CN116004801A - Application of pathogenic gene ASPM compound heterozygous mutation for leading to MCPH5 type microcephaly and detection reagent and application - Google Patents

Abstract

The invention provides application of a pathogenic gene ASPM compound heterozygous mutation for leading to MCPH5 type microcephaly, a detection reagent and application thereof, and belongs to the technical field of medical diagnosis. The invention discovers for the first time that a composite heterozygous mutation at the locus of ASPM: nm_018136.5: exon15: c.3692delc: p.p 1231lfs.3 and ASPM: nm_018136.5: exon18: c.6684_6685delaa: p.r2230kfs.8 can lead to MCPH 5-type small head malformation (MIM 608716). The reagent for detecting the gene mutation site is used for genetic diagnosis and prenatal and postnatal guidance of the MCPH5 type microcephaly, provides a new basis and path for pathogenesis research of the MCPH5 type microcephaly, provides a new theoretical basis for treatment of the MCPH5 type microcephaly, and can provide a possible drug target for treatment of the MCPH5 type microcephaly.

Description

Application of pathogenic gene ASPM compound heterozygous mutation for leading to MCPH5 type microcephaly and detection reagent and application

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to application of a pathogenic gene ASPM compound heterozygous mutation for leading to MCPH5 type microcephaly, a detection reagent and application.

Background

Primary microcephaly (congenital microcephaly), also known as true microcephaly or autosomal stealth genetic microcephaly (autosomal recessive primary microcephaly, MCPH), is a neurological dysplastic disorder characterized primarily by a decrease in head circumference accompanied by a degree of non-progressive intellectual degradation.

Clinical characteristics: the development of the brain comprises a fetal stage and a postnatal stage, MCPH mainly influences the development of the brain in the fetal stage, and ultrasonic technology and nuclear magnetic resonance scanning can be applied as early as about 24 weeks after pregnancy to find that the head circumference measurement value and the brain capacity of the infant are lower than those of a normal age fetus. Although it is difficult to accurately reflect the size of brain volume in comparison to objective standards such as skull MRI and CT, postnatal head circumference measurement is one of the most common ways to diagnose small head deformity due to its simple and easy method. Clinically, 3 standard deviations smaller than the head circumference of a normal infant are commonly used as the standard for diagnosing the microcephaly. Correction of age, sex, race, and the like should be noted when using the head circumference measurement as a criterion for diagnosing small head deformity. Clinically, the moderate-mild mental deterioration is used as an important auxiliary diagnosis basis. Individuals with head circumference less than 3 standard deviations from normal and with mental well-being are rare in the report, while individuals with head circumference less than 4 standard deviations from normal and with mental well-being are rare. The important sign of the classification is that the primary microcephaly is postnatal mental deterioration and the brain capacity deficiency level of the primary microcephaly are relatively static, and the secondary microcephaly often has progressive brain deterioration. The primary microcephaly includes non-hereditary primary microcephaly and hereditary Microcephaly (MCPH), and the causes of the non-hereditary primary microcephaly include congenital toxoplasmosis infection, excessive alcohol intake in maternal pregnancy, etc. MCPH is a type of autosomal recessive genetic disease caused by genetic mutations that excludes secondary factors and non-hereditary microcephaly. To date, a number of MCPH-related loci have been discovered successively, such as ASPM, CEP152, microcephalin, WDR62, CDK5RAP2, CNPJ, STIL, etc. Mutations in the ASPM gene (MIM 605481) can lead to autosomal recessive inheritance of primary microcephaly type 5 (MCPH 5), characterized by reduced occipital circumference (OFC) at birth and associated with mental retardation and language retardation, and other features may include short stature or mild seizures.

The ASPM gene (MIM 605481) is located on chromosome 1q31.3, comprising 28 exons and 27 introns, is 63.4kb in length, and encodes the 3477 amino acid human abnormal spindle-like small head deformity associated protein ASPM. The N-terminus of ASPM comprises a microtubule binding region, a calmodulin homology region (CH), and 81 isoleucine-glutamine motifs (IQ) that bind calmodulin, the number of IQ motifs being different in different mammals, and being associated with an increase in cerebral cortex during evolution; ASPM proteins play a role in maintaining symmetrical division during mitosis, the N-and C-termini of ASPM proteins are located in the spindle pole and in the middle, respectively, during mitosis, and ASPM plays an important role in the realization of mitotic spindle function and orientation of the cleavage plane. ASPM gene expression is associated with cell proliferation, with highest expression in progenitor cells, gradually down-regulating as the cells differentiate. The function of ASPM protein is affected during gene mutation, so that the self-renewal and proliferation capacity of cells are inhibited, and the nerve progenitor cells are asymmetrically split in the proliferation process, so that the development of cerebral cortex is affected, and the brain capacity is further affected.

Thus, gene mutation is an important genetic basis for the development of diseases, and gene diagnosis is an important genetic criterion for the diagnosis of micropitting. Clinically, corresponding detection technologies are required to be established for different mutations so as to realize disease diagnosis in advance. However, the variety of genetic mutations used for diagnosing the small head deformity is limited clinically at present, for example, patent publication No. CN112795642A discloses that diagnosis and identification of simple FEVR and FEVR small head deformity are realized by detecting whether c.1271dupA, IVS11+5G > A and c.C247T mutations exist in a KIF11 gene sequence. However, there is no report of mutation sites of pathogenic genes against MCPH5 type microcephaly.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of a composite heterozygous mutation of a pathogenic gene ASPM which causes MCPH5 type microcephaly, and develop a novel composite heterozygous mutation of a pathogenic gene which can be used as a biomarker for diagnosing MCPH5 type microcephaly to distinguish MCPH5 type microcephaly patients, carriers and normal people.

