CN115141837A

CN115141837A - Novel SLC9A6 mutant gene and diagnostic reagent thereof

Info

Publication number: CN115141837A
Application number: CN202210769201.2A
Authority: CN
Inventors: 曾桥; 薛斌; 李婵艺
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2022-10-04
Anticipated expiration: 2042-06-30
Also published as: CN115141837B

Abstract

The invention provides a new SLC9A6 mutant gene and a diagnostic reagent thereof, belonging to the technical field of medical diagnosis. The invention firstly discovers that the mutation of SLC9A6: NM-001177651.2. The results of the present invention can be used genetic diagnosis of Christianson syndrome. Provides a new basis and approach for researching pathogenesis of the Christianson syndrome, provides a new theoretical basis for treating the Christianson syndrome, and can provide a possible drug target for treating the Christianson syndrome.

Description

Novel SLC9A6 mutant gene and diagnostic reagent thereof

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to a novel SLC9A6 mutant gene and a diagnostic reagent thereof.

Background

X-1-linked intellectual disability (XLID) is a congenital intellectual disability caused by mutation of genes located on the X chromosome, and the congenital intellectual disability involved accounts for about 15% of all congenital intellectual disabilities. XLIDs fall into two categories, depending on whether there are other physiological defects besides intellectual disability: S-XLID (syndrome forms) and NS-XLID (non-syndrome forms) which manifest themselves in metabolic aspects, neurological features or other physical signs in addition to intellectual disabilities, such as abnormalities or defects in the bones, craniofacial regions

According to the American Association on Mental Retardation (MR) definition of Mental Retardation, congenital Mental Retardation is a complex disease mainly caused by abnormal development of the central nervous system and possibly accompanied by symptoms such as metabolic disorders, and patients usually show significant defects in intelligence and behavior before the age of 18 years. According to statistics, the mental retardation patients account for 1% -3% of the total population, and the proportion of men and women is 1.4-1.6. To date, it has been found that loss of function of 102 genes leads to 81S-XLID syndromes and NS-XLID for more than 50 families, and that another 30S-XLID syndromes and 48 families carrying NS-XLID are associated with a specific region of the X chromosome. Factors causing congenital intellectual disturbance include change of gene copy number, deletion or insertion of small nucleotide fragments, dysfunction of regulatory elements, epigenetic change and the like, and 10% -15% of intellectual disturbance is related to X chromosome linkage.

The X-linked intellectual impairment of Christianson syndrome, characterized by microcephaly, impaired eye movement, severe gross developmental retardation, developmental reversal, dystonia, dyskinesia and various types of early onset epilepsy, results from mutations in the SLC9A6 (MIM 300231) gene. The epileptic seizures are all expressed by Lennox-Gastaut syndrome (LGS), and the LGS is a serious age-dependent Epileptic Encephalopathy (EE), and the onset peak is 3-5 years old and accounts for 1% -10% of children's epilepsy.

Christianson syndrome is an X-chromosome dominant hereditary disease. Typically, the gene on the male X chromosome is hemizygous and the SLC9A6 mutation can cause male morbidity; whether a female heterozygote carrier with SLC9A6 mutation has clinical manifestations depends not only on the expression status of the pathogenic gene, but also on whether the X chromosome is inactivated. Thus, some female heterozygotes have clinical manifestations, some are not, and some female carriers may be mildly affected.

The SLC9A6 gene is located on chromosome Xq26.3, comprises 16 exons and 15 introns, is 73.4kb in length, and codes for an intracellular sodium-hydrogen ion exchange pump 6 (NHE 6) with 649 amino acids, and the NHE6 is important for the formation of neuron dendrites and synapses. NHE6 is an endosomal transmembrane protein that regulates endosomal pH and endosomal translocation and signaling. It was found that deletion of NHE6 leads to lysosomal dysfunction and impairment of endosomal maturation and transport, and that targeted modulation of NHE6 also alters amyloid β (a β) levels. In addition, NHE6 expression levels are inversely related to tau protein deposition. SLC9A6 gene mutations can affect NHE6 function, leading to neurodevelopment and neurodegeneration, and ultimately leading to intellectual disability and epilepsy.

Therefore, gene mutation is an important genetic basis for the development of diseases, and gene diagnosis is an important genetic standard for accurate diagnosis of Christianson syndrome. Clinically, corresponding detection techniques need to be established for different mutations and used for determining the cause and disease diagnosis.

