improved, and a plurality of cells with high expression PIGR protein can be obtained; through screening and verification, the expression quantity of the cell line with the ultrahigh expression PIGR protein is 12.43 times that of an unloaded cell, the cell line still has the ultrahigh efficient capability of over-expressing the PIGR protein through multi-generation subculture, the stability is good, and the cell line is a permanently over-expressing PIGR protein aquatic animal cell line.

In a sixth aspect of the present invention, there is provided a method for preparing an immortalized PIGR overexpressing cell line according to the fifth aspect of the present invention, comprising the steps of:

transfecting the PIGR overexpression vector of the second aspect of the invention into tilapia brain cells, performing screening culture by using a culture solution containing antibiotics, and obtaining a positive clone which is an immortalized PIGR overexpression cell strain through screening.

In some embodiments of the invention, the antibiotic comprises G418.

In some embodiments of the present invention, the preparation method specifically comprises:

after tilapia brain cells with confluency of 75% are washed by HBSS, gibco serum reducing medium and PIGR overexpression vector of the second aspect of the invention are added, after even mixing, the mixture is cultured for 5-7 h, and M199 culture medium containing serum is replaced, so that transfected TiBC cells are obtained. And (3) screening by using an M199 culture medium containing G418l until cell cloning occurs, thus obtaining the cell clone.

In a seventh aspect of the present invention, there is provided a use of the immortalized PIGR overexpressing cell line according to the fifth aspect of the present invention in any one or more of the following (1) to (4);

(1) Preparing a tilapia lake virus vector or a cell model;

(2) Screening and/or evaluating tilapia lake virus treatment drugs;

(3) Preparing a tilapia lake virus diagnosis product;

(4) And (5) developing tilapia lake virus products.

The inventor finds that the TiLV can cause the PIGR protein to be up-regulated when infecting TiBC cells, and the PIGR protein up-regulated expression quantity induced by infecting TiLV strains with good cell adaptability is higher, which indicates that the PIGR plays an important role when infecting TiLV. The tilapia pIgR over-expression also promotes the proliferation of TiLV, so that the cell line over-expressing the PIGR protein has a good application prospect in the culture of tilapia lake viruses, and the TiBC cell line over-expressing the PIGR protein in the invention is used for culturing the tilapia lake viruses to obviously influence the virus proliferation titer, which has great significance for the efficient culture of the tilapia lake viruses and the production of inactivated vaccines thereof.

The invention has the beneficial effects that:

(1) The cell line constructed by the invention can permanently express PIGR protein in high quantity, is easy to culture, has high proliferation speed, unlimited expansion, stable property, easy storage, mature method technology and strong repeatability, can be completed by general researchers, and has genetic stability.

(2) The cell line over expressing the PIGR protein and the preparation method thereof have far-reaching research and wide application, and comprise the research on the stability of host cell immune response and the immortalization of aquatic animal cells capable of expressing the required protein, and the influence of the cells and the PIGR protein on the proliferation of tilapia lake viruses.

Drawings

FIG. 1 is a 1% agarose gel electrophoresis of PCR amplification products of the present invention, wherein lane M is DLMaker 5000, and

lanes

1 and 2 are pIgR amplification products.

Fig. 2 is a result of identifying a recombinant plasmid according to an embodiment of the present invention, where a is a result of identifying a recombinant plasmid positive clone PCR, M: DNA molecular weight Standard marker,1-2: pEGFP-pIgR positive clone; b is the result of enzyme digestion verification of the recombinant plasmid, M: DNA molecular weight standard marker,1: recombinant vector pEGFP-pIgR,2: pEGFP-N1 empty vector; c is a WB detection result, M: protein molecular weight standard marker,1: transfection of pEGFP-pIgR cells, 2: transfection of pEGFP-N1-unloaded cells, 3: tiBC untransfected cells.

FIG. 3 is a fluorescent image of TiBC cells after transfection in the example of the present invention, wherein A is cells transfected with pEGFP-N1 empty and B is cells transfected with pEGFP-pIgR.

