CN115261390B - Cell line for over-expressing PIGR protein and preparation method and application thereof - Google Patents

Abstract

The invention discloses a cell line for over-expressing PIGR protein, a preparation method and application thereof, wherein the cell line for over-expressing PIGR protein is named as TiBC-PIGR+ of tilapia multimeric immunoglobulin, and is preserved in China center for type culture collection, and the preservation number is C2022162. The cell is an immortalized cell line for over-expressing the PIGR protein, and maintains the high expression of the PIGR protein after 10 continuous passages. In addition, the cell line culture tilapia lake virus can obviously influence the virus increment titer, has great significance for the efficient culture of the virus and the production of inactivated vaccines, and has good application prospect in the culture of the tilapia lake virus.

Description

Cell line for over-expressing PIGR protein and preparation method and application thereof

Technical Field

The invention belongs to the field of biotechnology and cytology, and particularly relates to a cell line for over-expressing PIGR protein, and a preparation method and application thereof.

Background

The poly-immunoglobulin receptor (pIgR) is a type I transmembrane glycoprotein belonging to immunoglobulin superfamily, and can mediate trans-epithelial cell transport of secretory antibody IgA and IgM in animal mucosa-related immune tissue, and can be secreted to mucosa surface after enzyme digestion so as to implement the action of inhibiting adhesion and invasion of pathogenic microorganism. Mammalian pIgR molecules are composed of three parts, a cytoplasmic region, an extracellular ligand-binding region and a transmembrane region, wherein the extracellular ligand-binding region contains 5 immunoglobulin-like functional domains (Immunoglobulin like domain, ILD1-ILD 5), wherein the amino acid sequences of ILD1, ILD4 and ILD5 are highly conserved in mammals. ILD1 is an important domain that binds to multimeric immunoglobulins (Polymeric immunoglobulin, pIg). In other vertebrates, the number of ILDs differs, e.g., 4 ILDs are present in extracellular regions of the bird and amphibian type of pIgR molecules corresponding to mammalian ILD1, LD3, ILD4 and ILD5, respectively, whereas fish pIgR molecules only find two immunoglobulin-like domains corresponding to mammalian ILD1 and ILD 5.

In the related art, the study of the immunological function of pIgR is currently focused mainly on the aspects of regulating the expression of pigg in mucosal epithelial cells, the binding of ligand to pIgR, the intracellular transport of pigg and the intracellular neutralization of pIgA in pathogens and antigens, the cleavage of pigg at the surface into SC and the novel functions of free SC and SIgA in epithelial surfaces and exocrine. In fish research, the regulation and control of pIgR in bacterial infection process is mainly involved. The research shows that the pIgR expression level of various fishes including loaches, crucian, carps, zebra fish, grass carp and the like after being infected with bacteria has obvious difference compared with healthy fish bodies. The pIgR in rainbow trout and sea bass plays a role in inhibiting the proliferation of pathogenic bacteria by combining with symbiotic bacteria and pathogenic bacteria, and shows that the pIgR plays an important role in maintaining a microbial community and resisting invasion of pathogenic bacteria on a mucous membrane surface. pIgR functions as a cell surface receptor and is hijacked by part of viruses as a cell receptor to invade cells at the same time of the mucosal immune process, such as white spot syndrome virus, porcine epidemic diarrhea virus, murine norovirus and the like.

In the related art, the report of PIGR research in aquatic animals is very limited, and the research on the role of the aquatic animal pIgR in the process of resisting virus invasion is clearer, namely the Penaeus japonicus pIgR (MjpIgR) and white spot syndrome virus (White spot syndrome virus, WSSV). After VP24 of WSSV binds to the extracellular portion of MjpIgR, the intracellular portion of MjpIgR acts with calmodulin to recruit clathrin and AP-2 complex to promote WSSV into cells to complete self-proliferation. These results demonstrate that PIGR has important regulatory effects on viral proliferation.

Disclosure of Invention

The present invention aims to solve at least one of the technical problems in the prior art described above. Therefore, the invention provides a cell line for over-expressing PIGR protein, a preparation method and application thereof, and the immortalized over-expressing PIGR protein cell strain TiBC-PIGR is obtained by constructing PIGR over-expression plasmid and transfecting the PIGR over-expression plasmid into tilapia brain cells (TiBC) ⁺ . The cell strain is easy to culture, fast in proliferation speed, capable of being infinitely expanded, stable in property, easy to store, mature in method technology, high in repeatability, and capable of being completed by common researchers, and has genetic stability.

In a first aspect of the invention, there is provided SEQ ID NO:4 or SEQ ID NO:3 in the preparation of a PIGR overexpression vector.

In the invention, the inventor constructs a PIGR over-expression vector based on the complete ORF (SEQ ID NO: 4) of the PIGR gene, and finds that the vector can stably transfect tilapia brain cells (TiBC), thereby obtaining a cell line for over-expressing the PIGR protein.

