CN115160426A

CN115160426A - Cotton potassium ion channel protein GhKAT1 and coding gene and application thereof

Info

Publication number: CN115160426A
Application number: CN202210682365.1A
Authority: CN
Inventors: 田晓莉; 王倩倩; 李芳军; 李召虎
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2022-06-16
Filing date: 2022-06-16
Publication date: 2022-10-11

Abstract

The invention discloses cotton potassium channel protein GhKAT1, a coding gene and application thereof, wherein the protein provided by the invention is obtained from cotton (Gossypium hirsutum) and named as GhKAT1 protein, the invention also provides a gene for coding the GhKAT1 protein and named as GhKAT1 gene, and the invention also provides application of the GhKAT1 protein and the GhKAT1 gene. The invention has great value for researching the low potassium tolerance of plants and exploring the signal regulation and control network of the plants under the adverse circumstances.

Description

Cotton potassium ion channel protein GhKAT1, coding gene and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a cotton potassium ion channel protein GhKAT1, and a coding gene and application thereof.

Background

Potassium is one of three essential nutrients for plant growth and development, and is involved in many important physiological and biochemical processes in plant growth and development, such as regulating osmotic pressure, affecting cell expansion, maintaining cell charge balance, regulating the activity of various enzymes, participating in protein synthesis, etc.

Since the last 90 s, people have made systematic and intensive studies on the molecular genetic mechanism of plant potassium nutrition traits. Numerous potassium channels, potassium transporters, and related regulatory proteins in plants were cloned sequentially. Their roles in potassium affinity, selectivity and energy coupling are all different. Potassium transport and channel proteins can be classified into 3 families of potassium channels and 3 families of potassium transporters, depending on their structure and function. The method comprises the following steps: shaker potassium channel, TPK potassium channel, kir-like potassium channel and KUP/HAK/KT potassium transporter, TPK/HKT transporter, CPA cation proton antiporter.

Cotton is an important economic crop in China and plays an important role in national economy. However, along with the popularization of Bt gene-transferred insect-resistant cotton in cotton areas in the yellow river basin and the Yangtze river basin and unreasonable fertilizer and water operation, potassium deficiency of cotton in China is more and more serious, the cotton is a potassium-loving crop, the potassium deficiency causes the premature senility of the cotton more and more serious, and the yield and the quality of the cotton are seriously influenced. Solving the potassium deficiency problem of cotton is of great significance to the improvement of cotton yield and quality. With the continuous development of molecular biology, the cultivation of low-potassium-resistant cotton varieties becomes possible by using biotechnology means. Although certain achievements have been achieved in the current gene cloning work of cotton, the gene cloning work of cotton is far behind that of rice, corn, wheat and other grain crops.

Disclosure of Invention

In view of the above, the present invention aims to provide cotton potassium channel protein GhKAT1, and its coding gene and application.

The embodiment of the invention provides a protein, which is obtained from cotton (Gossypium hirsutum) and is named GhKAT1 protein, and the protein is (a) or (b) as follows:

(a) Is represented by SEQ ID NO:1, and the protein consists of an amino acid sequence shown in the specification;

(b) And SEQ ID NO:1 and having substitution and/or deletion and/or addition of one or more amino acid residues as compared to the amino acid sequence shown in SEQ ID NO:1, or a derivative thereof.

The embodiment of the invention also provides a gene for coding the GhKAT1 protein, which is named as the GhKAT1 gene.

In some embodiments, the nucleotide sequence of the GhKAT1 gene is as set forth in SEQ ID NO:2 or the sequence shown in SEQ ID NO:2 having a homology of 90% or more.

The embodiment of the invention also provides an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium containing the GhKAT1 gene.

The embodiment of the invention also provides a substance for inhibiting the expression of the GhKAT1 gene.

In some embodiments, the agent that inhibits expression of the GhKAT1 gene comprises an interference vector. The interfering vector may specifically be: inserting the sequence table SEQ ID NO:3 to obtain the recombinant plasmid. The substance for inhibiting the expression of the GhKAT1 gene also comprises pTRV RNA1 and Agrobacterium GV3101.

The embodiment of the invention also provides the application of any one of the following 1) to 4) in regulating the potassium absorption capacity of plants and/or regulating the growth of the plants,

1) GhKAT1 protein;

2) GhKAT1 gene;

3) An expression cassette, a recombinant vector, a transgenic cell line or a recombinant strain containing the GhKAT1 gene;

4) A substance which inhibits the expression of the GhKAT1 gene.

In some embodiments, the expression level and/or activity of the GhKAT1 protein or GhKAT1 gene in the plant is reduced, the potassium uptake capacity of the plant is reduced, and/or the dry matter accumulation capacity is reduced, and/or the chlorophyll content is reduced.

In some embodiments, the expression level and/or activity of the GhKAT1 protein or GhKAT1 gene in the plant is increased, the potassium uptake capacity of the plant is increased, and/or the dry matter accumulation capacity is increased, and/or the chlorophyll content is increased.

In some embodiments, the plant is a dicot. In some embodiments, the dicot is specifically cotton.

The embodiment of the invention also provides a method for cultivating transgenic plants, which is to introduce the GhKAT1 gene into a receptor plant to obtain the transgenic plants.