Disclosure of Invention

In view of this, the present invention aims to provide a novel SLC9A6 mutant gene and a diagnostic reagent thereof, which are capable of discovering a novel SLC9A6 mutation that may cause Christianson syndrome for the first time, and develop a corresponding diagnostic kit based on the new SLC9A6 mutant gene, thereby assisting screening and diagnosis of Christianson syndrome gene mutation, and providing a new technical support for drug screening, drug efficacy evaluation and targeted therapy thereof.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a novel mutant gene of Christianson syndrome, which comprises a mutation at SLC9A6: NM-001177651.2.

The c.169+2C > -T mutation refers to the mutation of the 2 nd position of the No.2 intron which is adjacent to the No.2 exon of the wild SLC9A6 gene from C to T to form a gene mutant, and the nucleotide sequence of the gene mutant is preferably shown as SEQ ID NO.6 (GATTTATGGTAAGTTCCT).

The invention also provides a detection reagent of Christianson syndrome triggered by the novel mutant gene, which comprises a specific amplification primer designed aiming at the mutant site of the novel mutant gene.

Preferably, the specific amplification primers comprise SLC9A6-F and SLC9A6-R, the nucleotide sequence of SLC9A6-F is shown in SEQ ID NO.1, and the nucleotide sequence of SLC9A6-R is shown in SEQ ID NO. 2.

The invention also provides a detection kit for Christianson syndrome, which comprises the detection reagent.

Preferably, the kit further comprises reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

Preferably, the sequencing primer comprises SLC9A6-SeqF and SLC9A6-SeqR, the nucleotide sequence of the SLC9A6-SeqF is shown as SEQ ID No.3, and the nucleotide sequence of the SLC9A6-SeqR is shown as SEQ ID No. 4.

The invention also provides application of the detection reagent or the detection kit in preparation of a diagnosis reagent for Christianson syndrome.

Preferably, the test sample of the diagnostic reagent comprises blood or amniotic fluid.

Has the advantages that: according to the invention, exon sequencing is utilized to screen pathogenic gene mutation highly related to Christianson syndrome, in order to avoid the occurrence of false positive result, and then Sanger sequencing is used for verification, so that the pathogenic gene mutation of the Christianson syndrome is finally obtained, wherein the pathogenic gene mutation is SLC9A6: NM-001177651.2. The patients with Christianson syndrome can be distinguished from normal people in the pathogenic gene mutation screened by the invention, so that the pathogenic gene mutation can be used as a biomarker for diagnosing Christianson syndrome. The invention can be used for screening or diagnosing genetic diagnosis of Christianson syndrome by detecting whether a subject carries the mutation so as to guide treatment. The diagnostic kit provided by the invention can be used for quickly and effectively predicting or diagnosing Christianson syndrome. The invention lays an important foundation for researching pathogenesis of Christianson syndrome and provides a brand new theoretical basis for treating Christianson syndrome patients. The invention can provide a possible drug target for treating Christianson syndrome.

Drawings

FIG. 1 shows a Christianson syndrome No.1 pedigree genetic map; where \9633lindicates a male normal individual, \9632lindicates a female carrier, \9632lindicates a male patient, \8599lindicates proble, _ o indicates a fetus;

FIG. 2 shows a graph of the results of the Sanger sequencing for the genotype at the SLC9A6: NM-001177651.2 +2C > -T locus of family 1, in which the proband is the patient (the arrow in the sequencing indicates the site of the mutation);

FIG. 3 shows a family genetic map of Christianson syndrome No. 2; wherein, the symbol indicates that male is normal, indicates that female carries person, \ 9632indicates male patient, \ 8599indicates probation;

FIG. 4 shows the results of the detection of SLC9A6: NM-001177651.2 for pedigree 2, in which proband is the patient (the arrow in the sequencing chart indicates the position of the mutation).

Detailed Description

The novel mutant gene disclosed by the invention is used for screening the pathogenic gene mutation highly related to Christianson syndrome by exon sequencing, and in order to avoid the occurrence of false positive results, the novel mutant gene is finally obtained by verifying through Sanger sequencing. In the invention, the DNA sequencing result of a sample to be detected is compared with the normal human genome DNA sequence, if the genotype of SLC9A6: NM-001177651.2; if the site has no mutation, the SLC9A6 gene is judged to be wild type, and the individual is a normal person.

The invention also provides a detection reagent for Christianson syndrome triggered by the novel mutant gene, which comprises a specific amplification primer designed aiming at the mutant site of the novel mutant gene.