SEQ ID NO:4 is as follows: 5'-ATGAGAGAGTTCTGCACCAGCTTGGCTCG AACTGACGAGACCTCCTCGACCAATCCAAGTAAAGACAAAGTGAGCATTTTTGATGACC CGGCCCAGGAGATGTTCACAGTGACCATGAACAACCTGAAAGAGACGCAGTCTGGGTG GTACTTGTGTGGTGTGGAATTAGGTAACGGGTGGAAGGCCGATGATGTTGCTTACACTA AAGTGAAAGTCATTCACGGTGTGTCAGTCGTGAACAGCATGGTGAGTGGGGAAGAAGG AAGTAGTGTCACGGTTCAGTGCCTTTACAGTGAAAGATTCAGAGAAAGTGAGAAGAAG TGGTGTCGGAGCGGAGGCTGGAGCTCCTGTCTGTCGACGGGTTCTGAAGGGAGTTACG AAGATACTTCAGTGGCCATCAGCGATGACAGAACTGGGACTTTCACTGTAACCTTAAAG AAGCTGCAGATGAGAGATGCTGGCTGGTATTTATGTTCTGCAGGGCAGCAGCAAGTAGC CGTACAGGTTCAGGTCAGACCACGCGCCTCTACTACGACAGAGCCTGTGACATCCCCAC CTACTCCGAGTCAGTCTGCTGTGTACCTCCCTCCACCCAAACCCATCACTAAGGAGTCCT GGAACAGTCACCGTTACATGTTGGAGTCTATAGCGGTGTGTTCGTCTCTCCTGCTCCTTG TGGGCTTGGCTGTATTGGCAAGAAAGTTGTGGATACTGCACAAGGAGGATTCTGAACTT AGACACTTTAAGGAGATGAAAGAGAGATTCCCTGATAATCCATCGGGCATGAGTGACCT GCAATATGTTCCTATTGCTTTCCATAACAAAGCTACCATGGACGTACGTGCTTACCAGGTA CCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAG-3' (SEQ ID NO: 4).

In a second aspect of the invention, there is provided a PIGR overexpression vector comprising the sequence set forth in SEQ ID NO: 4.

In the invention, the inventor constructs a PIGR over-expression vector based on the complete ORF (SEQ ID NO: 4) of the PIGR gene, and finds that the vector can stably transfect tilapia brain cells (TiBC), thereby obtaining a cell line for over-expressing the PIGR protein.

In some embodiments of the invention, the nucleotide sequence of the vector is set forth in SEQ ID NO: 3.

In the invention, the inventor carries out sequencing on the PIGR over-expression vector constructed and obtained, and discovers that the sequence is shown as SEQ ID NO: 3.

In a third aspect, the present invention provides a method for preparing the PIGR overexpression vector according to the second aspect of the present invention, comprising the following steps:

and amplifying the cDNA sequence of the PIGR protein by PCR to obtain a target fragment, and inserting the target fragment into eukaryotic expression plasmids to obtain the PIGR protein.

In some embodiments of the invention, the nucleotide sequence of the primers used for the PCR amplification is as follows:

the upstream primer PIGR-F is 5'-CCGCTCGAGATGCCGCGACTCTCTATACT-3';

the downstream primer PIGR-R is 5'-CGGGGTACCGTAAGCACGTACGTCCA-3'.

In some embodiments of the invention, the primers are designed based on the tilapia pIgR nucleotide sequence in the NCBI GenBank (MK 061423.1) database.

In some embodiments of the invention, the cDNA sequence is obtained based on TiBC cell total RNA reverse transcription.

In some embodiments of the invention, the method of making the PIGR overexpression vector is specifically: and (3) amplifying a cDNA sequence of the PIGR protein by PCR to obtain a target fragment, carrying out enzyme digestion on the target fragment and the empty vector by using restriction enzymes EcoRI and KpnI, connecting the digested target fragment and empty vector, and screening by using a kanamycin resistance plate to obtain the PIGR overexpression vector.

In some embodiments of the invention, the empty vector is a pEGFP-N1 vector.

In a fourth aspect, the invention provides the use of a PIGR overexpression vector according to the second aspect of the invention in the preparation of a product that overexpresses the PIGR protein.

In the present invention, the inventors found that the above-described PIGR overexpression vector is capable of stably expressing PIGR after transfection into cells, and the expression level is significantly higher than that of cells transfected with empty vectors.

In a fifth aspect of the present invention, there is provided an immortalized PIGR overexpressing cell line deposited in the China Center for Type Culture Collection (CCTCC) for which the deposit address is: chinese, university of Wuhan, taxonomic designation TiBC-PIGR, a tilapia multimeric immunoglobulin over-expression brain cell line ⁺ The preservation number is CCTCC NO: C2022162.

In the specific operation of preparing the PIGR protein over-expression cell line, the cell uptake, integration and expression of the exogenous gene are all small probability events, and the occurrence of the small probability events can be improved only under specific operation conditions; in addition, the probability of integrating the exogenous gene into the genome is small, and the exogenous gene is randomly integrated into the genome, so that the amount of the target protein expressed by different transfected cells is greatly different, and the cells which lose the exogenous gene and the cells which rarely express the target gene can take advantage of along with the continuation of the culture time, and the cells which strongly express the target protein can be less and less. In the invention, the inventor effectively optimizes the technical defects in the traditional method through a special construction method, obviously improves the occurrence rate of a gene recombination cell line, and can obtain a plurality of cells with high expression of PIGR protein; the expression quantity of the cell line for the ultra-high expression of the PIGR protein obtained by the invention is 12.43 times of that of an empty cell through screening and verification, and the cell line still has the ultra-high efficiency capability of over-expressing the PIGR protein through multi-generation substitution culture, has good stability, and is an aquatic animal cell line for permanently over-expressing the PIGR protein.