The invention also aims to provide a reagent for detecting the compound heterozygous mutation of the pathogenic gene ASPM causing the MCPH5 type microcephaly and application thereof, and the reagent can assist in screening and diagnosing the mutation of the MCPH5 type microcephaly gene.

The invention provides an application of a gene ASPM composite heterozygous mutation site in preparing an MCPH5 type microcephaly diagnostic reagent or preparing a medicament for preventing and treating the MCPH5 type microcephaly, wherein the pathogenic gene ASPM composite heterozygous mutation site is ASPM: NM_018136.5: exon15: c.3692delC: p.1231Lfs x 3 and ASPM: NM_018136.5: exon18: c.6684_6685delAA: p.R2230Kfs x 8.

The invention provides a reagent for detecting a pathogenic gene ASPM compound heterozygous mutation site of MCPH5 type microcephaly, which comprises a primer for detecting a pathogenic gene ASPM mutation site c.3692delC and a primer for detecting a pathogenic gene ASPM mutation site c.6684_6685 delAA;

the primer for detecting the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-1F with a nucleotide sequence shown as SEQ ID NO. 1 and ASPM-1R with a nucleotide sequence shown as SEQ ID NO. 2;

the primer for detecting the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-2F with a nucleotide sequence shown as SEQ ID NO. 3 and ASPM-2R with a nucleotide sequence shown as SEQ ID NO. 4.

Preferably, the method further comprises a sequencing primer;

the sequencing primer comprises a sequencing primer of a pathogenic gene ASPM mutation site c.3692delC and/or a sequencing primer of a pathogenic gene ASPM mutation site c.6684-6685 delAA;

the sequencing primer of the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-SEQ1F with a nucleotide sequence shown as SEQ ID NO. 5 and ASPM-SEQ1R with a nucleotide sequence shown as SEQ ID NO. 6;

the sequencing primer of the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 and ASPM-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8.

The invention provides an MCPH5 type microcephaly diagnosis kit, which comprises the reagent and a PCR amplification reagent.

Preferably, the PCR amplification reagents include dNTPs, 10 XPCR buffer, magnesium ions and Tap polymerase;

the 10 XPCR buffer comprises an aqueous solution of: 500mmol/LKCl,100mmol/L Tris-Cl pH8.3 and 15mmol/LMgCl ₂ 。

The invention provides application of the reagent in preparing a kit for detecting a pathogenic gene ASPM mutation site of MCPH5 type microcephaly.

The invention provides application of a primer for detecting a pathogenic gene ASPM compound heterozygous mutation site in preparation of a kit for auxiliary diagnosis of MCPH5 type small head deformity, wherein the pathogenic gene ASPM compound heterozygous mutation site is ASPM: NM_018136.5: exon15: c.3692delC: p.1231 Lfs x 3 and ASPM: NM_018136.5: exon18: c.6684_6685delAA: p.R2230Kfs x 8.

Preferably, the primer is a reagent according to the above scheme.

Preferably, the method for assisting in diagnosing the MCPH5 type microcephaly comprises the following steps: detecting the genotype of the mutation site of the gene in the sample with the kit to diagnose whether the individual is at risk of suffering from MCPH 5-type microcephaly:

when the detected genotype is 'c.3692 delC heterozygote+c.6684_6685 delAA heterozygote', judging that the ASPM gene has compound heterozygote mutation, wherein the individual is a patient;

if the genotype is detected as a single heterozygous mutation, "c.3692delc heterozygous mutation" or "c.6684_6685delAA heterozygous mutation", the individual is the carrier;

if mutation is not generated at the mutation site, the ASPM gene is judged to be wild type, and the individual is normal.

Preferably, the sample is at least one of blood, amniotic fluid and biopsy tissue.

The invention provides an application of a gene ASPM composite heterozygous mutation site in preparing an MCPH5 type microcephaly diagnostic reagent or preparing a medicament for preventing and treating the MCPH5 type microcephaly, wherein the pathogenic gene ASPM composite heterozygous mutation site is ASM:NM_018136.5:exon 15:c.3692delC:p.P1231Lfs 3ASPM:NM_018136.5:exon18:c.6684_6685delAA:p.R2230Kfs 8. The invention discovers that ASPM is NM_018136.5, exon15, c.3692delC, p.P1231Lfs 3 and exon18, c.6684_6685 for the first time through an exome sequencing technology

The delAA p.R2230Kfs 8 locus compound heterozygous mutation can cause the incidence of the MCPH5 type microcephaly. In one aspect, the method is used to screen or diagnose a MCPH 5-type microcephaly by detecting whether a subject carries the mutation described above to guide treatment. In particular, the diagnostic kit provided by the invention can be used for rapidly and effectively predicting or diagnosing the MCPH5 type microcephaly. On the other hand, the invention lays an important foundation for researching pathogenesis of the MCPH5 type microcephaly and provides a brand-new theoretical basis for treating the MCPH5 type microcephaly patients. In a third aspect, the invention may provide a potential drug target for the treatment of MCPH 5-type microcephaly.

The invention also provides a kit for detecting the mutation site of the pathogenic gene ASPM of the MCPH5 type microcephaly, which comprises the reagent and a PCR amplification reagent. The primer and the reaction system for detecting the ASPM mutation site of the pathogenic gene are optimized, so that the accuracy and the reliability of a detection result are greatly improved, the screening and the diagnosis of the MCPH5 type microcephaly malformation gene mutation are greatly assisted, and a new technical support is provided for drug screening, drug effect evaluation and targeted treatment.