FIG. 4 is an image of an over-expressed cell line obtained by G418 selection in an example of the present invention, wherein A is the clear field of G418 selection pEGFP-N1 no-load transfected cells; b is a fluorescence map of the G418 screened pEGFP-N1 no-load transfected cells; c, screening a pEGFP-pIgR transfected cell bright field for G418; d is a fluorescence map of the pEGFP-pIgR transfected cells screened by G418.

FIG. 5 is a fluorescence diagram of TiBC-PIGR + after serial passage in the example of the present invention, wherein A is a fluorescence diagram after 1 passage; b is a fluorescence map for passage 3; c is a fluorescence map for passage 5; d is the fluorescence pattern at passage 10.

FIG. 6 shows the effect of pIgR overexpression on TiLV proliferation, wherein A is a TiLV S8 gene expression level comparison graph; b is a TiLV S10 gene expression level comparison graph; c is TiLV copy number contrast plot.

FIG. 7 is a comparison of the protein level changes at 48h of infection with TiLV in pIgR-overexpressing cells and unloaded cells.

FIG. 8 is a comparison of IFA results of over-expressing pIgR cells and unloaded cells 48h after infection with TiLV.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are given by way of illustration only.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Construction and sequencing of recombinant pMD18T-OnpigR cloning vector

(1) Design and synthesis of oligonucleotide primers:

the tilapia pIgR specific primer is designed according to a tilapia pIgR nucleotide sequence in an NCBI GenBank (MK 061423.1) database, and the specific nucleotide sequence of the primer is as follows:

an upstream primer PIGR-F: 5;

the downstream primer PIGR-R: 5-.

The above primers were used as PCR amplification primers for obtaining the desired fragment.

(2) Extraction of total RNA of TiBC cells:

inoculating 100-generation immortalized TiBC cells (Tilapia brain cells) into a basal area of 25cm²After culturing in a cell culture flask for 24 hours, 1mL of Trizol was added and the mixture was left at room temperature for 5min to allow sufficient lysis. 12 Centrifuging at 000r/min for 5min, and collecting supernatant. Chloroform was added in an amount of 200. Mu.L of chloroform/mL of Trizol, followed by shaking and mixing, and standing at room temperature for 15min. Centrifuging at 4 deg.C for 15min at 12 000r/min. And (4) sucking the supernatant into another centrifuge tube, adding isopropanol according to the amount of 0.5mL of isopropanol/mL of Trizol, uniformly mixing, and standing at room temperature for 5-10 min. Centrifuging at 4 deg.C for 10min at 12 000r/min, discarding supernatant, and precipitating RNA at the bottom of the tube.

Add 75% ethanol to tubes in an amount of 1mL 75% ethanol/mL Trizol, gently shake the tubes, and centrifuge at 4 ℃ at 12 000r/min for 10min. The supernatant was discarded and dried at room temperature. Adding 20 μ L RNase-free water to dissolve, and storing at-80 deg.C for use.

(3) PIGR gene fragment full-length cDNA Synthesis:

mu.L of the total RNA obtained in step (2) was taken, heated at 70 ℃ for 10min, and ice-cooled for 5min. Other reagents were added in the reaction system shown in Table 1. Wherein, the upstream primer F and the downstream primer R are respectively an upstream primer PIGR-F and a downstream primer PIGR-R.

TABLE 1 reverse transcription System

Components	Content (wt.)
		200U reverse transcriptase M-MLV	1μL
25 pmol/. Mu.L of upstream primer F	1μL
		25 pmol/. Mu.L of the downstream primer R	1μL
10mmol/L dNTPs	1μL
		Total RNA obtained in step (2)	5μL
ddH₂O	1μL

The reaction was carried out at 42 ℃ for 60min to obtain cDNA (reverse transcription product). Water bath at 70 deg.c for 10min to deactivate reverse transcriptase.

A PCR amplification system was constructed as shown in Table 2 using 10. Mu.L of the prepared cDNA. Among them, the following PCR buffer was purchased from Nanjing Novozam science and technology Co.