The specific amplification primer of the invention preferably comprises:

SLC9A6-F(SEQ ID NO.1):CAACCTGCTCATCTTCATCC；

SLC9A6-R(SEQ ID NO.2):GCCCACTCGTTTTCCATC。

The detection kit of the invention preferably further comprises a reagent for PCR amplification reaction, and/or a reagent and a sequencing primer required in DNA sequencing. Wherein, the sequencing primer preferably comprises:

SLC9A6-SeqF (SEQ ID NO. 3): ATCCTGCTCACCTC and SLC9A6-SeqR (SEQ ID NO. 4): CCACTCGTTTTCCATCCTCA. The detection kit of the invention preferably further comprises other conventional reagents in PCR amplification reaction, such as dNTP, PCR buffer solution, magnesium ions, tap polymerase and the like.

The test sample of the diagnostic reagent of the present invention preferably includes blood or amniotic fluid. When the diagnostic reagent of the present invention is used to diagnose Christianson syndrome, the diagnostic reagent preferably comprises: 1) Extracting sample genome DNA;

2) Amplifying the sequence of the SLC9A6 gene;

3) DNA sequencing;

4) Comparing the DNA sequencing result of the sample to be detected with a normal human genome DNA sequence, and if the genotype of the SLC9A6: NM-001177651.2 exon 2; if the site has no mutation, the SLC9A6 gene is judged to be wild type, and the individual is a normal person.

The method for amplifying the SLC9A6 gene sequence is preferably a PCR amplification method, and the system is calculated by 20 mu L, and preferably comprises the following steps: 10 XPCR buffer 2.0. Mu.L, 10mmol/L dNTPs

0.4. Mu.L, 100 ng/. Mu.L SLC9A 6-F0.5. Mu.L, 100 ng/. Mu.L SLC9A 6-R0.5. Mu.L, 100 ng/. Mu.L peripheral blood extracted DNA 1.0. Mu.L, 5 u/. Mu.L Taq enzyme 0.2. Mu.L and the balance ddH ₂ And O. The system is placed in a PCR instrument, and the program is set as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 60 seconds, and 30 cycles; extension was carried out at 72 ℃ for 7 minutes. The method for sequencing the DNA is not particularly limited, and the DNA is preferably sequenced by using a conventional sequencing means in the field, such as sanger sequencing.

The SLC9A6 mutant gene and diagnostic reagent thereof provided by the present invention will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention. In the present invention, the term "diagnosis" includes prediction of the risk of a disease, diagnosis of the presence or absence of the disease, and evaluation of the prognosis of the disease; the term "mutation" refers to a change in the sequence of a wild-type polynucleotide to a variant, which may be naturally occurring or non-naturally occurring; "primer" refers to a polynucleotide fragment, typically an oligonucleotide, for amplifying a target nucleic acid in a PCR reaction, e.g., a polynucleotide fragment containing at least 5 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. In the present invention, the term "specifically amplifying" means that the primers are capable of amplifying a gene of interest by a PCR reaction without amplifying other genes. For example, specifically amplifying the SLC9A6 gene means that the primer amplifies only the SLC9A6 gene, but not the other genes, in a PCR reaction.

Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: cold Spring Harbor laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1 sample acquisition

The inventors have discovered a family of Christianson syndrome (SLC 9A6 family for short) and the clinical information of some members of the SLC9A6 family is shown in table 1. Figure 1 shows an SLC9A6 family atlas wherein, \ 9633indicating a male normal individual, \ indicating a female carrier, \9632indicatinga male patient, \8599indicatinga proband, _ o indicating a fetus.

1. Diagnostic criteria:

reference may be made to "human monogenic genetic diseases" version 2010 and "expert consensus on diagnosis strategy for mental retardation or overall developmental delay etiology" version 2018:

the clinical characteristics are as follows: microcephaly, impaired eyeball movement, severe gross developmental retardation, developmental regression, low muscle tone, abnormal movement, and various types of early onset epilepsy.

TABLE 1 clinical information of family members of Christianson syndrome

As shown in FIG. 1, I (first generation) and II (second generation) are used as the numbering.

The family members I1 (father), I2 (mother), II 1 (proband) peripheral blood and II 2 (fetus) amniotic fluid DNA are used for sequencing analysis.