Drawings

FIG. 1 is a family genetic map of the MCPH5 type microcephaly No. 1; wherein, the utility model represents the male carrier,

representing a female carrier, ■ representing a male patient, o representing a fetus, ↗ representing a forerunner;

FIG. 2 is a diagram showing the results of detection of the ASPM: NM-018136.5:exon 15:c.3692delC:p.P1231Lfs*3 locus genotype by Sanger sequencing, wherein the ancestor of family 1, the mother and the fetus of the ancestor are "c.3692delC heterozygous mutations", the father of the ancestor is wild type (the position of the mutation is indicated by the arrow in the sequencing);

FIG. 3 is a graph showing the results of the detection of the ASPM: NM-018136.5:exon 18:c.6684_6685delAA:p.R2230Kfs*8 locus genotype by Sanger sequencing, wherein the ancestor No. 1 family, the male parent, is "c.6684-6685 delAA heterozygous mutant", and the mother and fetus of the ancestor are wild type (the position of the mutation is indicated by the arrow in the sequencing);

FIG. 4 is a family genetic map of the MCPH5 type microcephaly No. 2; wherein, the utility model represents the male carrier,

representing a female carrier, +.;

FIG. 5 is a graph showing the results of a kit for detecting the genotype at position 3 of line 2 ASPM: NM-018136.5: exon15: c.3692delC: p.P1231Lfs. Wherein the ancestor of line 2, the mother of the ancestor, is "c.3692delC heterozygous mutant", and the father of the ancestor is wild (the position of the mutation is indicated by the arrow in the sequencing);

FIG. 6 is a diagram showing the results of the detection of genotype at position 8 of line No. 2 ASPM: NM-018136.5: exo18: c.6684_6685delAA: p.R2230Kfs using the kit, wherein the ancestor of line No. 2, the male parent of the ancestor, is "c.6684_6685delAA heterozygous mutant", and the mother of the ancestor is wild type (the position of the mutation indicated by the arrow in the sequencing map).

Detailed Description

The invention provides an application of a gene ASPM composite heterozygous mutation site in preparing an MCPH5 type microcephaly diagnostic reagent or preparing a medicament for preventing and treating the MCPH5 type microcephaly, wherein the pathogenic gene ASPM composite heterozygous mutation site is ASPM: NM_018136.5: exon15: c.3692delC: p.1231Lfs x 3 and ASPM: NM_018136.5: exon18: c.6684_6685delAA: p.R2230Kfs x 8.

In the invention, firstly, exon sequencing is utilized to screen pathogenic gene mutation highly related to the MCPH5 type microcephaly, in order to avoid false positive results, and then Sanger sequencing is utilized to verify, so that the pathogenic gene composite heterozygous mutation of the MCPH5 type microcephaly is finally obtained, specifically ASPM: NM_018136.5: exon15: c.3692delC: p.P1231Lfs 3 and exon18: c.6684_66895delAA: p.R2230Kfs 8. The pathogenic gene composite heterozygous mutation can be used as a biomarker for diagnosing the MCPH5 type microcephaly, and can be used for distinguishing the MCPH5 type microcephaly patient, the carrier and the normal crowd. Wherein the ASPM: nm_018136.5: exon15: c.3692delc mutation means that nucleotide at position 3692 of exon15 of wild type ASPM gene is deleted by C to form an ASPM gene mutant, the nucleotide sequence of which is preferably as set forth in SEQ ID NO:9 (aaac ∈tgcta, box is deletion mutation occurrence position, bold underlined letter is amino acid sequence after frame shift mutation, ×is stop code). Compared with the protein encoded by a wild type ASPM gene, the ASPM mutant protein provided by the invention has the advantages that the 1231 st amino acid is mutated from proline (P) to leucine (L) and subjected to frame shift mutation, and the ASPM mutant protein is terminated after the later 2 nd amino acid, namely, the ASPM mutant protein contains the mutation of p.P1231Lfs 3, and the mutation is caused by the frame shift mutation of c.3692delC; the amino acid sequence of the ASPM mutant protein is shown as SEQ ID NO:10 (LGGILL, bolded underlined letter is amino acid sequence after frame shift mutation, stop code). The ASPM: nm_018136.5: exon15: c.6684_6685delaa mutation refers to deletion of nucleotide AA at positions 6684 and 6685 of exon18 of wild type ASPM gene, forming an ASPM gene mutant, the nucleotide sequence of which is preferably as shown in SEQ ID NO:11 (AAAGA ≡gaaac, boxes are deletion mutation occurrence positions). Compared with the protein encoded by the wild type ASPM gene, the ASPM mutant protein provided by the invention has the advantages that the 2230 th amino acid generates lysine (K) from arginine (R) and generates frame shift mutation, and the ASPM mutant protein is terminated after the 6 th amino acid, namely, the ASPM mutant protein contains the mutation of p.R2230Kfs x 8, and the mutation is caused by the frame shift mutation of c.6684_6685 delAA; the amino acid sequence of the ASPM mutant protein is shown as SEQ ID NO. 12 (KEKHTISKV, the underlined letter is the amino acid sequence after frame shift mutation, and the underlined letter is the termination code).

In the present invention, a diagnostic reagent is prepared by designing a specific amplification primer or a specific detection probe according to the sequences upstream and downstream of two mutation sites of ASPM.

The invention provides a reagent for detecting a pathogenic gene ASPM compound heterozygous mutation site of MCPH5 type microcephaly, which comprises a primer for detecting a pathogenic gene ASPM mutation site c.3692delC and a primer for detecting a pathogenic gene ASPM mutation site c.6684_6685 delAA; the primer for detecting the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-1F with a nucleotide sequence shown as SEQ ID NO. 1 (TCCACCATTACCATCCT) and ASPM-1R with a nucleotide sequence shown as SEQ ID NO. 2 (CTCATACCTCCCCAACC); the primer for detecting the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-2F with a nucleotide sequence shown as SEQ ID NO. 3 (AGGGCAGCCACTTTTATT) and ASPM-2R with a nucleotide sequence shown as SEQ ID NO. 4 (CGCATCCTTTTCCTTATC).