In some embodiments, the GhKAT1 gene is introduced into a recipient plant, and the expression vector carrying the GhKAT1 gene can be used to transform plant cells or tissues by using Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium-mediated transformation, etc., and the transformed plant tissues can be grown into plants. The GhKAT1 gene can be specifically introduced into the recipient plant by the recombinant vector. The recipient plant is a dicotyledonous plant. The dicotyledonous plant is cotton.

The embodiment of the invention also provides a method for cultivating the transgenic plant, which comprises the following steps: silencing the GhKAT1 gene in a recipient plant to obtain a silenced plant having a potassium uptake capacity and/or a dry matter accumulation capacity and/or a chlorophyll content lower than that of said recipient plant.

In some embodiments, silencing the GhKAT1 gene in the recipient plant is achieved by introducing into the recipient plant an agent that inhibits expression of the GhKAT1 gene.

In some embodiments, silencing the GhKAT1 gene in the recipient plant can be specifically accomplished with the VIGS system.

In some embodiments, silencing the GhKAT1 gene in the recipient plant is specifically achieved by injecting an infestation solution into the leaves of the recipient plant. The infection solution is a bacterial solution with the following two recombinant agrobacteria: recombinant Agrobacterium obtained by introducing the interference vector into Agrobacterium GV3101 and recombinant Agrobacterium obtained by introducing pTRV-RNA1 into Agrobacterium GV3101.

In some embodiments, the interference vector may be specifically pTRV2 vector with the restriction enzyme sites KpnI and SmaI inserted between the restriction enzyme sites of SEQ ID NO:3, and the recombinant vector is obtained.

In some embodiments, the recipient plant is a dicot. The dicotyledonous plant is cotton.

The invention discloses a novel protein (GhKAT 1 protein) and a novel gene (GhKAT 1 gene), and proves that the plant potassium absorption capacity can be obviously reduced after the GhKAT1 gene is silenced in plants. The invention has great value for researching the low potassium tolerance of plants and exploring the signal regulation and control network of the plants under the adverse circumstances.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows the subcellular localization of cotton GhKAT1.

FIG. 2 shows the result of tissue-specific expression analysis of cotton GhKAT1 gene.

FIG. 3 shows the results of the expression level changes of cotton GhKAT1 genome under low potassium stress.

FIG. 4 is a photograph showing the results of the silencing efficiency test of VIGS-GhKAT1 plants and the low potassium stress phenotype.

FIG. 5 shows the results of physiological indicators of VIGS-GhKAT1 plants

FIG. 6 shows K in VIGS plant ⁺ Measurement of absorption Rate

FIG. 7 shows the expression results of GhKAT1 in potassium deficient yeast.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

(b) And SEQ ID NO:1 and a sequence represented by SEQ ID NO:1 derived protein.

1) GhKAT1 protein;

2) GhKAT1 gene;

4) A substance which inhibits the expression of the GhKAT1 gene.

In some embodiments, modulating plant growth may be modulating plant dry weight (dry matter accumulating capacity);

in some embodiments, modulating plant growth may be modulating the green color (chlorophyll content) of plant leaves.

In some embodiments, the expression level and/or activity of the GhKAT1 protein or GhKAT1 gene in a plant is reduced, the potassium uptake capacity of the plant is reduced, and/or the dry matter accumulation capacity is reduced, and/or the chlorophyll content is reduced.

In some embodiments, the expression level and/or activity of the GhKAT1 protein or GhKAT1 gene in a plant is increased, the potassium uptake capacity of the plant is increased, and/or the dry matter accumulation capacity is increased, and/or the chlorophyll content is increased.

In some embodiments, the plant is a dicot.

In some embodiments, the dicot is specifically cotton.

In one embodiment, the cotton may be specifically cotton variety "R15".

In some embodiments, the GhKAT1 gene is introduced into a recipient plant, and the expression vector carrying the GhKAT1 gene can be used to transform plant cells or tissues by using Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, agrobacterium-mediated transformation, etc., and the transformed plant tissues can be grown into plants. The GhKAT1 gene can be specifically introduced into the recipient plant by the recombinant vector. The recipient plant is a dicot. The dicot is specifically cotton, which in one embodiment may be specifically cotton variety "R15".

The embodiment of the invention also provides a method for cultivating the transgenic plant, which comprises the following steps: silencing the GhKAT1 gene in a recipient plant to obtain a silenced plant with lower potassium absorption capacity and/or dry matter accumulation capacity and/or chlorophyll content than the recipient plant.

It can be understood that the embodiment of the invention provides a method for cultivating a gene silencing plant, which can silence GhKAT1 gene in a receptor plant, and can obtain a silencing plant with lower potassium absorption capacity than the receptor plant.

It is understood that the embodiments of the present invention provide a method for breeding gene-silenced plants, wherein the silencing of GhKAT1 gene in a recipient plant can result in silenced plants with lower dry matter accumulation capacity than the recipient plant.

It is understood that the embodiments of the present invention provide a method for breeding gene-silenced plants, which silence GhKAT1 gene in a recipient plant and can obtain silenced plants with chlorophyll content lower than that of the recipient plant.

In some embodiments, silencing the GhKAT1 gene in the recipient plant can be specifically accomplished by means of the VIGS system.

In some embodiments, silencing the GhKAT1 gene in the recipient plant is specifically achieved by injecting an infestation solution into the leaves of the recipient plant. The infection solution is a bacterial solution with the following two recombinant agrobacteria: a recombinant Agrobacterium obtained by introducing the interference vector into Agrobacterium GV3101 and a recombinant Agrobacterium obtained by introducing pTRV-RNA1 into Agrobacterium GV3101.