TABLE 2 PCR amplification System

Components	Content (wt.)
		10×PCR buffer	4μL
25mmol/L MgCL₂	4μL
		25 pmol/. Mu.L upstream primer PIGR-F	0.5μL
25 pmol/. Mu.L downstream primer PIGR-R	0.5μL
		10mmol/L dNTPs	0.5μL
cDNA template	10μL
		ddH₂O	30μL

Boiling for denaturation for 10min, and ice-cooling for 5min. Then, 0.25. Mu.L of Taqplus DNA polymerase (5U/. Mu.L) was added thereto and mixed well. The following reaction sequence was then carried out: denaturation at 94 ℃ 30sec, annealing at 57 ℃ for 40sec, extension at 72 ℃ for 90sec,25 cycles; and further extended for 10min at 72 ℃. The PCR product was verified by nucleic acid electrophoresis on a 1% agarose gel.

The results are shown in FIG. 1.

Electrophoresis on a 1% agarose gel showed a band of interest of about 1023bp corresponding to the expected size. Further purifying the amplified fragment, sending the purified fragment to a biological company for sequencing, and finding that the similarity of the sequencing result and the pIgR sequence of tilapia in an NCBI database is 100% through BLAST search comparison, so that the amplified fragment can be determined to be the pIgR ORF (OnpigR) sequence of tilapia.

(4) Constructing a eukaryotic expression vector pEGFP-pIgR:

the OnpigR gene obtained by the amplification in (3) and the pEGFP-N1 vector were digested with restriction enzymes EcoRI and KpnI, and the digestion system is shown in Table 3. The enzyme digestion Buffer described below was purchased from Nanjing Novozam science and technology, inc. The reaction conditions are as follows: react for 1h at 37 ℃. Obtaining the enzyme-cut pEGFP-N1 vector and the enzyme-cut pIgR gene fragment.

TABLE 3 enzyme digestion System

Components	Content (c) of
		10 Xenzyme digestion Buffer	5μL
EcoRⅠ/KpnⅠ	5μL
		vector/Gene fragment	2μg
Enzyme-free water	Make up to 50 μ L

Then based on the operation instruction of a commercial kit, T4 ligase of Thermo Fisher is used for connecting the enzyme digestion products, and the specific reaction system is as follows:

TABLE 4 connection System

The reaction conditions are as follows: the reaction was carried out at 22 ℃ for 10min. To obtain a ligation product.

The ligation products were transformed into e.coli DH5 α cells. The specific operation steps are as follows: the DH5 alpha competent cells were removed from the-80 ℃ cryorefrigerator, placed in ice until they were thawed, the ligation product was added, mixed well and left on ice for 25 minutes. Water bath at 42 ℃ for 60 seconds, quickly putting back on ice and standing for 2 minutes, and avoiding shaking to reduce the conversion efficiency. 700mL of LB broth without antibody was added and put in a shaker at 37 ℃ for 1h recovery at 200 rpm. Centrifuging at 4000-5000rpm for 1min. The supernatant was aspirated, and about 100 mL of the medium was left, applied to kanamycin-resistant plates after pipetting, and incubated at 37 ℃ overnight. And picking the monoclonal colony for PCR amplification of bacteria liquid.

The reaction system is shown in Table 5.

TABLE 5 bacterial liquid PCR System

Components	Content (wt.)
		PIGR-F	2μL
PIGR-R	2μL
		Premix Taq^TM	2μL
Monoclonal bacterium solution	2μL
		Enzyme-free water	12μL

Reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and 30 cycles; final extension at 72 ℃ for 10min. Storing at 4 deg.C for use.

The PCR result of the bacterial liquid shows that the size of the amplified fragment is about 1023bp, which is consistent with the expected result, and the amplified product is sent to a biological company for sequencing to confirm that the amplified product contains the correct pIgR gene. After the plasmid is extracted from the bacterium liquid which is confirmed to be correct, double enzyme digestion verification is carried out, 1% agarose gel electrophoresis is used for displaying that specific target bands appear near 5000bp and 1000bp, and a Western Blot result shows that a fusion protein band (shown in figure 2) which is consistent with the expected size appears at the position of 55 kDa-70 kDa of the transfected pEGFP-pIgR, so that the recombinant eukaryotic expression plasmid pEGFP-pIgR can correctly express the target protein in cells. The result shows that the recombinant plasmid containing pIgR gene is successfully constructed.