In the present invention, the reagent preferably further comprises a sequencing primer. The sequencing primer comprises a sequencing primer of a pathogenic gene ASPM mutation site c.3692delC and/or a sequencing primer of a pathogenic gene ASPM mutation site c.6684-6685 delAA. The sequencing primer of the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-SEQ1F with a nucleotide sequence shown as SEQ ID NO. 5 (TTTCTCCTTTCCTCCTGC) and ASPM-SEQ1R with a nucleotide sequence shown as SEQ ID NO. 6 (CCTGATGGCGTTTGAGAT); the sequencing primer of the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 (GGCAAGTTTTAGAGGAGTAA) and ASPM-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8 (ACAAAGATGTGCCCGATA). The source of the primer is not particularly limited in the present invention, and primer synthesis methods well known in the art may be employed.

The invention provides an MCPH5 type microcephaly diagnosis kit, which comprises the reagent and a PCR amplification reagent.

In the present invention, the PCR amplification reagent preferably includes dNTPs, 10 XPCR buffer, magnesium ions and Tap polymerase. The 10 XPCR buffer comprises an aqueous solution of: 500mmol/L KCl,100mmol/LTris-Cl and 15mmol/LMgCl at pH8.3 ₂ 。

The invention provides application of the reagent in preparing a kit for detecting a pathogenic gene ASPM mutation site of MCPH5 type microcephaly.

In the present invention, the method for detecting the ASPM mutation site of the pathogenic gene of the MCPH 5-type microcephaly preferably comprises the following steps:

extracting genome DNA of a sample to be detected;

amplifying the ASPM gene sequence using the reagents described in the above schemes using genomic DNA as a template;

DNA sequencing the amplified product of the ASPM gene;

comparing the DNA sequencing result of the sample to be detected with the genome DNA sequence of a normal person, wherein when the result is completely consistent, the ASPM gene in the sample to be detected is not mutated into a wild type, when one allele in the chromosome is deleted C at exon15 (NM_ 018136) and the other allele is not mutated, the genotype of the mutation site is 'c.3692delC heterozygous mutation', and similarly, the genotype of the mutation site is 'c.6684_6685 delAA heterozygous mutation' when one allele on the chromosome is deleted AA at exons 18 and 6685 and the other allele is not mutated.

In the present invention, the reaction system for amplifying the ASPM gene sequence is preferably 10 XPCR buffer of 2.0. Mu.L, 10mmol/LdNTPs of 0.4. Mu.L, 100 ng/mu.LASPM-1F (or ASPM-2F) of 0.5. Mu.L, 100 ng/mu.LASPM-1R (or ASPM-2R) of 0.5. Mu.L, 100 ng/mu.L of extracted DNA of 1.0. Mu.L, 5U/mu.LTaq enzyme of 0.2. Mu. L, ddH ₂ O15.4. Mu.L. For ASPM: nm_018136.5: exon15: c.3692delc: p.p1231lfs 3 mutation site, the PCR amplification reaction procedure is preferably as follows: the first step: 95 ℃ for 5 minutes; and a second step of: 30 cycles (95 ℃,30 seconds- > 49 ℃,30 seconds- > 72 ℃,60 seconds); and a third step of: 72 ℃,7 minutes; fourth step: preserving heat at 4 ℃. For ASPM: nm_018136.5: exo18: c.6684_66885 delaa: p.r2230kfs x 8 mutation site reaction procedure was as follows: the first step: 95 ℃ for 5 minutes; and a second step of: 30 cycles (95 ℃,30 seconds- > 52 ℃,30 seconds- > 72 ℃,60 seconds); and a third step of: 72 ℃,7 minutes; fourth step: preserving heat at 4 ℃.

The invention provides application of a primer for detecting a pathogenic gene ASPM compound heterozygous mutation site in preparation of a kit for auxiliary diagnosis of MCPH5 type small head deformity, wherein the pathogenic gene ASPM compound heterozygous mutation site is ASPM: NM_018136.5: exon15: c.3692delC: p.1231 Lfs x 3 and ASPM: NM_018136.5: exon18: c.6684_6685delAA: p.R2230Kfs x 8.

In the invention, a specific primer is designed based on the sequence at the upstream and downstream of the mutation site of the pathogenic gene ASPM, the primer is adopted to amplify the DNA fragment containing the mutation site, and whether the risk of suffering from the MCPH5 type microcephaly is judged through the genotype of the DNA fragment. In an embodiment of the present invention, the primer is preferably a reagent according to the above scheme.

In the present invention, the method for assisting in diagnosing the MCPH5 type microcephaly preferably comprises the steps of: detecting the genotype of the mutation site of the gene in the sample with the kit to diagnose whether the individual is at risk of suffering from MCPH 5-type microcephaly: when the detected genotype is 'c.3692 delC heterozygote+c.6684_6685 delAA heterozygote', judging that the ASPM gene has compound heterozygote mutation, wherein the individual is a patient; if the genotype is detected as a single heterozygous mutation, "c.3692delc heterozygous mutation" or "c.6684_6685delAA heterozygous mutation", the individual is the carrier; if mutation is not generated at the mutation site, the ASPM gene is judged to be wild type, and the individual is normal.

In the present invention, the sample is preferably at least one of blood, amniotic fluid and biopsy tissue.

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, the terms related to molecular genetics, nucleic acid chemistry and molecular biology and laboratory procedures used herein are all widely used terms and conventional procedures in the corresponding field. Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

The term "diagnosis" herein includes prediction of disease risk, diagnosis of the onset or absence of a disease, and also the assessment of disease prognosis.