In a sixth aspect, the invention provides a method for preparing an immortalized PIGR overexpressing cell strain according to the fifth aspect of the invention, comprising the steps of:

the PIGR over-expression vector of the second aspect of the invention is transfected into tilapia brain cells, and the culture solution containing antibiotics is used for screening culture, and positive clones obtained by screening are immortalized PIGR over-expression cell strains.

In some embodiments of the invention, the antibiotic comprises G418.

In some embodiments of the present invention, the preparation method specifically comprises:

washing tilapia brain cells with 75% of confluence by using HBSS, adding a Gibco serum-reduced culture medium and the PIGR overexpression vector according to the second aspect of the invention, uniformly mixing, culturing for 5-7 h, and changing into a serum-containing M199 culture medium to obtain transfected TiBC cells. Screening by using M199 culture medium containing G418l until cell cloning occurs.

In a seventh aspect, the invention provides the use of an immortalized PIGR overexpressing cell strain according to the fifth aspect of the invention in any one or more of (1) to (4) below;

(1) Preparing tilapia lake virus vector or cell model;

(2) Screening and/or evaluating tilapia lake virus therapeutic drugs;

(3) Preparing tilapia lake virus diagnostic products;

(4) And (5) developing tilapia lake virus products.

The inventor finds that the PIGR protein up-regulated expression can be caused when TiLV infects TiBC cells, and the PIGR protein up-regulated expression quantity induced when TiLV strains with good cell adaptability infects TiLV strains is higher, which shows that the PIGR plays an important role when TiLV infects. The TiBC cell line over-expressing the PIGR protein has good application prospect in the culture of TiBC cell line over-expressing the PIGR protein, and the TiBC cell line over-expressing the PIGR protein in the invention is used for culturing TiBC cell line over-expressing the PIGR protein, so that the TiBC cell line over-expressing the PIGR protein can obviously influence the virus proliferation titer, and has great significance on the efficient culture of the TiBC cell line over-expressing the PIGR protein and the production of inactivated vaccines thereof.

The beneficial effects of the invention are as follows:

(1) The cell line constructed in the invention can permanently express the PIGR protein in high quantity, is easy to culture, has high proliferation speed, can be infinitely expanded, has stable property, is easy to store, has mature technology and strong repeatability, can be completed by common researchers, and has genetic stability.

(2) The cell line for over-expressing the PIGR protein and the preparation method thereof have profound researches and wide application, including research on the host cell immune response stability, the immortalization of aquatic animal cells capable of expressing the required protein, and the influence of the cells and the PIGR protein on the proliferation of tilapia lake virus.

Drawings

FIG. 1 shows a 1% agarose gel electrophoresis of PCR amplification products in an embodiment of the invention, wherein lane M is DLMaker 5000 and lanes 1 and 2 are amplification products of pIgR.

FIG. 2 shows the identification results of recombinant plasmids in the examples of the present invention, wherein A is the identification result of recombinant plasmid positive clone PCR, and M: standard marker of DNA molecular weight, 1-2: pEGFP-pIgR positive clones; b is recombinant plasmid enzyme digestion verification result, M: standard marker of DNA molecular weight, 1: recombinant vector pEGFP-pIgR,2: pEGFP-N1 empty vector; c is WB detection result, M: protein molecular weight standard marker,1: transfection of pEGFP-pIgR cells, 2: transfection of pEGFP-N1 empty cells, 3: tiBC is a non-transfected cell.

FIG. 3 shows the fluorescence of TiBC cells after transfection in the examples of the present invention, A is transfected pEGFP-N1 empty cells, and B is transfected pEGFP-pIgR cells.

FIG. 4 is an image of an over-expressed cell line obtained by G418 screening in an example of the present invention, wherein A is G418 screening pEGFP-N1 empty transfected cells bright field; b is G418 screening pEGFP-N1 empty transfected cell fluorescence diagram; c, screening pEGFP-pIgR transfected cells for G418 to obtain a bright field; d was G418 screening pEGFP-pIgR transfected cell fluorescence.

FIG. 5 is a fluorescence image after TiBC-PIGR+ serial passage in an embodiment of the invention, A is a passage 1 fluorescence image; b is a fluorescent chart of passage 3 times; c is a fluorescent chart of passage 5 times; d is a fluorescent chart of 10 passages.

FIG. 6 is a graph showing the effect of pIgR overexpression on TiLV proliferation, wherein A is a comparison graph of TiLV S8 gene expression level; b is a TiLV S10 gene expression level comparison chart; c is a TiLV copy number comparison chart.

FIG. 7 is a comparison of protein level changes in pIgR-overexpressing cells and empty cells at 48h infection with TiLV.

FIG. 8 is a comparison of IFA results of pIgR over-expressing cells and empty cells 48h after TiLV infection.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to the following specific embodiments. It should be understood that the detailed description is presented herein for purposes of illustration only and is not intended to limit the invention.

The experimental materials and reagents used, unless otherwise specified, are those conventionally available commercially.