In some embodiments, the interference vector may be specifically pTRV2 vector with the sequence shown in SEQ ID NO:3, and the recombinant vector is obtained.

In some embodiments, the recipient plant is a dicot.

In some embodiments, the dicot is specifically cotton.

In some embodiments, the cotton may specifically be cotton variety "R15".

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.

The pTRV2 vector is described in literature 2, i.e., in literature, pYL156 (pTRV RNA 2).

pTRV GFP is described in reference 1.

pTRV ghcia 1 is described in document 2.

pTRV RNA1 is described in document 1.

Document 1: huang, Y., yin, C., liu, J.et al.A three CrRLK1L LLG1 complete genetic models SUMM2 dimensioned Autoimmiture.Nat Commun 11,4859 (2020).

https://doi.org/10.1038/s41467020 18600 8。

Document 2: yiru Wang, ye Wang, bo Li, changming Xiong, A egr Eneji, mingcai Zhang, fangjun Li, xiaooli Tian, ZHaohu Li, the Cotton High Affinity K ⁺ Transporter,GhHAK5a,Is Essential for Shoot Regulation of K ⁺ Uptake in Root under Potassium Deficiency,Plant and Cell Physiology,Volume 60,Issue 4,April 2019,Pages888–899,https://doi.org/10.1093/pcp/pcz003。

Improved Hoagland's nutrient solution: containing 2.5mM KNO ₃ 、5mM Ca(NO ₃ ) ₂ 、2mM MgSO ₄ 、1mM(NH ₄ )H ₂ PO ₄ 、0.2mM Fe Na EDTA、0.4μM CuSO ₄ 、2μM ZnSO ₄ 、40μM H ₃ BO ₃ 、10pM(NH ₄ ) ₆ Mo ₇ O ₂₄ 、2μMMnSO ₄ And the balance being water.

Potassium-free nutrient solution: not containing KNO ₃ Other Hoagland's nutrient solution with the same improvement.

VIGS solution: containing 10mM MES, 200. Mu.M acetosyringone and 10mM MgCl ₂ And the balance being water.

Example 1 cloning and localization of GhKAT1 protein and its coding Gene

1. Cloning of GhKAT1 Gene

A new protein is obtained from cotton variety R15 and named as GhKAT1 protein.

Designing two specific primers, which are respectively as follows: an upstream primer: atgtagccttgattc and downstream primers: GGTCGCATTGAACCTACATT. The RNA of cotton leaves is extracted by using an Edley RNA kit, a first strand cDNA is synthesized by using an M-MLV reverse transcription kit, and the obtained first strand cDNA is used for amplifying the full length of a GhKAT1 gene. The 20. Mu.L PCR reaction system included: template 10Xbuffer 2. Mu.L, 10mmol/L dNTPs 2. Mu.L, mgSO 4.4. Mu.L, cDNA1.2. Mu.L, KOD-Plus enzyme 0.4. Mu.L, upstream primer 0.3. Mu.L, downstream primer 0.3. Mu.L, ddH2O 12.4. Mu.L. The PCR amplification procedure was: 94 ℃ for 2min; 15s at 94 ℃,30 s at 50 ℃ and 3min at 68 ℃ for 30 cycles; 10min at 68 ℃. The PCR products were electrophoresed on a 1% agarose gel. After completion of the electrophoresis, the objective band was excised under an ultraviolet lamp, and purified by an agarose gel DNA recovery kit (purchased from Tiangen Biochemical technology Co., ltd.), according to the instructions of the kit. The end of the recovered fragment needs to be added with A, and the 10. Mu.L reaction system is: 10xBuffer 1. Mu.L, dATP 1. Mu.L, taq enzyme 0.5. Mu.L, and the recovered fragment 7.5. Mu.L were reacted at 72 ℃ for half an hour. The recovered fragment after adding A was ligated with PMD18-T vector (purchased from TaKaRa Co., ltd.) according to the instructions of TaKaRa Co., PCR tubes were sequentially added with: adding A into the fragment 4.5. Mu.L, PMD 18-T0.5. Mu.L and Solution I5. Mu.L, wherein the total volume is 10. Mu.L; ligation was carried out overnight at 16 ℃. mu.L of the ligation product was taken, transformed into E.coli DH 5. Alpha. By heat shock method (see J. SammBruk, et al, huang Petang et al, molecular cloning: A third edition, scientific Press, 2002 edition), positive clones were selected on LB solid plate containing 50mg/L of ampicillin, and 5 clones were selected for sequencing (sequencing was done by Shanghai Invitrogen) to obtain the desired full-length gene cDNA. Sequencing results show that the gene sequence has the full length of 2292bp and codes a complete ORF reading frame of 763 amino acids.

The amino acid sequence of the GhKAT1 protein is shown as SEQ ID NO:1 (763 aa). The gene coding the GhKAT1 protein is named as GhKAT1 gene, and the sequence is shown as SEQ ID NO:2, respectively.