The term "mutation" as used herein refers to the alteration of a wild-type polynucleotide sequence into a variant, which may be naturally occurring or non-naturally occurring.

In the present invention, the term "heterozygous mutation" means that the mutation exists in only one gene of a pair of alleles.

In the present invention, the term "complex heterozygous mutation" means a heterozygous mutation in which 1 or more parts of alleles occur, that is, a double allelic mutation, each chromosome being mutated.

The term "prenatal diagnosis" herein refers to definitive diagnosis of a high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and achieves the purpose of fetal selection through selective abortion of a diseased fetus, thereby reducing birth defect rate and improving prenatal quality and population quality.

In the present invention, a "primer" refers to a polynucleotide fragment, typically an oligonucleotide, containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases, for amplifying a target nucleic acid in a PCR reaction. The primer need not be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. As used herein,

the term "specifically amplify" refers to a primer that is capable of amplifying a gene of interest by a PCR reaction, but not other genes. For example, specifically amplifying ASPM genes means that primers amplify only ASPM genes and not other genes in a PCR reaction.

The application of the present invention for the composite heterozygous mutation of the pathogenic gene ASPM causing the MCPH 5-type microcephaly and the detection reagent and application thereof will be described in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.

The experimental procedures, which do not address the specific conditions in the examples below, are generally followed by conventional conditions such as those described in Sambrook et al, molecular cloning, A laboratory Manual (Molecular CloningALABORATORYMANUAL 1SECOND EDITION;NewYork:Cold Spring Harbor LaboratoryPress,2014), or by the manufacturer's recommendations.

Example 1

Sample acquisition

The inventor discovers 1 MCPH5 type microcephaly family (1 family for short), and clinical information of part members of the family is shown in table 1. Drawing of the figureA family 1 map, wherein,

representing a male carrier, is->

Representing female carriers, ■ representing male patients, o representing fetuses, ↗ representing forerunner.

1. Diagnostic criteria:

reference may be made to "human monogenic genetic disease" 2010 edition:

the MCPH diagnostic criteria were:

1) MCPH is congenital disease, and the head circumference measurement at birth is smaller than 4 standard deviations of normal age-matched infants;

2) Non-progressive intellectual deterioration, which is not generally accompanied by other neurological abnormal symptoms such as epilepsy, persistent cramps, etc., cannot be regarded as exclusion criteria if the neurological abnormal symptoms occur;

3) Weight, height, appearance are basically normal, genome examination and brain structure are not abnormal, but for individuals with MCPH1 variation, there is often insufficient height development and periventricular neuronal cell dislocation.

TABLE 1 clinical information of MCPH5 family members of the microcephaly No. 1

As shown in FIG. 1, the numbers I (first generation) and II (second generation) are adopted.

Family 1 personnel I1 (forerunner's father), I2 (forerunner's mother), II 1 (forerunner's) peripheral blood DNA and II 2 (fetal) amniotic fluid DNA were used for sequencing analysis.

Example 2

Exon sequencing

1. The instrument is shown in table 2.

Table 2 list of instruments and devices

Instrument name	Manufacturing factories
		High throughput sequencer NextSeq500	Illumina
QubitFluometer nucleic acid metering meter	Invitrogen
		PCR instrument	Bio-RAD
Centrifuge 5810R	Eppendorf
		Centrifuge 5424	Eppendorf
5418 small-sized high-speed centrifugal machine	Eppendorf
		Biological safety cabinet	Sujing (Sujing)
Super clean bench	Sujing (Sujing)
		Ice machine	Grant
UPS power supply	Santa
		MilliQ ultrapure water instrument	Millipore
High performance computers (including servers, cabinets, switches, storage, etc.)	DELL
		-25 degree refrigerator	Meilishi (Meilishi)
Ultralow temperature refrigerator	Eppendorf
		Microwave oven	Beautiful appearance

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different model tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigdye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB dye solution (amerco).

3. Reagent formulation

A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 3 5 XTBE electrophoresis liquid formula

Reagent(s)	Volume/weight
		Tris	5.4g
Boric acid	750mg
		EDTA(pH8.0,0.5mol/L)	2mL
ddH 2 O	90mL

The final volume was adjusted to 100mL with ddH 2O.

0.5 XTBE working solution was run on ddH ₂ O is diluted by 10 times.

10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 4 10 Xerythrocyte lysate formula

Reagent(s)	Volume/weight
		NH 4 Cl	82.9g
KHCO 3	10g
		EDTA	0.37g
Adding dH 2 O	To 1000mL

Autoclaving and storing at 4deg.C.

1 Xnuclear lysate was prepared according to Table 5.

Table 5 1 XNuclear lysate formula

Reagent(s)	Volume/weight
		2MTris-HCl,pH8.2	0.5mL
4MNaCl	10mL
		2mMEDTA	0.4mL

4. Experimental procedure

After signing the informed consent, 3-5mL of peripheral blood and 5-10mL of amniotic fluid of members of family 1, such as I1 (male parent of the forerunner), I2 (mother of the forerunner), II 1 (mother of the forerunner) and the like, are collected.

4.1 sample DNA extraction

1) For the heparin anticoagulation peripheral blood sample, 3-5mL of peripheral blood is filled into a 15mL centrifuge tube, and 2-3 times of 1 Xerythrocyte lysate is added, uniformly mixed, and kept stand on ice for 30 minutes until the solution becomes transparent.

2) Centrifuge at 4℃for 10 min at 3000 rpm, carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by shaking, and centrifuging at room temperature of 3000 rpm for 10 min.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1:1 v/v) and centrifuged at 3000 rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

4.2 exon sequencing

Reference is made to the manual of the human whole exon sequencing kit (Agilent) and the manual of the molecular cloning laboratory (third edition; molecular Cloning A LABORATORY MANUAL 1SECOND EDITION;New York:Cold Spring Harbor LaboratoryPress,2014) for instructions.