Example 2 exon sequencing

1. The instrumentation is shown in table 2.

Table 2 Instrument and Equipment List

Name of instrument	Manufacturer of the product
		High throughput sequencer NextSeq500	Illumina
QubitFluorometer nucleic acid quantitative meter	Invitrogen
		PCR instrument	Bio-RAD
Centrifuge 5810R	Eppendorf
		Centrifuge 5424	Eppendorf
5418 Small high-speed centrifuge	Eppendorf
		Biological safety cabinet	Sujing medicine
Super clean bench	Sujing medicine
		Ice making machine	Grant
UPS power supply	Santa
		MilliQ ultrapure water instrument	Millipore
High performance computer (including server, cabinet, exchanger, storage, etc.)	DELL
		-25 degree refrigerator	Mitsubishi
Ultra-low temperature refrigerator	Eppendorf
		Microwave oven with a heat exchanger	Beauty treatment

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigdye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).

3. Reagent formulation

A stock solution of 5 XTBE electrophoresis solution was prepared as shown in Table 3.

TABLE 3 formulation of 5 XTBE electrophoretic solutions

Reagent	Volume/weight
		Tris	5.4g
Boric acid	750mg
		EDTA(pH8.0,0.5mol/L)	2mL
ddH ₂ O	90mL

By ddH ₂ O adjusted the final volume to 100mL.

Working solution of 0.5 XTBE electrophoresis solution, ddH ₂ Diluting with O10 times.

10 × erythrocyte lysates were prepared according to table 4.

TABLE 4 erythrocyte lysate recipe

Reagent	Volume/weight
		NH4Cl	82.9g
KHCO ₃	10g
		EDTA	0.37g
Add ddH ₂ O	To 1000mL

Autoclaving, and storing at 4 deg.C.

1 × cell nucleus lysate was prepared according to Table 5.

TABLE 5 cell nucleus lysate recipe

Reagent	Volume/weight
		2M Tris-HCl,pH8.2	0.5mL
4M NaCl	10mL
		2mM EDTA	0.4mL

4. Experimental procedure

After signing an informed consent, 3-5mL of peripheral blood and 5-10mL of II 2 (fetus) amniotic fluid of members in the family, such as I1 (father), I2 (mother), II 1 (proband) and the like, are collected.

4.1 sample DNA extraction

1) If the sample is heparin anticoagulated peripheral blood, 3-5mL of peripheral blood is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with 2-3 times volume is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent. Amniotic fluid specimens were directly subjected to the next step.

2) Centrifuge at 3000 rpm for 10 minutes at 4 ℃ and carefully remove the supernatant. The pellet was mixed with 1mL of 1 Xcell nucleus lysate, followed by addition of 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS, and the mixture was shaken until it became viscous and transparent. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion was carried out at 37 ℃ for more than 6 hours or overnight.

3) Adding equal volume of saturated phenol, shaking gently, mixing, and centrifuging at 3000 rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1 v/v), and centrifuged at 3000 rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.

6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out using a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring the OD value by ultraviolet.

7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.

4.2 exon sequencing

1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering a 150-250bp fragment;

2) Carrying out end repair on the DNA fragment and adding A at the 3' end;

3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing agarose gel electrophoresis on a small sample for quality control analysis;

5) NextSeq500 sequencer and data analysis.

4.3 results

Finally obtaining 1 gene mutation SLC9A6 with pathogenic significance, wherein NM-001177651.2 comprises c.169+2C >T; c.169+2C is located at the 2 nd base of the No.2 intron, and forms a shearing signal together with the 1 st base (c.169 + 1) of the intron and the last 2 bases (c.168, c.169) of the former No.2 exon, and the c.169+2C >T mutation breaks the sequence of the shearing site, so that the shearing signal is abnormal, and the mRNA shearing is abnormal. The genotype of the SLC9A6: NM-001177651.2; the genotype of SLC9A6: NM _ 001177651.2; the genotype is wild type without mutation in normal individuals of the SLC9A6 family.

Example 3Sanger sequencing validation

The SLC9A6: NM-001177651.2. The genotype detection of SLC9A6: NM-001177651.2 and the genotype of the site expon 2 c.169+2C >is carried out on family members I1, I2, II 1, II 2 and the like in example 1 and 100 normal persons outside the family members respectively.

The method comprises the following specific steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 2.

2. Candidate primer design, validation and optimization

2.1 primer design reference human genome sequence database hg 19/built 36.3, primer sequence was synthesized by Shanghai Biotechnology.