2. Subcellular localization of GhKAT1 protein

Extracting the total RNA of the root system of the R15, performing reverse transcription to obtain cDNA, and performing PCR amplification by taking F2 and R2 as primers;

F2：TCTCCCCTTGCTCCGTGGATCCATGTGTAGCCTTGAGTATTC；

R2:CCTCGCCCTTGCTCACAGGCCT GGTCGCATTGAAACCTACA；

and carrying out double digestion on the obtained PCR amplification product by using restriction enzymes BamHI and StuI, simultaneously carrying out double digestion on the pHBT-GFP vector by using restriction enzymes BamHI and StuI, recovering the product, carrying out homologous recombination, constructing the cDNA sequence of GhKAT1 on the pHBT-GFP expression vector, and carrying out transient transformation in cotton leaf protoplasts. Microscopic observation shows that GhKAT1 is co-localized with membrane localization marker (FIG. 1), indicating that GhKAT1 protein is a cell membrane localized protein.

3. Tissue-specific expression of the GhKAT1 Gene

The expression site of the GhKAT1 gene in the cotton variety R15 is analyzed by fluorescent real-time quantitative PCR: the instrument for fluorescent real-time quantitative PCR is ABI 7500Fast (Applied Biosystem), the primer pair is F3: GCCACACAGCATACACAGTTAGTTAGG and R3: TCATTGTTCCTTCTCTCCGGG, the sample for detecting tissue specificity expression is cDNA obtained by reverse transcription of total RNA of each part of cotton in three-leaf stage under normal nutrition level, PCR program: denaturation at 94 ℃ for 30s; denaturation at 94 ℃ for 5s, annealing at 60 ℃ for 35s, and 40 cycles; relative expression amount of 2 ^-ΔΔCt The method calculates that the relative expression level of GhKAT1 gene at each part of cotton in the three-leaf stage under normal nutrition level is shown in figure 2 by taking cotton Actin9 gene as a reference (primer pairs for identifying cotton Actin9 gene are 5'-GCCTTGGACTATG ang AGCAGGA-3' and 5-.

Using R15 as test material, performing 0mM K during three-leaf stage of seedling ⁺ The low potassium stress treatment is carried out, and RT-qPCR is used for detecting the change of GhKAT1 expression level in roots, stems and leaves. The results are shown in FIG. 3, where CK in FIG. 3 is normal potassium supply (2.5 mM K) ⁺ ) Culture, LK low potassium stress (0 mM K) ⁺ ) And the transcription level of GhKAT1 in the root system is quickly up-regulated under the induction of low potassium stress. The expression level of GhKAT1 in leaves and stems is induced to some extentIt is clear that GhKAT1 plays a certain role in coping with low potassium stress.

Example 2 VIGS silencing plant phenotype

1. Construction of VIGS-GhKAT1 silencing vector

1. Total RNA from leaves of cotton variety "R15" was extracted and reverse transcribed into cDNA.

2. And (2) performing PCR amplification by using the cDNA obtained in the step (1) as a template and using a primer pair consisting of F4 and R4 to obtain a PCR amplification product.

F4：CGGGGTACCGTGGAACTTCACTGATGAAC

R4：TCCCCCGGGAACACTTTTGGTGTCCTTCC

3. And (3) carrying out double digestion on the PCR amplification product obtained in the step 2 by using restriction enzymes KpnI and XbaI, and recovering a digestion product.

4. The pTRV2 vector was digested with restriction enzymes KpnI and XbaI, and the vector backbone was recovered.

5. And (4) connecting the enzyme digestion product in the step (3) with the vector framework in the step (4) to obtain a recombinant plasmid pTRV2-GhKAT1. According to the sequencing result, the structure of the recombinant plasmid pTRV2-GhKAT1 is described as follows: double-stranded DNA molecules shown in sequence 3 of the sequence table are inserted between Kpn I and XhoI enzyme cutting sites of the pTRV2 vector.

2. Obtaining of VIGS-GhKAT1 silencing plant

1. The recombinant plasmid pTRV2-GhKAT1 is introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. Then, the recombinant agrobacterium was suspended with VIGS solution to obtain a bacterial solution with OD600nm = 1.5.

2. The pTRV1-RNA1 vector is introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. Then, the recombinant agrobacterium was suspended in VIGS solution to obtain a bacterial solution with OD600nm = 1.5.

3. And (3) mixing the bacterial liquid obtained in the step (1) and the bacterial liquid obtained in the step (2) in equal volume to obtain a mixed liquid A.

4. pTRV2-GhCLA1 and pTRV2-GFP are respectively introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium. Then, the recombinant agrobacterium was suspended in VIGS solution, and a bacterial solution with OD600nm =1.5 was obtained.

5. And (3) mixing the pTRV2-GhCLA1 and pTRV2-GFP bacterial liquid obtained in the step (4) and the bacterial liquid obtained in the step (2) in equal volume to obtain a mixed liquid B and C respectively.

6. Group injection

Test groups: the R15 plants at cotyledon stage were manipulated: mixed liquor a was injected to the lower surface of the cotyledon (two cotyledons were injected for each plant until the cotyledon was filled).

Positive control group: the R15 plants at cotyledon stage were manipulated: and injecting mixed liquor B on the lower surface of the cotyledon (each plant injects two cotyledons till the cotyledons are filled).

Negative control group: the R15 plants at cotyledon stage were manipulated: the mixture C was injected under the cotyledon (two cotyledons were injected per plant until they were filled).

Each group of plants was hydroponically cultivated in Hoagland's nutrient solution, and replaced with fresh nutrient solution every week.