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting gel, and recovering 150-250bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 results

Finally, 1 gene composite heterozygous mutation ASPM with pathogenic significance is obtained, wherein the gene composite heterozygous mutation ASPM is NM_018136.5, exon15, c.3692delC, p.P1231Lfs 3 and exon18, c.6684_6685delAA, p.R2230Kfs 8; c.3692delC is mutated to 3692 base C deletion, which causes frame shift mutation, resulting in mutation of amino acid 1231 from proline (P) to leucine (L); 6684-6685 delAA mutation is deletion of the AA at the base positions 6684 and 6685, which results in frame shift mutation, and the mutation from arginine (R) to lysine (K) at the 2230 th amino acid. The genotypes at the position of family 1 patient (precursor) ASPM: nm_018136.5: exon15: c.3692delc: p.p1231lfs x 3 and exon18: c.6684_6685delAA: p.r2230kfs x 8 were the "c.3692delc heterozygote+c.6684_6685 delAA heterozygote" composite heterozygote; the genotype of this site in line 1 carrier was either the "c.3692delC" heterozygous mutation or the "c.6684_6685delAA" heterozygous mutation.

Example 3

Sanger sequencing validation

For exome sequencing results further using Sanger sequencing, ASPM: nm_018136.5: exon15: c.3692delc: p.p1231lfs x 3 and exon18: c.6684_6685delaa: p.r2230kfs x 8 sites were verified. The genotype test was performed on 4 persons such as I1 (forerunner father), I2 (forerunner mother), II 1 (forerunner), II 2 (fetus) and the like in line 1 and 100 extraline normal persons, respectively, in example 1, at positions ASPM: NM-018136.5: exon15: c.3692delC: p.1231Lfs.3 and exon18: c.6684-6685 delAA: p.R2230 Kfs.8.

The specific method comprises the following steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 1.

2. Candidate primer design, verification and preference

2.1 candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome. Ucsc. Edu/cgi-bin/hgGateway.

2.2 design 16 pairs of candidate primers for the c.3692delC and c.6684_6685delAA sites, respectively (see Table 6), and use PCR experiments to verify and evaluate the merits of each pair of candidate primers

TABLE 6 list of candidate primer base conditions and validation experiment results for each pair

/>

/>

/>

Note that: after electrophoresis, the normal PCR amplification result has only one specific band, and if the primer dimer band and the non-specific product band are all the results of abnormal reaction of the primer; the target primer avoids such a situation as much as possible. The optimal primer pairs were also comprehensively evaluated and selected with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G+C is preferably 40-60%, too little G+C has poor amplification effect, and excessive G+C is easy to generate nonspecific bands. ATGC is preferably randomly distributed;

(3) avoiding a serial alignment of more than 5 purine or pyrimidine nucleotides;

(4) complementary sequences should not occur inside the primer;

(5) no complementary sequences should exist between the two primers, in particular to avoid complementary overlapping of the 3' ends;

(6) the homology of the primer and the sequence of the non-specific amplification region is not more than 70 percent, the continuous 8 bases at the 3' -end of the primer cannot have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easy to cause;

2.3 candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds→tm,30 seconds→72 ℃,60 seconds); (the Tm value is calculated for each primer in Table 6 by setting PCR amplification parameters based on the Tm value of each primer).

And a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

2.4 candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding electrophoresis buffer solution to make the liquid level 1-2 mm higher than the rubber surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) The power supply is cut off, the gel is taken out, and the gel is put into an EB water solution with the concentration of 0.5g/mL for dyeing for 10 to 15 minutes.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 evaluation of results:

1) If only one bright and clear target strip appears in the tube No. 7 and no other strip exists, judging that the pair of primers and a reaction system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No. 7 tube has a primer dimer band outside the target band and also has a primer dimer band in the No. 2, 3, 4, 5 and 6 partial tubes, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No. 7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No. 5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No. 7, and primer dimer and non-specific band also appear in the tube No. 2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 based on the results of statistics after the verification test in Table 6, the optimal pair (No. 1 in Table 6) was selected as the primers for mutation family detection.

The PCR primer sequences for the ASPM: NM-018136.5: exon15: c.3692delC: p.P1231Lfs 3 sites are shown below:

5’-TCCACCATTACCATCCT-3’(SEQ ID NO：1)；

5’-CTCATACCTCCCCAACC-3’(SEQ ID NO：2)。

the primer sequences for ASPM: nm_018136.5: exo18: c.6684_6685delaa: p.r2230kfs x 8 sites are as follows:

5’-AGGGCAGCCACTTTTATT-3’(SEQ ID NO：3)；

5’-CGCATCCTTTTCCTTATC-3’(SEQ ID NO：4)。

other candidate primers have poor PCR results due to the presence of priming hairpin structures, or primer dimers, or non-specific binding amplifications. So each gene mutation site selects a first pair of candidate primers for subsequent detection.