Construction and sequencing of recombinant pMD18T-OnpIgR cloning vector

(1) Design and Synthesis of oligonucleotide primers:

according to the nucleotide sequence of tilapia pIgR in NCBI GenBank (MK 061423.1) database, designing to obtain a tilapia pIgR specific primer, wherein the specific nucleotide sequence of the primer is as follows:

the upstream primer PIGR-F5'-CCGCTCGAG ATGCCGCGACTCTCTATACT-3' (SEQ ID NO: 1);

the downstream primer PIGR-R5'-CGGGGTACCGTAAGCACGTACGTCCA-3' (SEQ ID NO: 2).

The above primers were used as PCR amplification primers for obtaining the target fragment.

(2) Extraction of TiBC cell total RNA:

inoculating 100 generation immortalized TiBC cells (tilapia brain cells, tilapia brain cell) to a bottom area of 25cm ² After culturing in a cell culture flask for 24 hours, 1mL of Trizol was added, and the flask was left at room temperature for 5 minutes to allow the cells to be sufficiently lysed. 12 Centrifuging at 000r/min for 5min, and collecting supernatant. According to 200 mu L chloroform/mLChloroform was added to the Trizol amount, and the mixture was stirred and stirred at room temperature for 15 minutes. Centrifuging at 4deg.C for 15min at 12 000r/min. Sucking the supernatant into another centrifuge tube, adding isopropanol according to the amount of 0.5mL isopropanol/mL Trizol, uniformly mixing, and standing at room temperature for 5-10 min. Centrifuging at 4deg.C for 10min at 12 000r/min, removing supernatant, and precipitating RNA at the bottom of tube.

75% ethanol was added to the tube in an amount of 1mL 75% ethanol/mL Trizol, the tube was gently shaken and centrifuged at 12 000r/min for 10min at 4 ℃. The supernatant was discarded and dried at room temperature. Adding 20 μl of RNase-free water for dissolving, and storing at-80deg.C.

(3) Full-length cDNA synthesis of PIGR gene fragment:

taking 5 mu L of total RNA obtained in the step (2), heating at 70 ℃ for 10min, and carrying out ice bath for 5min. Other reagents were added according to the reaction system shown in Table 1. Wherein the upstream primer F and the downstream primer R are respectively an upstream primer PIGR-F and a downstream primer PIGR-R.

TABLE 1 reverse transcription system

Component (A)	Content of
		200U reverse transcriptase M-MLV	1μL
25 pmol/. Mu.L of upstream primer F	1μL
		25 pmol/. Mu.L of downstream primer R	1μL
10mmol/L dNTPs	1μL
		Total RNA obtained in step (2)	5μL
ddH 2 O	1μL

The reaction was carried out at 42℃for 60min to obtain cDNA (reverse transcription product). Inactivating the reverse transcriptase in a water bath at 70℃for 10min.

10. Mu.L of the prepared cDNA was used to construct a PCR amplification system as shown in Table 2. Among them, the following PCR buffer was purchased from Nanjinouzan technologies Co., ltd.

TABLE 2 PCR amplification System

Component (A)	Content of
		10×PCR buffer	4μL
25mmol/L MgCL 2	4μL
		25 pmol/. Mu.L of upstream primer PIGR-F	0.5μL
25 pmol/. Mu.L downstream primer PIGR-R	0.5μL
		10mmol/L dNTPs	0.5μL
cDNA template	10μL
		ddH 2 O	30μL

Boiling and denaturing for 10min, and ice-bathing for 5min. Then 0.25. Mu.L of Taqplus DNA polymerase (5U/. Mu.L) was added and mixed well. The following reaction procedure was then carried out: denaturation at 94℃for 30sec, annealing at 57℃for 40sec, elongation at 72℃for 90sec,25 cycles; and extending at 72 ℃ for 10min. The PCR products were verified by nucleic acid electrophoresis on a 1% agarose gel.

The results are shown in FIG. 1.

1% agarose gel electrophoresis showed a band of interest of about 1023bp conforming to the expected size. Further purifying and sending to biological company for sequencing, and comparing the sequencing result by BLAST search to find that the similarity with the tilapia pIgR sequence in NCBI database is 100%, so that the amplified fragment can be determined to be the pIgR ORF (OnpIgR) sequence of tilapia.

(4) Construction of eukaryotic expression vector pEGFP-pIgR:

the OnpIgR gene obtained by the amplification of (3) and pEGFP-N1 vector were digested with restriction enzymes EcoRI and KpnI, and the digestion system is shown in Table 3. Among them, the following enzyme-cut Buffer was purchased from Nanjinouzan technologies, inc. The reaction conditions are as follows: the reaction was carried out at 37℃for 1h. The digested pEGFP-N1 vector and digested pIgR gene fragment are obtained.

TABLE 3 enzyme digestion system

Component (A)	Content of
		10 Xenzyme cutting Buffer	5μL
EcoRⅠ/KpnⅠ	5μL
		Vector/gene fragment	2μg
Enzyme-free water	Make up to 50 mu L

The cleavage products were then ligated using the T4 ligase of Thermo Fisher based on the instructions of the commercial kit, the specific reaction system was as follows:

table 4 connection system

The reaction conditions are as follows: the reaction was carried out at 22℃for 10min. The ligation product was obtained.