3. Phenotype of VIGS-GhKAT1 silenced plants

Obtaining a cotton plant silencing the GhKAT1 gene according to the method, injecting a 14 th contrast plant injected with pTRV2-GhCLA1 bacterial liquid to generate a albino phenotype, and detecting the gene silencing efficiency of the silencing plant. Subjecting the VIGS-GhKAT1 silenced plant and the control VIGS-GFP to normal nutrient solution (CK, 2.5mM K) ⁺ ) And low potassium nutrient solution (LK, 0mM K) ⁺ ) After 24 days of culture, the phenotype was observed and the dry weight, chlorophyll content, plant height were examined.

Detection method of dry weight: 80 deg.C (oven dried to constant weight), and weighed. The dry weight of Leaf (Leaf)/Stem (Stem)/Root (Root) was measured. Samples of 12 plants were taken from each group of plants under each treatment and the results averaged.

The method for detecting the chlorophyll content comprises the following steps: SPAD502 chlorophyll apparatus, samples of 12 plants were taken from each group of plants under each treatment and the results averaged.

The plant height detection method comprises the following steps: ruler measurements were taken, samples of 12 plants were taken per group of plants under each treatment, and the results were averaged.

FIG. 4 is a photograph of the phenotype of plant leaves. Under low potassium conditions, leaf yellowing is more severe in the test plants than in the negative control plants.

The results of dry weight, chlorophyll content and plant height are shown in FIG. 5. Under the condition of low potassium, the dry weight and chlorophyll content of the leaves of the test group plants are lower than those of the negative control group plants.

The results show that the plants in the test group (namely GhKAT1 gene silencing plants) are more sensitive to low potassium.

4. Root system potassium ion absorption rate of VIGS-GhKAT1 silent plant

After obtaining VIGS-GhKAT1 silent plant, growing to three leaves under the culture condition of sufficient potassium supply, one part continues to supply potassium normally (CK, 2.5mM K) ⁺ ) Culture, another part at low potassium stress (LK, 0mM K) ⁺ ) Culturing for 8d under the condition of (1). Selecting plants with the sizes which are not different from each other for K ⁺ Determination of the absorption rate (FIG. 6). All the VIGS plants are subjected to K ⁺ After 2d of starvation, the initial K was replaced ⁺ The concentration of the depleted solution was 0.01mM, and K in the depleted solution was measured at 10h of depletion ⁺ Content, converted to K per fresh weight per time unit ⁺ The rate of absorption.

GhKAT1 silencing cotton seedlings, K thereof ⁺ The absorption capacity is significantly reduced.

Example 3 expression of GhKAT1 in Potassium deficient Yeast

1. Construction of Yeast expression vector p416-GhKAT1

And (3) carrying out PCR amplification by using the cDNA obtained in the step (1) as a template and using a primer pair consisting of F5 and R5 to obtain a PCR amplification product.

F4：CTTAGTTTCGACGGATTCTAGAATGTGTAGCCTTGAGTATTC

R4：ATATCGAATTCCTGCAGCCCGGGGGTCGCATTGAAACCTACA

2. And (3) double enzyme digestion of the PCR amplification product obtained in the step 2 by using restriction enzymes XbaI and SmaI, and recovery of the enzyme digestion product.

3. The p416 vector is double digested by restriction enzymes XbaI and SmaI, and the vector skeleton is recovered.

4. And (4) connecting the enzyme digestion product in the step (3) with the vector skeleton in the step (4) to obtain the recombinant plasmid p416-GhKAT1.

2. Yeast transformed by yeast expression vector p416-GhKAT1

1. The activated yeast strain R5421 is streaked on YPDA solid medium and cultured in a constant temperature incubator at 30 ℃ for 48h.

2. Selecting the single clone, adding 5mL YPDA liquid medium, placing in a shaking table at 30 ℃ for shake culture at the rotation speed of 200rpm until the OD600 is 1.6-1.8.

3. Inoculating the mixed bacteria liquid in new YPDA culture medium at a ratio of 1.

4. Centrifuging at1,000g for 1min to collect bacterial liquid, pouring off the supernatant, and adding 1.5mL of sterilized double distilled water to wash the thalli;

5. centrifuging at1,000g for 1min to collect bacterial liquid, pouring off the supernatant, and adding 1.5mL of 1 × TE/LiA to wash the thallus;

6. centrifuging at1,000g for 1min, collecting bacterial liquid, pouring off supernatant, and adding 100 mu L of 1 × TE/LiA heavy suspension bacteria;

7. sequentially adding 50 mu L of yeast liquid, 1 mu g of plasmid DNA and 2 mu L of Carrier DNA (2 mu g/mu L; preheating at 100 ℃ for 2-3min, taking out and putting on ice) into a sterile 1.5mL Ep tube, and uniformly mixing;

8. adding 300 μ L of 40% PEG/LiAc, mixing, and shake culturing at 30 deg.C for 30min at 150-200rpm

9. Adding 40 μ L dimethyl sulfoxide into Ep tube, mixing, placing on metal bath, heating at 42 deg.C for 15min, and cooling on ice for 2min;

10. centrifuging at1,000g for 1min, discarding the supernatant, adding 100 μ L of 1 × TE resuspended liquid, spreading on SD-Ura culture medium, and culturing in 30 deg.C constant temperature incubator for 2-3d until the diameter of bacterial plaque is greater than 2mm.