3. PCR amplification of mutation sites in family 1 personnel and 100 off-family personnel

PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation site PCR reaction system

Reagent(s)	Volume of
		10 XPCR buffer	2.0μL
10mmol/LdNTPs	0.4μL
		100 ng/. Mu.LASPM-1F (or ASPM-2F)	0.5μL
100 ng/. Mu.LASPM-1R (or ASPM-2R)	0.5μL
		100 ng/. Mu.L of peripheral blood extract DNA	1.0μL
5U/. Mu.LTaq enzyme	0.2μL
		ddH2O	15.4μL

Reaction conditions: the reaction system was put into a PCR instrument, and the following reaction procedure was performed:

for ASPM: nm_018136.5: exon15: c.3692delc: p.p1231lfs 3 site reaction procedure is as follows:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds- > 49 ℃,30 seconds- > 72 ℃,60 seconds);

and a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

For ASPM: nm_018136.5: exo18: c.6684_66885 delaa: p.r2230kfs x 8 site reaction procedure is as follows:

the first step: 95 ℃ for 5 minutes;

and a second step of: 30 cycles (95 ℃,30 seconds- > 52 ℃,30 seconds- > 72 ℃,60 seconds);

and a third step of: 72 ℃,7 minutes;

fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to the 5. Mu.LPCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15 minutes and inactivated at 85℃for 15 minutes.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

TABLE 9BigDye reaction System

Reagent(s)	Dosage of
		DNA after purification of PCR product	2.0μL
3.2 pmol/. Mu.L sequencing primer	1.0μL
		BigDye	0.5μL
5 XBigDye sequencing buffer	2.0μL
		ddH 2 O	4.5μL

Sequencing PCR cycling conditions:

the first step: 96℃for 1 minute;

and a second step of: 33 cycles (96 ℃,30 seconds- > 55 ℃,15 seconds- > 60 ℃,4 minutes);

and a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, and 1. Mu.L of 3mol/LNaAc (pH 5.2) was added to the bottom of the tube;

2) Adding 70 mu L of 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15 minutes;

3) 3000g, centrifugation at 4℃for 30 minutes; immediately inverting the 96-well plate and centrifuging 185g for 1 minute;

4) After 5 minutes at room temperature, the residual alcohol was allowed to evaporate at room temperature, 10. Mu.LHi-Di formamide was added to dissolve DNA, denatured at 96℃for 4 minutes, quickly placed on ice for 4 minutes, and sequenced on the machine.

8. Sequencing

DNA sequencing the purified BigDye reaction product, wherein sequencing primers are designed based on the PCR preferred primers (the second set of primers are designed within the range of the product sequence obtained by amplifying the first set of primers) as sequencing primers, and the sequencing primer sequences of the p.P1231Lfs 3 sites for ASPM are as follows:

5’-TTTCTCCTTTCCTCCTGC-3’(SEQ ID NO：5)；

5’-CCTGATGGCGTTTGAGAT-3’(SEQ ID NO：6)；

the sequencing primer sequences for ASPM: nm_018136.5: exo18: c.6684_6685delaa: p.r2230kfs x 8 sites are as follows:

5’-GGCAAGTTTTAGAGGAGTAA-3’(SEQ ID NO：7)；

5’-ACAAAGATGTGCCCGATA-3’(SEQ ID NO：8)。

9. analysis of results

The Sanger sequencing results of FIG. 2 show that the genotype of line 1, 3 personnel ASPM: NM-018136.5: exon15: c.3692delC: p.P1231Lfs 3 locus is the "c.3692delC heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 2 shows A, C and D-layer ASPM: NM-018136.5: exon15: c.3692delC: p.P1231 Lfs. 3 locus genotype is the "c.3692delC heterozygote" mutation; the position indicated by the arrow in the sequencing diagram of FIG. 2 shows that the B-layer individual genotype is wild-type.

The Sanger sequencing results of FIG. 3 show that the genotype of 2 members of family 1 ASPM: NM-018136.5: exo18: c.6684_6685delAA: p.R2230Kfs x 8 locus is "c.3692delC heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 3 shows that the ASPM of individuals B and C layers is NM-018136.5, exo18, c.6684_6685delAA, p.R2230Kfs. 8 locus genotype is the "c.6684_6685delAA heterozygote" mutation; the position indicated by the arrow in the sequencing diagram of FIG. 3 shows that the A and D layers of the idiotypes are wild type.

The detection results are combined, and the genotype of the prior-evidence ASPM is c.3692delC and c.6684-6685 delAA compound heterozygous mutation.

Example 4

ASPM gene c.3692delC, c.6684_6685delAA mutation diagnosis kit and application

1. The kit comprises the following components:

1) Amplification primers (1.2. Mu.g per primer): as shown in example 3

2) Buffer (500 μl of 10 XPCR buffer: 500mmol/LKCl,100mmol/LTris-Cl (pH 8.3), 15mmol/LMgCl 2)

3) Taq enzyme (20U)

4) dNTPs (four kinds of dNTPs 4mM each)

5) ASPM: c.3692delc, c.6684_6685delAA positive mutation reference DNA the reference is a double-stranded DNA, the specific sequence of c.3692delc positive mutation reference DNA is shown as follows:

the specific sequence of the 6684_6685delAA positive mutant reference DNA is as follows:

wherein, single underlined base is the position of the primer at the upstream and downstream of PCR amplification, the base in the square frame is the mutation site, and double underlined base is the position of the primer at the upstream and downstream of sequencing.

6) Sequencing primer: as shown in example 3

2. The using method comprises the following steps:

104 individuals in 23 dysnoesia families were screened and detected altogether, families conforming to the present invention were found again, and the application of the gene mutation detection kit was described using family 2 patients as examples (see table 10).

TABLE 10 clinical information of MCPH5 type microcephaly family 2 members

As shown in FIG. 4, the numbers I (first generation) and II (second generation) are used.

The peripheral blood DNA of family 2 personnel I1 (father), I2 (mother) and II 1 (forerunner) were used for the detection of the kit.

1) Genomic DNA extraction: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by using the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like, as in the example 3;

3) Purifying the PCR amplification product;

4) Performing BigDye reaction on the purified PCR product by using the sequencing primer;

5) Purifying the BiyDye reaction product;

6) The biydiye reaction products were sequenced and the sequenced sequences were compared to the normal sequences.