The sequence of the pEGFP-pIgR recombinant plasmid is obtained by sequencing (the underlined position is the complete ORF of the PIGR gene):

5’-TAGTGTCCTGGAGGGTGGATCCATCACTGTCCCGTGTCGATATGACCCTAAGTAT GCTAACCATGTCAAATACTGGTGTAGTGGGAGCATGAGAGAGTTCTGCACCAGCTTGGCTCGAACTGACGAGACCTCCTCGACCA ATCCAAGTAAAGACAAAGTGAGCATTTTTGATGACCCGGCCCAGGAGATGTTCACAGTGACCATGAACAACCTGAA AGAGACGCAGTCTGGGTGGTACTTGTGTGGTGTGGAATTAGGTAACGGGTGGAAGGCCGATGATGTTGCTTACACT AAAGTGAAAGTCATTCACGGTGTGTCAGTCGTGAACAGCATGGTGAGTGGGGAAGAAGGAAGTAGTGTCACGGTTC AGTGCCTTTACAGTGAAAGATTCAGAGAAAGTGAGAAGAAGTGGTGTCGGAGCGGAGGCTGGAGCTCCTGTCTGTC GACGGGTTCTGAAGGGAGTTACGAAGATACTTCAGTGGCCATCAGCGATGACAGAACTGGGACTTTCACTGTAACC TTAAAGAAGCTGCAGATGAGAGATGCTGGCTGGTATTTATGTTCTGCAGGGCAGCAGCAAGTAGCCGTACAGGTTC AGGTCAGACCACGCGCCTCTACTACGACAGAGCCTGTGACATCCCCACCTACTCCGAGTCAGTCTGCTGTGTACCT CCCTCCACCCAAACCCATCACTAAGGAGTCCTGGAACAGTCACCGTTACATGTTGGAGTCTATAGCGGTGTGTTCG TCTCTCCTGCTCCTTGTGGGCTTGGCTGTATTGGCAAGAAAGTTGTGGATACTGCACAAGGAGGATTCTGAACTTA GACACTTTAAGGAGATGAAAGAGAGATTCCCTGATAATCCATCGGGCATGAGTGACCTGCAATATGTTCCTATTGC TTTCCATAACAAAGCTACCATGGACGTACGTGCTTACCAGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATG GTGAGCAAGGGCGAGGAG-3’ (SEQ ID NO：3)。

establishment of cell lines overexpressing PIGR protein

(1) Extraction of the recombinant plasmid pEGFP-pIgR:

taking the positive bacterial liquid obtained in the above embodiment, extracting the recombinant plasmid pEGFP-pIgR by using an endotoxin-free plasmid extraction kit (Omega company), and specifically comprising the following steps:

and (3) mixing the positive bacterium liquid according to the proportion of 1:100 portions of the culture broth were added to LB medium prepared for kanamycin resistance and cultured at 37 ℃ at 200 rmp/min for 12 hours. Centrifuging at 4000 Xg for 10min at room temperature, and collecting thalli. The medium was discarded leaving a pellet of bacteria, 10mL of Solution I (from the plasmid extraction kit described above) was added, and vortexed to thoroughly suspend the pellet of bacteria. 10mL of Solution II was added, the centrifuge tube was closed, the mixture was gently inverted and mixed, and then allowed to stand at room temperature for 2 to 3 minutes (not more than 5 minutes) to obtain a clear cell lysate. 5mL of N3 buffer pre-cooled on ice are added to the cell lysate, mixed until a white flocculent precipitate forms, and incubated for 2 minutes at room temperature (to ensure complete neutralization of the solution). Filtration was performed using a syringe filter. To the filtrate was added 0.1 volume of ETR Solution and incubated on ice for 10 minutes. After a water bath for 5 minutes, the mixture was centrifuged at 4000 Xg for 5min at room temperature. Transferring the supernatant into a new centrifuge tube, adding one-half volume of absolute ethyl alcohol, mixing uniformly, and incubating at room temperature for 2 minutes. Transferred to a binding column and centrifuged at 4000 Xg for 3min. The filtrate was discarded until all the mixture was bound to the column. 10mL of HBC buffer (diluted with isopropanol as required for use in the specification) was added to the binding column and centrifuged at 4000 Xg for 3min. Discard the filtrate, add 15mL of DNA wash buffer to the binding column and centrifuge at 4000 Xg for 3min. The filtrate was discarded and the washing was repeated 1 time using a DNA wash buffer. The filtrate was centrifuged off. 6000 Xg, centrifuging for 10min in a combined column space, and drying the combined column basement membrane in a drying way. The bound column was transferred to a new 50mL centrifuge tube. 1mL of Endo-Free Elution buffer was added to the center of the basement membrane bound to the column, and the mixture was allowed to stand at room temperature for 5 minutes. The plasmid was eluted by centrifugation at 4000 Xg for 5min.