The ligation product was transformed into E.coli DH 5. Alpha. Cells. The specific operation steps are as follows: taking out DH5 alpha competent cells from the low-temperature refrigerator at-80 ℃, placing the cells in ice for melting, adding the connection product, uniformly mixing, and standing on the ice for 25 minutes. And the water bath at 42 ℃ is carried out for 60 seconds, and the water bath is quickly put back on ice and kept stand for 2 minutes, so that shaking is avoided, and the conversion efficiency is reduced. 700mL of antibiotic-free LB broth medium was added and the mixture was placed in a shaker at 37℃and resuscitated at 200rpm for 1h. Centrifuging at 4000-5000rpm for 1min. The supernatant was aspirated, leaving only about 100% mL of the medium, and after mixing by blowing, the mixture was spread on a kanamycin-resistant plate and incubated overnight at 37 ℃. And (5) picking a monoclonal colony for bacterial liquid PCR amplification.

The reaction system is shown in Table 5.

TABLE 5 bacterial liquid PCR System

Component (A)	Content of
		PIGR-F	2μL
PIGR-R	2μL
		Premix Taq TM	2μL
Monoclonal bacteria liquid	2μL
		Enzyme-free water	12μL

Reaction conditions: pre-denaturation at 94℃for 3min; denaturation at 94℃for 30s, annealing at 55℃for 30s, elongation at 72℃for 1min,30 cycles; final extension at 72℃for 10min. Preserving at 4 ℃ for standby.

The bacterial liquid PCR result shows that the amplified fragment size is about 1023bp, and the amplified product is consistent with the expected result, and is sent to a biological company for sequencing, so that the correct pIgR gene is confirmed. The plasmid is extracted from the confirmed bacterial liquid, double enzyme digestion verification is carried out, 1% agarose gel electrophoresis is used for displaying specific target bands near 5000bp and 1000bp, western Blot results show that fusion protein bands which are consistent with the expected size appear at the positions of 55 kDa-70 kDa of transfected pEGFP-pIgR (figure 2), and further the recombinant eukaryotic expression plasmid pEGFP-pIgR can accurately express target proteins in cells. Shows that the recombinant plasmid containing the pIgR gene is successfully constructed.

Wherein, the sequence of the pEGFP-pIgR recombinant plasmid obtained by sequencing is as follows (the underlined position is the complete ORF of the PIGR gene):

5’-TAGTGTCCTGGAGGGTGGATCCATCACTGTCCCGTGTCGATATGACCCTAAGTAT GCTAACCATGTCAAATACTGGTGTAGTGGGAGCATGAGAGAGTTCTGCACCAGCTTGGCTCGAACTGACGAGACCTCCTCGACCA ATCCAAGTAAAGACAAAGTGAGCATTTTTGATGACCCGGCCCAGGAGATGTTCACAGTGACCATGAACAACCTGAA AGAGACGCAGTCTGGGTGGTACTTGTGTGGTGTGGAATTAGGTAACGGGTGGAAGGCCGATGATGTTGCTTACACT AAAGTGAAAGTCATTCACGGTGTGTCAGTCGTGAACAGCATGGTGAGTGGGGAAGAAGGAAGTAGTGTCACGGTTC AGTGCCTTTACAGTGAAAGATTCAGAGAAAGTGAGAAGAAGTGGTGTCGGAGCGGAGGCTGGAGCTCCTGTCTGTC GACGGGTTCTGAAGGGAGTTACGAAGATACTTCAGTGGCCATCAGCGATGACAGAACTGGGACTTTCACTGTAACC TTAAAGAAGCTGCAGATGAGAGATGCTGGCTGGTATTTATGTTCTGCAGGGCAGCAGCAAGTAGCCGTACAGGTTC AGGTCAGACCACGCGCCTCTACTACGACAGAGCCTGTGACATCCCCACCTACTCCGAGTCAGTCTGCTGTGTACCT CCCTCCACCCAAACCCATCACTAAGGAGTCCTGGAACAGTCACCGTTACATGTTGGAGTCTATAGCGGTGTGTTCG TCTCTCCTGCTCCTTGTGGGCTTGGCTGTATTGGCAAGAAAGTTGTGGATACTGCACAAGGAGGATTCTGAACTTA GACACTTTAAGGAGATGAAAGAGAGATTCCCTGATAATCCATCGGGCATGAGTGACCTGCAATATGTTCCTATTGC TTTCCATAACAAAGCTACCATGGACGTACGTGCTTACCAGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATG GTGAGCAAGGGCGAGGAG-3’ (SEQ ID NO：3)。

establishment of cell lines overexpressing the PIGR protein

(1) Extraction of recombinant plasmid pEGFP-pIgR:

the positive bacterial liquid obtained in the above example was used to extract recombinant plasmid pEGFP-pIgR using endotoxin-free plasmid extraction kit (Omega Co.), and the specific procedure was as follows:

positive bacterial liquid is prepared according to the following steps of 1:100 was added to the prepared LB medium with kanamycin resistance, and cultured at 37℃for 12 hours at 200 rmp/min. The cells were collected by centrifugation at 4000 Xg for 10min at room temperature. The medium was discarded to leave a bacterial pellet, 10mL of Solution I (from the plasmid extraction kit described above) was added, and the pellet was thoroughly suspended by vortexing. Solution II of 10mL was added, the centrifuge tube lid was closed, gently inverted and mixed, and then allowed to stand at room temperature for 2 to 3 minutes (not more than 5 minutes) to obtain a clarified cell lysate. 5mL of pre-chilled N3 buffer on ice was added to the cell lysate, mixed until a white flocculent precipitate formed, and incubated at room temperature for 2 minutes (to ensure complete neutralization of the solution). Filtration was performed using a syringe filter. To the filtrate was added 0.1 volume of ETR Solution and incubated on ice for 10 minutes. After 5 minutes of water bath, the mixture was centrifuged at 4000 Xg for 5 minutes at room temperature. The supernatant was transferred to a new centrifuge tube, half volume of absolute ethanol was added, and after mixing, incubated at room temperature for 2 minutes. Transfer to a binding column and centrifuge at 4000 Xg for 3min. The filtrate was discarded until all the mixture was bound to the column. 10mL of HBC buffer (diluted with isopropanol as required for the application) was added to the binding column and centrifuged at 4000 Xg for 3min. The filtrate was discarded, 15 g mL DNA wash buffer was pipetted into a binding column and centrifuged at 4000 Xg for 3min. The filtrate was discarded and the washing was repeated 1 time using a DNA wash buffer. Centrifuging to remove filtrate. 6000 Xg, and centrifuging the combined column for 10min, and spin-drying the combined column base film. The binding column was transferred to a new 50mL centrifuge tube. To the center of the binding column base membrane was added 1mL Endo-Free Elution buffer and allowed to stand at room temperature for 5 minutes. The plasmid was eluted by centrifugation at 4000 Xg for 5min.

(2) Transfecting the immortalized TiBC cells with a pEGFP-pIgR eukaryotic expression vector:

a. preparation of transfected cells: at 27 ℃,5% CO ₂ Immortalized TiBC cells of 100 generations were cultured in six-well cell culture plates under the conditions for 12-18h, and transfection was started when the cell confluency was 75%.

b. Preparation of liposome/DNA complexes: six-well plates were equally divided into two groups, and reference was made to Lipofectamine2000, wherein one group was transfected with 2g per well of pEGFP-N1 empty (pEGFP-N1 was purified by repeated phenol/chloroform extraction, OD260/OD280 was 1.8-2.0 as measured by UV spectrophotometry, and was sterilized by filtration before use), and the other group was transfected with 2g per well of the recombinant eukaryotic expression vector pEGFP-pIgR obtained in the above example. The plasmid was mixed with the transfection reagent thoroughly by gentle shaking and left at room temperature for 25min to obtain liposome/DNA complexes, which did not affect transfection if the solution was cloudy. However, if precipitation occurs, transfection is stopped and the preparation is resumed.

c. Cells with 75% confluency in step a were washed 3 times with HBSS and then 1.5mL Gibco serum-reduced medium was added per well. Then adding the DNA/liposome mixture obtained in the step b, shaking gently, shaking uniformly, 27 ℃,5% CO ₂ After 6h of culture at saturated humidity, the TiBC cells after transfection were obtained by exchanging with M199 medium containing 5% (v/v) serum.

(2) Selection of G418 resistant cells:

TiBC cells after transfection were incubated at 27℃with 5% CO ₂ Culturing for 36 hours. The fluorescence was observed under a fluorescence microscope (as shown in fig. 3). When stronger fluorescence was seen, culture was continued by adding M199 medium containing G418l at a concentration of 1000G/mL, changing the medium every three days until cell cloning occurred.

(3) Obtaining an immortalized cell line over-expressing the PIGR protein:

the M199 culture medium containing 5% serum was added to each well, and the wells from which the cell clones were grown were observed under light to see that the individual cell clones were visibly opaque, the positions of the clones were marked by circling with a marker pen, and the cell clones were picked up with a sterile gun head on an ultra clean bench. Pumping into 96-well plate, limiting dilution, sequentially transferring into 24-well plate, 6-well plate, 30mL cell culture flask, and 50mL cell culture flask, gradually expanding culture, and maintaining G418 concentration and serum addition amount at 5% (v/v). Obtaining an immortalized over-expressed PIGR protein cell line named TiBC-PIGR after G418 screening ⁺ (FIG. 4).

The cells obtained by constructing the immortalized over-expression PIGR protein are preserved in China Center for Type Culture Collection (CCTCC) in the year of 2022, 6 and 3, with the preservation number of C2022162.

(4) Immortalization verification:

the TiBC-PIGR+ obtained by the steps is continuously passaged for 10 generations, and stronger green fluorescence is still visible (figure 5), which shows that the immortalized over-expression cell line is successfully constructed.

Promotion of TiLV proliferation by cell lines overexpressing the PIGR protein

Immortalized TiBC cells of 100 passages were seeded to a bottom area of 25cm 24h prior to transfection ² Of the 6 cell culture flasks, an average of 2 groups was obtained. One group was transfected with 50mg of pEGFP-N1 empty plasmid, the other group was transfected with 50mg of the above-mentioned pEGFP-pIgR over-expression recombinant plasmid, and three groups were placed in parallel. The culture medium was discarded at 36h after transfection, washed twice with HBSS, and 10 added separately ⁵ The copies/uL of TiLV virus solution were each 1mL and incubated in an incubator at 28℃for 1.5h. The virus solution was centrifuged off, 5mL of M199 medium containing 5% FBS was added, and the culture was performed in an incubator at 28℃for 48 hours and 72 hours. And (5) collecting samples. RNA was extracted by the method described in the above examples to prepare cDNA. And respectively carrying out quantitative detection on the TiLV-S1 gene, the TiLV-S8 gene and the TiLV-S10 gene. Wherein the detection was performed using a Ai Kerui bioengineering limited fluorescent quantitative kit.