The test results of the kit of FIG. 5 show that the genotype of the No. 2 family mother and precursor ASPM: NM-018136.5: exon15: c.3692delC: p.P1231Lfs 3 locus is "c.3692delC heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 5 shows that the B and C layer ASPM: NM-018136.5: exon15: c.3692delC: p.P1231 Lfs. 3 locus genotype is the "c.3692delC heterozygote" mutation; the position indicated by the arrow in the sequencing diagram of FIG. 5 shows that the A-layer individual genotype is wild type. The detection result of the kit in FIG. 6 shows that the genotype of the position 8 of the line 2 father and forerunner ASPM: NM_018136.5: exo18: c.6684_6685delAA: p.R2230Kfs is "c.6684_6685delAA heterozygote". The position indicated by the arrow in the sequencing diagram of FIG. 6 shows that the A and C layer ASPM: NM-018136.5: exo18: c.6684_6685delAA: p.R2230Kfs. 8 locus genotype is the "c.6684_6685delAA heterozygote" mutation; the position indicated by the arrow in the sequencing diagram of FIG. 6 shows that the B-layer individual genotype is wild-type. The detection result confirms that the first evidence is an MCPH5 type small head malformation patient, and the mother and father of the patient are mutant gene carriers; the genetic counseling opinion is that the probability of the couple to rebirth the MCPH5 type microcephaly patient is 1/4, the probability of the offspring of the birth carrier is 1/2, the probability of the normal individual after birth is 1/4, and the genetic diagnosis before embryo implantation and the prenatal diagnosis in the hospital after pregnancy are suggested when the couple is rebirth.

From the results of the above examples, it was found that a novel ASPM gene mutant was found, and it was confirmed that the novel mutant was closely related to the onset of MCPH 5-type microcephaly, which was useful for molecular diagnosis of MCPH 5-type microcephaly and differential diagnosis of related diseases.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (10)

1. The application of a gene ASPM composite heterozygous mutation site in preparing an MCPH5 type microcephaly diagnostic reagent or preparing a medicament for preventing and treating the MCPH5 type microcephaly is characterized in that the pathogenic gene ASPM composite heterozygous mutation site is ASPM: NM_018136.5: exon15: c.3692delC: p.1231 Lfs x 3 and ASPM: NM_018136.5: exon18: c.6684_6685delAA: p.R2230Kfs x 8.

2. A reagent for detecting a pathogenic gene ASPM complex heterozygous mutation site of MCPH5 type microcephaly, which is characterized by comprising a primer for detecting a pathogenic gene ASPM mutation site c.3692delc and a primer for detecting a pathogenic gene ASPM mutation site c.6684_6685 delAA;

the primer for detecting the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-1F with a nucleotide sequence shown as SEQ ID NO. 1 and ASPM-1R with a nucleotide sequence shown as SEQ ID NO. 2;

the primer for detecting the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-2F with a nucleotide sequence shown as SEQ ID NO. 3 and ASPM-2R with a nucleotide sequence shown as SEQ ID NO. 4.

3. The reagent of claim 2, further comprising a sequencing primer;

the sequencing primer comprises a sequencing primer of a pathogenic gene ASPM mutation site c.3692delC and/or a sequencing primer of a pathogenic gene ASPM mutation site c.6684-6685 delAA;

the sequencing primer of the pathogenic gene ASPM mutation site c.3692delC comprises ASPM-SEQ1F with a nucleotide sequence shown as SEQ ID NO. 5 and ASPM-SEQ1R with a nucleotide sequence shown as SEQ ID NO. 6;

the sequencing primer of the pathogenic gene ASPM mutation site c.6684-6685 delAA comprises ASPM-SEQ2F with a nucleotide sequence shown as SEQ ID NO. 7 and ASPM-SEQ2R with a nucleotide sequence shown as SEQ ID NO. 8.

4. An MCPH 5-type microcephaly diagnostic kit comprising the reagent of claim 2 or 3 and a PCR amplification reagent.

5. The kit of claim 4, wherein the PCR amplification reagents comprise dntps, 10 x PCR buffer, magnesium ions, and Tap polymerase;

the 10 XPCR buffer comprises an aqueous solution of: 500mmol/LKCl,100mmol/LTris-Cl, pH8.3 and 15mmol/LMgCl ₂ 。

6. Use of the reagent according to claim 2 or 3 for preparing a kit for detecting the ASPM mutation site of the pathogenic gene of the MCPH5 type microcephaly.

7. Application of a primer for detecting a pathogenic gene ASPM compound heterozygous mutation site in preparation of a kit for assisting in diagnosing MCPH5 type microcephalus, wherein the pathogenic gene ASPM compound heterozygous mutation site is ASPM: NM_018136.5: exo15: c.3692delC: p.1231Lfs x 3 and ASPM: NM_018136.5: exo18: c.6684_6685delAA: p.R2230Kfs x 8.

8. The use according to claim 7, wherein the primer is the reagent according to claim 2 or 3.

9. The use according to claim 7, characterized in that the method for aiding in the diagnosis of a microcephaly of MCPH5 type comprises the following steps: detecting the genotype of the mutation site of the gene in the sample with the kit to diagnose whether the individual is at risk of suffering from MCPH 5-type microcephaly:

when the detected genotype is 'c.3692 delC heterozygote+c.6684_6685 delAA heterozygote', judging that the ASPM gene has compound heterozygote mutation, wherein the individual is a patient;

if the genotype is detected as a single heterozygous mutation, "c.3692delc heterozygous mutation" or "c.6684_6685delAA heterozygous mutation", the individual is the carrier;

if mutation is not generated at the mutation site, the ASPM gene is judged to be wild type, and the individual is normal.

10. The use according to any one of claims 7 to 9, wherein the sample is at least one of blood, amniotic fluid and biopsy.

Images