3. Positive yeast clone gradient dilution spot

1. Marking and activating transformants of different plasmids, R757 (positive control) and R5421 (negative control) on a YPDA solid culture medium, and culturing in a constant temperature incubator at 30 ℃ for 48h;

2. selecting a monoclonal, adding 5mL YPDA liquid medium, placing in a shaking table at 30 ℃ for shake culture at the rotating speed of 200rpm;

3. centrifuging at1,000g for 1min, collecting bacterial liquid, pouring off supernatant, and washing thallus with sterile double distilled water;

4. centrifuging at1,000g for 1min, collecting bacterial liquid, pouring off supernatant, and repeatedly adding sterile double distilled water to wash thalli twice;

5. centrifuging at1,000g for 1min to collect bacterial liquid, pouring off the supernatant, and adding 100 μ L sterile double distilled water to resuspend the thallus;

6. adding a proper amount of resuspended yeast liquid into a new sterile Ep tube, and adjusting the OD600 to about 0.8 by using sterile double distilled water;

7. sequentially diluting the yeast liquid with the adjusted OD600 by 10 times in a gradient manner, namely diluting the yeast liquid by 10 times, 100 times and 1000 times;

8. and (3) sucking 5 mu L of each yeast liquid and the bacteria liquid diluted in a gradient manner, respectively dripping the yeast liquid and the bacteria liquid on the AP solid culture medium, blow-drying the flat plate in a super clean bench, placing the flat plate in a constant-temperature incubator at 30 ℃ for 2d, and photographing and recording.

FIG. 7 is a photograph showing the expression of GhKAT1 in potassium-deficient yeast. Under low potassium conditions, the test group yeast can grow normally compared with the negative control group (R5421, R5421+ Vector) yeast, thereby proving that GhKAT1 has a potassium absorption function.

In the present disclosure, the terms "one embodiment," "some embodiments," "an example," "a specific example," or "some examples" and the like mean that a specific feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Moreover, various embodiments or examples and features of various embodiments or examples described in this specification can be combined and combined by one skilled in the art without being mutually inconsistent.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Sequence listing

<120> cotton potassium ion channel protein GhKAT1, coding gene and application thereof

<130> C1224918

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 763

<212> PRT

<213> Cotton (Gossypium hirsutum)