2.2 design 20 pairs of candidate primers for c.169+2C > -T site (see Table 6), and use PCR experiment to verify and evaluate the quality of each pair of candidate primers.

TABLE 6 summary of the basic conditions and the results of the verification experiment for each pair of candidate primers

Note: only one specific band exists after electrophoresis of a normal PCR amplification result, and if a primer dimer band and a non-specific product band appear, the primer dimer band and the non-specific product band are both the results of primer abnormal reaction; the target primer avoids this as much as possible. The optimal primer pair is additionally evaluated and selected comprehensively with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G + C is preferably 40-60%, the amplification effect is poor when the content of G + C is too small, and a non-specific band is easy to appear when the content of G + C is too large. ATGC is preferably randomly distributed;

(3) avoid a tandem reference of more than 5 purine or pyrimidine nucleotides;

(4) no complementary sequence should appear inside the primer;

(5) complementary sequences should not exist between the two primers, especially to avoid complementary overlapping at the 3' end;

(6) the homology of the primer with the sequence of the non-specific amplification region does not exceed 70 percent, and the continuous 8 bases at the tail end of the primer 3' can not have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easily caused;

2.3 candidate primer PCR validation reaction

Performing PCR according to the reaction system in Table 7 and keeping the reaction system on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 7) were provided for each pair of primers.

TABLE 7 primer detection PCR reaction System

Reaction conditions are as follows: the test reaction tube is placed into a PCR instrument, and the following reaction procedures are carried out:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 sec → Tm,30 sec → 72 ℃,60 sec); (PCR amplification parameters were set based on Tm values of the primers in Table 6, and the average Tm value was obtained for the case of double primers).

The third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

2.4 agarose gel electrophoresis detection of the candidate primer PCR results to evaluate the effectiveness and specificity of the primer reaction:

1) The two ends of the washed and dried gel sample former are sealed by an adhesive tape, the gel sample former is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample former.

2) Weighing 2g agar powder into a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, shaking, heating until the gel is completely melted, and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, a sealed gel sample injector is poured into the gel sample injector to ensure that the thickness is about 5 mm.

4) The gel is solidified, the adhesive tape is removed, and the gel and the sample injector are placed into an electrophoresis tank.

5) Adding electrophoresis buffer solution to make the liquid level 1-2mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively and uniformly mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipette, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.

6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate electrophoresis.

7) The power was turned off, the gel was taken out and stained in 0.5g/ml EB aqueous solution for 10-15 minutes.

8) The gel was placed under a transmission ultraviolet irradiator to observe the result at a wavelength of 254nm, and photographed with a camera with a red color filter or the electrophoresis result was recorded with a gel scanning system.

2.5 evaluation of results:

1) If the No. 7 tube only has a bright and clear target band and no other band, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;

2) If no target band appears in the No. 7 tube, judging that the pair of primers and the reaction system are invalid;

3) If the primer-primer dimer band outside the target entry appears in the No. 7 tube and the primer-dimer band also appears in the No.2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;

4) If the non-specific band outside the target band appears in the No. 7 tube and the non-specific band also appears in the No.5 and No.6 tubes, the specificity of the pair of primers and the reaction system is judged to be poor;

5) If the primer dimer and the non-specific band appear outside the target band in the No. 7 tube, and the primer dimer and the non-specific band also appear in the No.2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the results of statistics after the verification test in table 6, the optimal pair (number 1in table 6) is selected as the primer for detecting the mutation family, and the primer sequences for the SLC9A6: NM _001177651.2 exon2:

5’-CAACCTGCTCATCTTCATCC-3’(SEQ ID NO.1)

5’-GCCCACTCGTTTTCCATC-3’(SEQ ID NO.2)

3. PCR amplification of mutation sites of family No.1 and 100 family members

PCR was performed according to the reaction system in Table 8 while keeping the reaction system on ice.

TABLE 8 mutant site PCR reaction System

Reagent	Volume of
		10 XPCR buffer	2.0μL
10mmol/L dNTPs	0.4μL
		100ng/μL SLC9A6-F	0.5μL
100ng/μL SLC9A6-R	0.5μL
		DNA extraction from 100 ng/. Mu.L peripheral blood	1.0μL
5 u/. Mu.L Taq enzyme	0.2μL
		ddH ₂ O	15.4μL

The reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction sequence was performed:

the first step is as follows: 5 minutes at 95 ℃;

the second step: 30 cycles (95 ℃,30 seconds → 55 ℃,30 seconds → 72 ℃,60 seconds);

first, the three steps: 7 minutes at 72 ℃;

the fourth step: 4 ℃ until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. And (3) carrying out enzymolysis purification on the PCR product: mu.L of exonuclease I (Exo I) and 1. Mu.L of alkaline phosphatase (AIP) were added to 5. Mu.L of the PCR product, and the mixture was digested at 37 ℃ for 15 minutes and inactivated at 85 ℃ for 15 minutes.