(2) Transfecting an immortalized TiBC cell by using a pEGFP-pIgR eukaryotic expression vector:

a. preparation of transfected cells: at 27 ℃ C, 5% CO ₂100 generations of immortalized TiBC cells were cultured in six-well cell culture plates for 12-18h under conditions and transfection was initiated when the confluency of cells was 75%.

b. Preparation of liposome/DNA complexes: the six-well plate was divided into two groups on average, and the recombinant eukaryotic expression vector pEGFP-pIgR obtained in the above example was transfected into 2g per well in one group (pEGFP-N1 was purified by phenol/chloroform extraction and repeated UV spectrophotometry, OD260/OD280 was 1.8-2.0, and was sterilized by filtration before use) according to the Lipofectamine2000 instructions. The plasmid and the transfection reagent are mixed well by slight shaking, and the mixture is placed at room temperature for 25min to obtain the liposome/DNA complex, wherein the transfection is not affected if the solution is turbid. However, if precipitation occurs, transfection is stopped and preparation is resumed.

c. Cells with 75% confluency in step a were washed 3 times with HBSS, then 1.5mL of Gibco antiserum medium was added per well. Then adding the DNA/liposome mixture obtained in step b, shaking gently, at 27 deg.C, 5%₂After 6h of saturation humidity culture, the cells were replaced with M199 medium containing 5% (v/v) serum to obtain transfected TiBC cells.

(2) Screening of G418 resistant cells:

the transfected TiBC cells were treated at 27 ℃,5%₂The culture was carried out for 36 hours. The fluorescence was observed under a fluorescence microscope (as shown in FIG. 3). When strong fluorescence was observed, M199 medium containing G418l at a concentration of 1000G/mL was added to continue the culture, and the solution was changed every three days until cell cloning occurred.

(3) Obtaining an immortalized cell line overexpressing the PIGR protein:

each holeAdding an M199 culture medium containing 5% serum, observing the hole where the cell clone grows under light to show that the single cell clone is obviously opaque, marking the position of the clone by using a marker pen, and picking the cell clone on a super clean bench by using a sterile gun head. The cells were transferred into a 96-well plate, subjected to limiting dilution, and transferred into a 24-well plate, a 6-well plate, a 30-mL cell culture flask, and a 50-mL cell culture flask in this order, and gradually expanded for culture, wherein the concentration of G418 was maintained and the amount of serum added was 5% (v/v). The cell line of the immortalized over-expression PIGR protein is obtained after G418 screening, and is named as TiBC-PIGR⁺(FIG. 4).

The constructed immortalized cell which over-expresses the PIGR protein is preserved in China center for type culture Collection CCTCC (China center for type culture Collection) with the preservation number of C2022162 at 6 months and 3 days in 2022.

(4) Immortalization verification:

after the TiBC-PIGR + obtained in the steps is continuously passaged for 10 generations, stronger green fluorescence can still be seen (figure 5), which indicates that the construction of the immortalized over-expression cell line is successful.