The results are shown in FIG. 6.

In cells transfected with the recombinant plasmid overexpressing pIgR, mRNA levels of the S8 and S10 fragments 48h and 72h post TiLV infection were significantly upregulated and the copy number was also significantly increased compared to cells transfected with empty vector as control. After 72h of overexpression, the TiLV proliferation in the pIgR overexpressing cell line was 8.08x10 ⁷ The proliferation amount of TiLV in the transfected empty plasmid cell line was 6.5X10 by cobies/uL ⁶ The amount of virus proliferation in the copies/uL over-expressed cell line was 12.43 times that of the empty cell line.

Meanwhile, a part of cells were collected for WB (Western Blot) and IFA (indirect immunofluorescence) detection, and the effect of over-expression pIgR on TiLV proliferation was studied at the protein level.

The WB detection operation steps are as follows:

preparing 10% lower layer separating gel and upper layer concentrating gel according to the instructions, placing the prepared protein gel into an electrophoresis tank, adding SDS-PAGE electrophoresis liquid, removing a comb, sucking 5 mu L of Thermo26616 pre-dyed protein MARKER, and then adding 20 mu L of protein sample into a sample adding hole. And (3) carrying out 80V constant voltage electrophoresis for 20min, converting the voltage into 120V to continue electrophoresis after the protein strips are on the same horizontal line in the concentrated gel, and ending the electrophoresis to carry out transfer membrane after the bromophenol blue indication strip reaches the bottom of the separation gel. Protein samples were separated by SDS-PAGE and transferred to Nitrocellulose (NC) membrane by a transfer membrane apparatus. And taking out the NC film to make corresponding marks. NC films were blocked with 5% skim milk for 1h at room temperature, then GFP-tagged rabbits were resistant to following 1: after 4000 proportion dilution, the primary antibody is used as primary antibody for 2 hours at room temperature. Washed 3 times with PBST for 10min each, and incubated with secondary antibody (1:4000 dilution) at room temperature for 2h. PBST was washed 3 times, 10 min/time. Color development was then performed using a hypersensitive ECL chemiluminescent kit (new siemens biotechnology limited), operating reference instruction manual. Images were acquired in a chemidoctmxrs+ imager.

Western Blot results are shown in FIG. 7.

Compared with a control group, the PIGR protein in the over-expression cell line has obvious over-expression phenomenon, which proves that the method can successfully construct the immortalized cell line over-expressing the PIGR protein.

The IFA detection operation steps are as follows:

fixing cells with pre-chilled formaldehyde at-20deg.C for 10min, and air drying for 15min. PBS was washed twice and blocked with 5% horse serum for 1h at room temperature. The PBS was washed twice. The following 1:500 proportion of diluted monoclonal antibody of the anti-TiLV-S8 fragment is used as a primary antibody, and the primary antibody is incubated for 1h at room temperature. The incubated primary antibodies were discarded and washed 3 times for 10min each with PBST according to 1:2000 proportion of Alexa Fluor 488-labeled goat anti-mouse antibody as secondary antibody was diluted and incubated for 2h at room temperature. PBST was washed 3 times for 10min each, and stained with DAPI staining solution for 10min. And (5) observing and photographing record by laser confocal.

The results are shown in FIG. 8.

It can be found that the red positive signal of TiLV at 48h was significantly greater in the plgr over-expressed group than in the control group.

From the above results, it was demonstrated that pIgR overexpression can promote proliferation of TiLV. In the conventional art, the probability of obtaining a cell line that overexpresses the PIGR protein is very low because only a portion of the foreign gene can enter the nucleus through the cytoplasm after entering the cell, and at most 80% of the foreign DNA entering the nucleus is transiently expressed depending on the cell type. Furthermore, in rare cases, the foreign DNA introduced into the cell is linked by a series of non-homologous intermolecular recombination nuclei and finally integrated into the chromosome of the cell, and the genome of the cell is expressed in a free portion, so that the integration does not necessarily mean expression, only the gene integrated into the expression region is expressed, and the amount of expression of the foreign gene integrated into a different chromosome segment is also different. In addition, as the culture time continues, cells that have lost the foreign gene and cells that rarely express the target gene will dominate, and cells that strongly express the target protein will be less and less. In summary, because the ingestion, integration and expression of exogenous genes are all small probability events, the cell line for obtaining the high-expression PIGR protein is more small probability events, and the method in the embodiment of the invention can stably obtain the PIgR over-expression cell line, thereby realizing the breakthrough of the technology.

Application of cell line for over-expressing PIGR protein

Although there are few studies on the roles played by PIGR in the viral infection process of aquatic animals, it is now clear that Penaeus japonicus pIgR (MjpIgR) and white spot syndrome virus (White spot syndrome virus, WSSV). WSSV can complete self-proliferation by binding to MjpIgR and then entering cells by clathrin-mediated endocytosis. However, these results have also demonstrated that PIGR has important regulatory effects on viral proliferation.