6. BigDye reaction

The BigDye reaction system is shown in table 7.

TABLE 9 BigDye reaction systems

Reagent	Amount of the composition
		DNA after purification of PCR product	2.0μL
3.2 pmol/. Mu.L sequencing primer	1.0μL
		BigDye	0.5μL
5 × BigDye sequencing buffer	2.0μL
		ddH ₂ O	4.5μL

Sequencing PCR cycling conditions:

the first step is as follows: 1 minute at 96 ℃;

the second step is that: 33 cycles (96 ℃,30 sec → 55 ℃,15 sec → 60 ℃,4 min);

the third step: 4 ℃ until sampling.

7. Purification of BigDye reaction product:

1) Add 1. Mu.L 125mM EDTA (pH8.0) to the bottom of each tube, add 1. Mu.L 3mol/L NaAc (pH5.2);

2) Adding 70 μ L70% ethanol, shaking and mixing for 4 times, standing at room temperature for 15 min;

3) 3000g, centrifuging at 4 ℃ for 30 minutes; immediately invert the 96-well plate and centrifuge at 185g for 1 min;

4) The mixture was allowed to stand at room temperature for 5 minutes, the residual alcohol was allowed to evaporate at room temperature, 10. Mu.L of Hi-Di formamide was added to dissolve the DNA, denaturation was carried out at 96 ℃ for 4 minutes, the mixture was quickly placed on ice for 4 minutes, and sequencing was carried out on a machine.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, designing a nested primer (the second group of primers are designed in the range of the product sequence obtained by amplifying the first group of primers) as a sequencing primer on the basis of the PCR optimal primer, wherein the primer sequence is as follows: .

5’-ATCCTGCTGCTCACCCTC-3’(SEQ ID NO.3)

5’-CCACTCGTTTTCCATCCTCA-3’(SEQ ID NO.4)

9. Analysis of results

The Sanger sequencing results in figure 2 show that the genotype of family 3 patients SLC9A6: NM _001177651.2 at the t site. The position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the genotype of SLC9A6: NM-001177651.2 at the C-layer Christianson syndrome patient's T locus is a "c.169+2C >" T hemizygous "mutation. The position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the genotype of the SLC9A6: NM-001177651.2T locus of the B-layer carrier is the "c.169+2C >" T heterozygote "mutation.

Example 4SLC9A6 Gene c.169+2C >

1. The kit comprises the following components:

1) An amplification primer: as shown in example 3

2) Buffer solution

3) Taq enzyme

4)dNTPs

5) The reference product of the SLC9A6: c.169+2C >.

6) Sequencing primer: as shown in example 3

2. The using method comprises the following steps:

the method is applied to detection of the mutation of the No.2 family gene.

TABLE 10 clinical information of Christianson syndrome 2 good family members

Peripheral blood of family personnel I1 (father), I2 (mother) and II 1 (proband) is used for detection and analysis of the kit.

FIG. 4 shows the results of using the kit to detect the genotype of SLC9A6: NM-001177651.2 of family 2 at site C.169+2C >; the detection result confirms that the proband is a Christianson syndrome patient; the detection result shows that the mother of the proband is a carrier, the probability of the same kind of boys and girls being born again is 1/4, the probability of the carrier being born is 1/4, and the probability of the normal individuals being born is 1/2; genetic counseling suggests a viable prenatal genetic diagnosis or prenatal diagnosis of the embryo for the parent.

As can be seen from the above example results, the present inventors have discovered a novel SLC9A6 gene mutation and confirmed that the novel mutation is closely related to the onset of Christianson syndrome, and the pathogenic mutant can be used for molecular diagnosis of Christianson syndrome and differential diagnosis of related diseases.