Cell line over-expressing PIGR protein promoting TiLV proliferation

100 generations of immortalized TiBC cells were seeded to a bottom area of 25cm 24h before transfection²The 6 cell culture flasks were divided into 2 groups on average. One group was transfected with 50mg of pEGFP-N1 empty plasmid, and the other group was transfected with 50mg of the above-mentioned pEGFP-pIgR overexpression recombinant plasmid, each group being arranged in triplicate. The culture medium is discarded after 36h of transfection, washed twice with HBSS, and 10 portions are added⁵1mL each of tipies/uL of TiLV virus was incubated for 1.5h at 28 ℃ in an incubator. Centrifuging to remove the virus solution, supplementing 5mL of M199 medium containing 5% FBS, and culturing in 28 deg.C incubator for 48h and 72h. And (6) collecting samples. RNA was extracted and cDNA was prepared by the method described in the above examples. And carrying out quantitative detection on the TiLV-S1 gene, the TiLV-S8 gene and the TiLV-S10 gene respectively. Wherein, the detection is carried out by using a fluorescence quantitative kit of Esciurel bioengineering GmbH.

The results are shown in FIG. 6.

TiLV induction in cells transfected with recombinant plasmid overexpressing pIgR, compared to cells transfected with empty vector as control groupmRNA levels of S8 and S10 fragments at 48h and 72h after staining were significantly up-regulated, and copy numbers were also significantly increased. After 72h of overexpression, the proliferation amount of TiLV in the pIgR overexpression cell line is 8.08 multiplied by 10⁷copies/uL, proliferation of TiLV in transfected empty plasmid cell line 6.5X 10⁶copies/uL, the amount of virus propagated in the over-expressing cell line was 12.43 times that of the unloaded cell line.

Meanwhile, a part of the cells are collected and subjected to WB (Western Blot) and IFA (Indirect immunofluorescence) detection, and the influence of the over-expression of pIgR on the TiLV proliferation is studied on the protein level.

The operation steps of WB detection are as follows:

10% of the lower separation gel and the upper concentrated gel were prepared according to the instructions, the prepared protein gel was placed in an electrophoresis tank, SDS-PAGE electrophoresis was added, the comb was removed, 5. Mu.L of Thermo26616 pre-stained protein MARKER was aspirated, and then 20. Mu.L of the protein sample was added to the well. And (4) carrying out electrophoresis at a constant voltage of 80V for 20min, converting the voltage into 120V after the protein bands are in the same horizontal line in the concentrated gel, continuing electrophoresis until the bromophenol blue indicates that the bands reach the bottom of the separation gel, ending the electrophoresis, and carrying out membrane conversion. After SDS-PAGE electrophoresis separation, the protein sample is transferred to a nitrocellulose membrane (NC membrane) by a membrane transfer instrument. And taking out the NC film and making a corresponding mark. NC membranes were blocked with 5% skim milk for 1h at room temperature, and then GFP-tagged rabbit antibodies were raised to a concentration of 1: after dilution at the ratio of 4000, the mixture was incubated for 2 hours at room temperature as a primary antibody. Washed 3 times with PBST for 10min each time, and incubated for 2h at room temperature with the addition of secondary antibody (1: 4000 dilution). PBST was washed 3 times, 10 min/time. Then, the reaction mixture was developed using a hypersensitive ECL chemiluminescence kit (New Seimei Biotechnology Co., ltd.), and the procedure was referred to an instruction manual. Images were acquired at the ChemiDOCTMXRS + imager.

The Western Blot results are shown in FIG. 7.

Compared with a control group, the PIGR protein in the over-expressed cell line has a more obvious over-expression phenomenon, which indicates that the method can successfully construct the cell line with immortalized over-expressed PIGR protein.

The IFA detection operation steps are as follows:

fixing the cells with pre-cooled formaldehyde at-20 deg.C for 10min, and air drying for 15min. PBS was washed twice and blocked with 5% horse serum for 1h at room temperature. PBS was washed twice. The following compositions were used according to 1: the monoclonal antibody of anti-TiLV-S8 fragment diluted at a ratio of 500 was used as a primary antibody and incubated at room temperature for 1h. Incubated primary antibody was discarded, washed 3 times with PBST for 10min each, using the following protocol 1: alexa Fluor 488-labeled goat anti-mouse antibody diluted at a ratio of 2000 was used as a secondary antibody and incubated at room temperature for 2h. PBST was washed 3 times, each time for 10min, and stained with DAPI staining solution for 10min. And (5) observing and photographing records by laser confocal.