In the previous study of the inventor, it is found that the TiLV infection immortalized TiBC cells in the invention can cause the up-regulated expression of PIGR protein, and the up-regulated expression quantity of the PIGR protein induced during the infection of the TiLV strain with good cell adaptability is higher, which indicates that the PIGR plays a key regulation role during the infection of the TiLV. The TiBC cell line over-expressing the PIGR protein has good application prospect in the culture of the TiBC cell line over-expressing the PIGR protein, and the TiBC cell line over-expressing the PIGR protein constructed in the embodiment of the invention can obviously influence the virus proliferation titer, thereby having great significance in the efficient culture of the Tilapia lake virus and the production of inactivated vaccines thereof.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Zhujiang aquatic institute of China aquatic science institute

<120> a cell line over-expressing PIGR protein, and preparation method and application thereof

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 29

<212> DNA

<213> artificial sequence

<400> 1

ccgctcgaga tgccgcgact ctctatact 29

<210> 2

<211> 26

<212> DNA

<213> artificial sequence

<400> 2

cggggtaccg taagcacgta cgtcca 26

<210> 3

<211> 994

<212> DNA

<213> artificial sequence

<400> 3

tagtgtcctg gagggtggat ccatcactgt cccgtgtcga tatgacccta agtatgctaa 60

ccatgtcaaa tactggtgta gtgggagcat gagagagttc tgcaccagct tggctcgaac 120

tgacgagacc tcctcgacca atccaagtaa agacaaagtg agcatttttg atgacccggc 180

ccaggagatg ttcacagtga ccatgaacaa cctgaaagag acgcagtctg ggtggtactt 240

gtgtggtgtg gaattaggta acgggtggaa ggccgatgat gttgcttaca ctaaagtgaa 300

agtcattcac ggtgtgtcag tcgtgaacag catggtgagt ggggaagaag gaagtagtgt 360

cacggttcag tgcctttaca gtgaaagatt cagagaaagt gagaagaagt ggtgtcggag 420

cggaggctgg agctcctgtc tgtcgacggg ttctgaaggg agttacgaag atacttcagt 480

ggccatcagc gatgacagaa ctgggacttt cactgtaacc ttaaagaagc tgcagatgag 540

agatgctggc tggtatttat gttctgcagg gcagcagcaa gtagccgtac aggttcaggt 600

cagaccacgc gcctctacta cgacagagcc tgtgacatcc ccacctactc cgagtcagtc 660

tgctgtgtac ctccctccac ccaaacccat cactaaggag tcctggaaca gtcaccgtta 720

catgttggag tctatagcgg tgtgttcgtc tctcctgctc cttgtgggct tggctgtatt 780

ggcaagaaag ttgtggatac tgcacaagga ggattctgaa cttagacact ttaaggagat 840

gaaagagaga ttccctgata atccatcggg catgagtgac ctgcaatatg ttcctattgc 900

tttccataac aaagctacca tggacgtacg tgcttaccag gtaccgcggg cccgggatcc 960

accggtcgcc accatggtga gcaagggcga ggag 994

<210> 4

<211> 906

<212> DNA

<213> PIGR

<400> 4

atgagagagt tctgcaccag cttggctcga actgacgaga cctcctcgac caatccaagt 60

aaagacaaag tgagcatttt tgatgacccg gcccaggaga tgttcacagt gaccatgaac 120

aacctgaaag agacgcagtc tgggtggtac ttgtgtggtg tggaattagg taacgggtgg 180

aaggccgatg atgttgctta cactaaagtg aaagtcattc acggtgtgtc agtcgtgaac 240

agcatggtga gtggggaaga aggaagtagt gtcacggttc agtgccttta cagtgaaaga 300

ttcagagaaa gtgagaagaa gtggtgtcgg agcggaggct ggagctcctg tctgtcgacg 360

ggttctgaag ggagttacga agatacttca gtggccatca gcgatgacag aactgggact 420

ttcactgtaa ccttaaagaa gctgcagatg agagatgctg gctggtattt atgttctgca 480

gggcagcagc aagtagccgt acaggttcag gtcagaccac gcgcctctac tacgacagag 540

cctgtgacat ccccacctac tccgagtcag tctgctgtgt acctccctcc acccaaaccc 600

atcactaagg agtcctggaa cagtcaccgt tacatgttgg agtctatagc ggtgtgttcg 660

tctctcctgc tccttgtggg cttggctgta ttggcaagaa agttgtggat actgcacaag 720

gaggattctg aacttagaca ctttaaggag atgaaagaga gattccctga taatccatcg 780

ggcatgagtg acctgcaata tgttcctatt gctttccata acaaagctac catggacgta 840

cgtgcttacc aggtaccgcg ggcccgggat ccaccggtcg ccaccatggt gagcaagggc 900

gaggag 906

Claims (2)

1. A PIGR over-expression cell strain is characterized in that the cell strain is preserved in China center for type culture Collection (China) on the 6 th month 3 days of 2022, and the PIGR over-expression cell strain is a TiBC-PIGR brain cell line of tilapia multimeric immunoglobulin over-expression ⁺ The preservation number is CCTCC NO: C2022162.

2. the use of the PIGR overexpressing cell strain of claim 1 in any one or more of the following (1) - (4);

(1) Preparing tilapia lake virus vector or cell model;

(2) Screening and/or evaluating tilapia lake virus therapeutic drugs;

(3) Preparing tilapia lake virus diagnostic products;

(4) And (5) developing tilapia lake virus products.

Images