<400> 1

Met Cys Ser Leu Glu Tyr Ser Asn Asn Ser Met Ser Phe Ser Cys Thr

1 5 10 15

Lys Asn Phe Phe Gln Arg Phe Cys Asn Asp Glu Phe Gln Met Gly Ser

20 25 30

Asp Ile His Gly Asn Phe Phe Ser Ser Asp Leu Leu Pro Ser Leu Gly

35 40 45

Ala Arg Ile Asn Gln Thr Thr Lys Leu Arg Arg Tyr Ile Ile Ser Pro

50 55 60

Phe Asn Pro Tyr Tyr Arg Ala Trp Glu Met Trp Leu Val Val Leu Val

65 70 75 80

Ile Tyr Ser Ala Trp Ile Cys Pro Phe Glu Phe Ala Phe Leu Thr Tyr

85 90 95

Glu Lys Asp Gly Leu Phe Ile Phe Asp Asn Ile Val Asn Gly Phe Phe

100 105 110

Ala Val Asp Ile Val Leu Thr Phe Phe Val Ala Tyr Leu Asp Ser His

115 120 125

Ser Tyr Leu Leu Val Asp Asp Pro Lys Lys Ile Ala Ile Arg Tyr Ile

130 135 140

Ser Thr Trp Phe Ala Phe Asp Val Cys Ser Thr Ala Pro Phe Gln Ser

145 150 155 160

Leu Ser Leu Leu Phe Thr Asn His Gly Ser Glu Leu Trp Leu Arg Leu

165 170 175

Leu Asn Met Leu Arg Leu Trp Arg Leu Arg Arg Val Ser Ser Leu Phe

180 185 190

Ala Arg Leu Glu Lys Asp Ile Arg Phe Asn Tyr Phe Trp Thr Arg Cys

195 200 205

Thr Lys Leu Ile Ser Val Thr Leu Phe Thr Val His Cys Ala Gly Cys

210 215 220

Phe Asn Tyr Leu Ile Ala Glu Arg Tyr Pro Asp Pro Ser Lys Thr Trp

225 230 235 240

Ile Gly Ala Val Tyr Pro Asn Phe Lys Glu Gln Ser Leu Trp Asp Arg

245 250 255

Tyr Ile Thr Ser Ile Tyr Trp Ser Ile Thr Thr Leu Thr Thr Thr Gly

260 265 270

Tyr Gly Asp Leu His Ala Glu Asn Pro Arg Glu Met Leu Phe Asp Ile

275 280 285

Phe Tyr Met Leu Phe Asn Leu Gly Leu Thr Ala Tyr Leu Ile Gly Asn

290 295 300

Met Thr Asn Leu Val Val His Trp Thr Ser Arg Thr Arg Asn Phe Arg

305 310 315 320

Asp Thr Ile Arg Ala Ala Ser Glu Phe Ala Thr Arg Asn Gln Leu Pro

325 330 335

Pro Arg Ile Gln Asp Gln Met Leu Ser His Ile Cys Leu Arg Phe Lys

340 345 350

Thr Glu Gly Leu Lys Gln Gln Glu Thr Leu Asn Ser Leu Pro Lys Ala

355 360 365

Ile Arg Ser Ser Ile Ala Gln His Leu Phe Phe His Ile Val Gln Lys

370 375 380

Val Tyr Leu Phe Gln Gly Val Ser His Asp Phe Leu Phe Gln Leu Val

385 390 395 400

Ser Glu Met Asp Ala Glu Tyr Phe Pro Pro Lys Glu Asp Val Ile Leu

405 410 415

Gln Tyr Glu Ala Pro Thr Asp Leu Tyr Ile Leu Val Ser Gly Ala Ala

420 425 430

Asn Leu Ile Ser His Ala Asp Gly His Asp Gln Val Met Gly Lys Val

435 440 445

Ala Ala Gly Asp Met Phe Gly Glu Val Gly Val Leu Cys Tyr Arg Pro

450 455 460

Gln Pro Tyr Thr Val Arg Thr Lys Glu Leu Cys Gln Ile Leu Arg Leu

465 470 475 480

Ser Gly Thr Ser Leu Met Asn Ser Ile Gln Val Asn Met Glu Asp Gly

485 490 495

Arg Val Ile Met His Asn Leu Tyr Met Lys Leu Asn Gly Leu Glu Ser

500 505 510

Ser Ser Phe Asp Gln Pro Glu Glu Gly Thr Met Arg Gly Ser Cys Ser

515 520 525

Glu Thr Gly Phe Glu Asp Gln Pro Gln Arg Tyr Ala Ser Lys Lys Glu

530 535 540

Ala Thr Asp Ile Gly Phe Leu Gly Ser Glu Ala Ile Glu Lys Ser Gln

545 550 555 560

Thr Ser Arg Ile Thr Asp Asn Gly Ile Pro Thr Ala Glu Asp Gly Gln

565 570 575

Thr Ala Leu His Asp Ala Val Arg Lys Gly His Ile Glu Met Val Lys

580 585 590

Ile Leu Leu Glu Gly Gly Ala Ser Val Asn Lys Leu Asp Ala Arg Gly

595 600 605

Arg Thr Pro Lys Val Leu Ala Glu Gln Gln Gly Asn Lys Ser Ile Tyr

610 615 620

Glu Leu Leu Leu Ser Tyr Glu Asn Lys Arg Lys Lys Asp Glu His Met

625 630 635 640

Ile Glu Ile Ile Glu Pro Glu Ile Ala Asp Asp Pro Lys Asn Asn Gln

645 650 655

Ser Lys His Arg Ser Gly Ala Gln Asn Phe Phe Asn Ser Arg Asn Tyr

660 665 670

Arg Glu Val Thr Ile Pro Thr Lys Lys Arg Val Thr Ile His Met Gln

675 680 685

Phe Gln Ser Ser Ser Thr Ser Ser Arg Gln Leu Gly Lys Leu Ile Leu

690 695 700

Leu Pro Asp Ser Ile Gln Glu Leu Leu Arg Val Ala Gly Glu Lys Phe

705 710 715 720

Gly Cys Tyr Thr Phe Thr Lys Val Leu Asn Ser Gln Asn Ala Glu Ile

725 730 735

Asp Asp Ile His Val Ile Arg Asp Gly Asp His Leu Tyr Leu Leu Gln

740 745 750

Asp Glu Asp Glu Asn Val Gly Phe Asn Ala Thr

755 760

<210> 2

<211> 2292

<212> DNA

<213> Cotton (Gossypium hirsutum)