The results are shown in FIG. 8.

It can be seen that in the pIgR over-expression group, the red positive signal of TiLV at 48h is significantly more than that of the control group.

In conclusion, the test results show that pIgR overexpression can promote TiLV proliferation. In the conventional art, the probability of obtaining a cell line that ultra-highly expresses the PIGR protein is very low because only a part of the foreign gene can enter the nucleus through the cytoplasm after entering the cell, and up to 80% of the foreign DNA entering the nucleus is transiently expressed depending on the cell type. In addition, in very few cases, the foreign DNA introduced into the cell is finally integrated into the chromosome of the cell by a series of non-homologous intermolecular recombination nuclear junctions, and the genome of the cell is expressed in a free portion, so that integration does not necessarily mean expression, only the gene integrated into the expression region is expressed, and the amount of expression of the foreign gene integrated into different chromosome segments is also different. In addition, as the culture time is prolonged, cells losing the foreign gene and expressing the target gene rarely are dominant, and cells strongly expressing the target protein are fewer. In general, the cell line for obtaining the high expression PIGR protein is a small probability event because the uptake, integration and expression of the exogenous gene are small probability events, and the method in the embodiment of the invention can stably obtain the pIgR over-expression cell line, thereby realizing the breakthrough of the technology.

Application of cell line for over-expressing PIGR protein

Although the role of PIGR in the viral infection of aquatic animals has been less studied, it is clear that PIGR (MjpIgR) and White Spot Syndrome Virus (WSSV) are used in penaeus japonicus. WSSV can enter cells through a clathrin-mediated endocytosis mode after being combined with MjpIgR to complete self proliferation. However, these results have also demonstrated that PIGR has an important regulatory role in viral proliferation.

In previous researches of the inventor, the TiLV infected immortalized TiBC cells in the invention are found to cause PIGR protein up-regulation expression, and PIGR protein up-regulation expression induced by TiLV strains with good cell adaptability is higher, which indicates that PIGR plays a key regulation role in TiLV infection. Tilapia pIgR also promotes the proliferation of TiLV after overexpression, so that a cell line over expressing PIGR protein has a good application prospect in the culture of Tilapia lake viruses, and the TiBC cell line over expressing PIGR protein constructed in the embodiment of the invention can be used for culturing Tilapia lake viruses to obviously influence the virus proliferation titer, thereby having great significance for the efficient culture of Tilapia lake viruses and the production of inactivated vaccines thereof.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Zhujiang aquatic product institute of China aquatic product science institute

<120> cell line for over-expressing PIGR protein, preparation method and application thereof