1) Extracting genome DNA: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;

3) Purifying PCR amplification products;

4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;

5) Purifying BiyDye reaction products;

6) The BiyDye reaction products were sequenced and the sequence compared to the normal sequence.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Hunan Jiahui Biotechnology Ltd

<120> a novel SLC9A6 mutant gene and diagnostic reagent therefor

<160> 43

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

caacctgctc atcttcatcc 20

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcccactcgt tttccatc 18

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atcctgctgc tcaccctc 18

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccactcgttt tccatcctca 20

<210> 5

<211> 430

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caacctgctc atcttcatcc tgctgctcac cctcaccatt ctcacaatct ggctcttcaa 60

gcaccgccgg gcccgcttcc tgcacgaaac cggcctggct atgatttatg gtaagttcct 120

caacccttgt cagccccttg gcgctgcccc tttctctgcc cgccggctgc ttcgcctcct 180

ctgctggccc tgctcggcct acgttcggct ccccttctaa ttccttccat tttctgcctc 240

gccttccccc taccccgcgt ttctctgcct cacccccttt cctcttcagc ctcgcgcccc 300

attttatctg cctctccaca cctttttcgc ttccgacccc accccctttt tcctccgcac 360

ccccagcccc ccaccctttc cctgcctacc aagctcggga cccggggctg aggatggaaa 420

acgagtgggc 430

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gatttatggt aagttcct 18

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acctgctcat cttcatcctg 20

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcccactcgt tttccatc 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atcctgctgc tcaccctc 18

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcccactcgt tttccatc 18

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acctgctcat cttcatcctg 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

accttaaaca aactgacacc c 21

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

atcctgctgc tcaccctc 18

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

accttaaaca aactgacacc c 21

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

caacctgctc atcttcatcc 20

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gaaaggacag ggcgtagc 18

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ctgggacaga ggggcaaag 19

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tggggtcgga agcgaaaa 18

<210> 19

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atcgtgtccg agaagcaa 18

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctccaaaaga acgccaga 18

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atcgtgtccg agaagcaa 18

<210> 22

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

aaggacaggg cgtagcag 18

<210> 23

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

atcgtgtccg agaagcaa 18

<210> 24

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

atggatcgca atggtgtc 18

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

caacctgctc atcttcatcc 20

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

accttaaaca aactgacacc c 21

<210> 27

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

acctgggaca gaggggcaaa g 21

<210> 28

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tggggtcgga agcgaaaa 18

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

caacctgctc atcttcatcc 20

<210> 30

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

agcccaattc cagacacc 18

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

acctgctcat cttcatcctg 20

<210> 32

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

atcgcaatgg tgtctccc 18

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

acctgctcat cttcatcctg 20

<210> 34

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ccagcccaat tccagaca 18

<210> 35

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cgtgtccgag aagcaagc 18

<210> 36

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tcgaaaggac agggcgta 18

<210> 37

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

cgtgtccgag aagcaagc 18

<210> 38

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

cagggcgtag caggagct 18

<210> 39

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

acctgctcat cttcatcctg 20

<210> 40

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

ctccaaaaga acgccaga 18

<210> 41

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

caacctgctc atcttcatcc 20

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

aacaaactga caccccagag 20

<210> 43

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

acctgctcat cttcatcctg 20

Claims

1. A novel mutant gene inducing Christianson syndrome, characterized in that said mutation comprises a mutation at SLC9A6: NM-001177651.2.

2. A detection reagent for Christianson syndrome caused by the novel mutant gene of claim 1, wherein the detection reagent comprises a specific amplification primer designed for the mutation site of the novel mutant gene.

3. The detection reagent of claim 1, wherein the specific amplification primers comprise SLC9A6-F and SLC9A6-R, the nucleotide sequence of SLC9A6-F is shown in SEQ ID NO.1, and the nucleotide sequence of SLC9A6-R is shown in SEQ ID NO. 2.

4. A kit for detecting Christianson syndrome, comprising the detection reagent according to claim 2 or 3.

5. The detection kit of claim 4, further comprising reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

6. The detection kit of claim 5, wherein the sequencing primers comprise SLC9A6-SeqF and SLC9A6-SeqR, the nucleotide sequence of the SLC9A6-SeqF is shown in SEQ ID NO.3, and the nucleotide sequence of the SLC9A6-SeqR is shown in SEQ ID NO. 4.

7. Use of the detection reagent according to claim 2 or 3 or the detection kit according to any one of claims 4 to 6 for the preparation of a diagnostic reagent for Christianson syndrome.

8. The use of claim 7, wherein the test sample of the diagnostic reagent comprises blood or amniotic fluid.