<400> 2

atgtgtagcc ttgagtattc aaacaactcg atgtcatttt cctgtaccaa aaacttcttc 60

cagcggtttt gtaatgatga atttcaaatg ggaagtgata ttcatggcaa tttcttctca 120

agtgatctcc ttccttcact tggggccaga attaaccaaa cgacgaagct acgtagatac 180

atcatttctc ctttcaaccc ttactacagg gcatgggaga tgtggctggt tgttctagtc 240

atttactctg cctggatctg tccattcgag ttcgcattcc tgacttatga gaaagatgga 300

cttttcattt ttgacaacat tgtcaatggc ttctttgctg ttgacatcgt tctcaccttc 360

tttgttgcat acctcgatag ccactcttac ctccttgttg atgatcccaa gaagattgca 420

atcaggtaca tatctacctg gtttgctttc gatgtctgtt ccactgcccc atttcagtct 480

ctcagcctct tgttcaccaa ccatggtagt gagctctggc ttaggctact caacatgctc 540

agactctggc gtctgagacg agtcagctcc ctttttgcaa gacttgagaa agacatacgc 600

ttcaactact tctggactcg gtgcaccaag ctcatttctg tgaccctgtt tacagtacat 660

tgtgcgggat gttttaacta tttgattgca gaaagatacc ctgatccttc gaaaacctgg 720

attggtgctg tctacccgaa tttcaaagag cagagtctct gggacagata tataacttca 780

atttactggt ccattacaac gcttactaca actggttatg gggacttgca tgctgagaat 840

ccaagagaga tgctatttga tatcttttac atgctgttta atttgggatt aacagcttac 900

ctcattggga acatgacaaa cctcgtagtt cactggacaa gccggacccg taattttagg 960

gatacaatta gagctgcttc ggaatttgcg acacgcaatc agttaccccc ccgcatacaa 1020

gatcaaatgt tgtcacacat atgcttgcga ttcaaaacag aaggattgaa acaacaagag 1080

accctaaata gtttgccaaa agccatccgc tcaagcattg cacagcatct cttcttccac 1140

attgtgcaga aagtctacct cttccaagga gtttctcatg acttcttgtt tcagttggtt 1200

tcagaaatgg atgctgagta tttcccaccc aaagaagatg tcattctgca gtatgaagcc 1260

ccaacagatc tttatatact tgtctcggga gcagcaaact tgatctccca tgctgatggg 1320

catgatcagg ttatgggaaa ggtagcagct ggggatatgt ttggagaggt tggagttcta 1380

tgttataggc cacagccata cacagttagg accaaagagc tttgtcaaat actacgactg 1440

agtggaactt cactgatgaa cagcatacaa gtaaatatgg aagatggacg tgttattatg 1500

cataatcttt acatgaaatt gaatgggcta gagagcagca gctttgacca gcccgaggaa 1560

ggaacaatga gaggaagttg ttcagaaact ggatttgaag atcaaccaca gagatatgca 1620

tcaaagaaag aagcaacaga cataggtttc ttgggatcag aggctataga gaagagtcaa 1680

acaagtagaa ttacagataa tggaattcca acagctgagg atggccaaac agctctccat 1740

gatgctgttc gcaaggggca cattgaaatg gttaagattt tgctcgaagg aggagcaagt 1800

gtaaataagc tagatgcaag aggaaggaca ccaaaagtgt tggcagagca acagggaaac 1860

aagagcatat atgagctctt acttagttat gaaaacaaaa gaaagaaaga tgaacatatg 1920

atagagatta tagagccaga aatagcagat gaccccaaga ataatcaaag caaacataga 1980

agcggggccc aaaatttctt caactcgcgc aattatagag aggtaacaat accgaccaag 2040

aaaagagtta caattcacat gcagttccag agcagcagta catcaagtag acaacttgga 2100

aagttgatac tcctacctga ttcaatacaa gagttgctca gagtggctgg tgaaaagttt 2160

ggatgctaca catttacaaa agttcttaat tctcagaatg ctgaaataga tgatatacat 2220

gtcattcgag atggcgatca tctgtatctc cttcaagatg aagatgaaaa tgtaggtttc 2280

aatgcgacct ga 2292

<210> 3

<211> 400

<212> DNA

<213> Cotton (Gossypium hirsutum)

<400> 3

gtggaacttc actgatgaac agcatacaag taaatatgga agatggacgt gttattatgc 60

ataatcttta catgaaattg aatgggctag agagcagcag ctttgaccag cccgaggaag 120

gaacaatgag aggaagttgt tcagaaactg gatttgaaga tcaaccacag agatatgcat 180

caaagaaaga agcaacagac ataggtttct tgggatcaga ggctatagag aagagtcaaa 240

caagtagaat tacagataat ggaattccaa cagctgagga tggccaaaca gctctccatg 300

atgctgttcg caaggggcac attgaaatgg ttaagatttt gctcgaagga ggagcaagtg 360

taaataagct agatgcaaga ggaaggacac caaaagtgtt 400

Claims

1. A protein characterized by being (a) or (b) below:

(b) And SEQ ID NO:1, and a sequence represented by SEQ ID NO:1, or a derivative thereof.

2. A gene encoding the protein of claim 1.

3. The gene of claim 2, wherein the nucleotide sequence of the gene is as shown in SEQ ID NO:2 or a sequence shown in SEQ ID NO:2 having a homology of 90% or more.

4. An expression cassette, recombinant vector, transgenic cell line or recombinant bacterium comprising the gene of claim 2 or 3.

5. A substance which inhibits the expression of the gene according to claim 2 or 3.

6. The use of any one of 1) to 4) for modulating potassium uptake capacity in a plant and/or modulating plant growth,

1) The protein of claim 1;

2) The gene according to claim 2 or 3;

3) An expression cassette, recombinant vector, transgenic cell line or recombinant bacterium comprising the gene of claim 2 or 3;

4) A substance which inhibits the expression of the gene according to claim 2 or 3.

7. The use according to claim 6, characterized in that in the use,

a plant having a reduced potassium uptake capacity, a reduced dry matter accumulation capacity, and/or a reduced chlorophyll content, wherein the plant has a reduced expression level and/or activity of the protein of claim 1 or a gene encoding the protein;

the plant has an increased expression level and/or activity of the protein or the gene encoding the protein according to claim 1, an increased potassium uptake capacity, and/or an increased dry matter accumulation capacity, and/or an increased chlorophyll content.

8. Use according to claim 7, wherein said plant is a dicotyledonous plant, further wherein said plant is cotton.

9. A method of growing a transgenic plant, said method comprising: silencing a gene according to claim 2 or 3 in a recipient plant, resulting in a silenced plant having a lower potassium uptake capacity and/or dry matter accumulation capacity and/or chlorophyll content than said recipient plant, said recipient plant being a dicotyledonous plant, further said recipient plant being cotton.

10. A method of producing a transgenic plant according to claim 9, wherein the silencing of the gene of claim 2 or 3 in the recipient plant is effected by introducing into the recipient plant an agent that inhibits the expression of the gene of claim 2 or 3; the substance for inhibiting the expression of the GhKAT1 gene comprises an interference vector, wherein the interference vector is as follows: inserting a sequence shown in SEQ ID NO:3 to obtain the recombinant plasmid.