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 29

<212> DNA

<213> Artificial sequence

<400> 1

ccgctcgaga tgccgcgact ctctatact 29

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence

<400> 2

cggggtaccg taagcacgta cgtcca 26

<210> 3

<211> 994

<212> DNA

<213> Artificial sequence

<400> 3

tagtgtcctg gagggtggat ccatcactgt cccgtgtcga tatgacccta agtatgctaa 60

ccatgtcaaa tactggtgta gtgggagcat gagagagttc tgcaccagct tggctcgaac 120

tgacgagacc tcctcgacca atccaagtaa agacaaagtg agcatttttg atgacccggc 180

ccaggagatg ttcacagtga ccatgaacaa cctgaaagag acgcagtctg ggtggtactt 240

gtgtggtgtg gaattaggta acgggtggaa ggccgatgat gttgcttaca ctaaagtgaa 300

agtcattcac ggtgtgtcag tcgtgaacag catggtgagt ggggaagaag gaagtagtgt 360

cacggttcag tgcctttaca gtgaaagatt cagagaaagt gagaagaagt ggtgtcggag 420

cggaggctgg agctcctgtc tgtcgacggg ttctgaaggg agttacgaag atacttcagt 480

ggccatcagc gatgacagaa ctgggacttt cactgtaacc ttaaagaagc tgcagatgag 540

agatgctggc tggtatttat gttctgcagg gcagcagcaa gtagccgtac aggttcaggt 600

cagaccacgc gcctctacta cgacagagcc tgtgacatcc ccacctactc cgagtcagtc 660

tgctgtgtac ctccctccac ccaaacccat cactaaggag tcctggaaca gtcaccgtta 720

catgttggag tctatagcgg tgtgttcgtc tctcctgctc cttgtgggct tggctgtatt 780

ggcaagaaag ttgtggatac tgcacaagga ggattctgaa cttagacact ttaaggagat 840

gaaagagaga ttccctgata atccatcggg catgagtgac ctgcaatatg ttcctattgc 900

tttccataac aaagctacca tggacgtacg tgcttaccag gtaccgcggg cccgggatcc 960

accggtcgcc accatggtga gcaagggcga ggag 994

<210> 4

<211> 906

<212> DNA

<213> PIGR

<400> 4

atgagagagt tctgcaccag cttggctcga actgacgaga cctcctcgac caatccaagt 60

aaagacaaag tgagcatttt tgatgacccg gcccaggaga tgttcacagt gaccatgaac 120

aacctgaaag agacgcagtc tgggtggtac ttgtgtggtg tggaattagg taacgggtgg 180

aaggccgatg atgttgctta cactaaagtg aaagtcattc acggtgtgtc agtcgtgaac 240

agcatggtga gtggggaaga aggaagtagt gtcacggttc agtgccttta cagtgaaaga 300

ttcagagaaa gtgagaagaa gtggtgtcgg agcggaggct ggagctcctg tctgtcgacg 360

ggttctgaag ggagttacga agatacttca gtggccatca gcgatgacag aactgggact 420

ttcactgtaa ccttaaagaa gctgcagatg agagatgctg gctggtattt atgttctgca 480

gggcagcagc aagtagccgt acaggttcag gtcagaccac gcgcctctac tacgacagag 540

cctgtgacat ccccacctac tccgagtcag tctgctgtgt acctccctcc acccaaaccc 600

atcactaagg agtcctggaa cagtcaccgt tacatgttgg agtctatagc ggtgtgttcg 660

tctctcctgc tccttgtggg cttggctgta ttggcaagaa agttgtggat actgcacaag 720

gaggattctg aacttagaca ctttaaggag atgaaagaga gattccctga taatccatcg 780

ggcatgagtg acctgcaata tgttcctatt gctttccata acaaagctac catggacgta 840

cgtgcttacc aggtaccgcg ggcccgggat ccaccggtcg ccaccatggt gagcaagggc 900

gaggag 906

Claims

1.SEQ ID NO:4 or SEQ ID NO:3 in the preparation of PIGR overexpression vectors.

2. A PIGR overexpression vector comprising the nucleotide sequence of SEQ ID NO: 4.

3. The overexpression vector according to claim 2, wherein the nucleotide sequence of the vector is as shown in SEQ ID NO:3, respectively.

4. A process for the preparation of a PIGR overexpression vector according to any of claims 2 to 3, comprising the steps of:

5. The method according to claim 4, wherein the nucleotide sequence of the primer used for PCR amplification is as follows:

5 'and 5' of upstream primer PIGR-F-;

the downstream primer PIGR-R is 5.

6. Use of a PIGR overexpression vector according to any of claims 2 to 3, for the manufacture of a product overexpressing a PIGR protein.

7. An immortalized PIGR over-expressed cell line, which is preserved in China center for type culture Collection 6.3.2022, and tilapia poly-immunoglobulin over-expressed brain cell line TiBC-PIGR⁺Accession number is C2022162.

8. A method of producing an immortalised PIGR overexpressing cell line according to claim 7, comprising the steps of:

transfecting the PIGR overexpression vector of any one of claims 2-3 into tilapia brain cells, performing screening culture by using a culture solution containing antibiotics, and obtaining a positive clone which is an immortalized PIGR overexpression cell strain through screening.

9. The method of claim 8, wherein the antibiotic comprises G418.

10. Use of the immortalized PIGR overexpressing cell line according to claim 7 in any one or more of the following (1) to (4);

(1) Preparing a tilapia lake virus vector or a cell model;

(2) Screening and/or evaluating tilapia lake virus treatment drugs;

(3) Preparing a tilapia lake virus diagnosis product;

(4) And (5) developing tilapia lake virus products.