CN116004799A

CN116004799A - CRTAP pathogenic mutant and application thereof in preparation of gristle syndrome VII type diagnosis kit

Info

Publication number: CN116004799A
Application number: CN202211543611.1A
Authority: CN
Inventors: 曾桥; 吴伟娟; 王维; 薛斌
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-11-30
Filing date: 2022-11-30
Publication date: 2023-04-25
Anticipated expiration: 2042-11-30
Also published as: CN116004799B

Abstract

The invention relates to the technical field of gene diagnosis, in particular to a CRTAP pathogenic mutant and application thereof in preparing a diagnostic kit for gristle syndrome VII type. The invention discovers that the c.24-25 insGCGGCGCT and c.1125dupT locus compound heterozygous mutation can cause the type VII of the gristle through an exome sequencing technology for the first time, and the diagnostic reagent or the kit prepared by taking the mutant genes as targets can specifically distinguish the type VII of the gristle, patients, carriers and normal people, can be used for rapidly and effectively predicting or diagnosing the type VII of the gristle, and can provide instruction of eugenic and therapeutic intervention. On the other hand, the invention lays an important foundation for the pathogenesis research of the type VII of the gristle, and provides a brand new theoretical basis for the treatment of patients of the type VII of the gristle. In a third aspect, the CRTAP pathogenic mutant provided by the invention can provide new technical support for drug screening, drug effect evaluation and targeted treatment of the type VII of the gristle.

Description

CRTAP pathogenic mutant and application thereof in preparation of gristle syndrome VII type diagnosis kit

Technical Field

The invention relates to the technical field of gene diagnosis, in particular to a CRTAP pathogenic mutant and application thereof in preparing a diagnostic kit for gristle syndrome VII type.

Background

Crohn's disease or osteogenesis imperfecta is a hereditary bone disease characterized by increased bone fragility, also known as brittle bone disease, porcelain doll, periosteal dysplasia; the main surface is also called as the brittle bone-blue sclera-deafness syndrome, because it presents with brittle bone, blue sclera, deafness, etc. The disease is rare, the fracture is the main clinical manifestation, the sick children are easy to fracture, and the slight collision can cause serious fracture; also includes connective tissue abnormalities such as blue sclera, dentin dysplasia, short stature, etc.

The pathogenic genes of the gristle diseases and the mutation spectrum thereof are complex and various, wherein the gristle diseases I-V are autosomal dominant inheritance, and the gristle diseases VI-IX are autosomal recessive inheritance. The pathogenic genes of type I-IV are COL1A1 (MIM 120150) and COL1A2 (MIM 120160), the pathogenic gene of type V is IFITM5 (MIM 614757), the pathogenic gene of type VI is SERPINF1 (MIM 172860), the pathogenic gene of type VII is CRTAP (MIM 605497), the pathogenic gene of type VIII is LEPRE1 (MIM 610339), and the pathogenic gene of type IX is PPIB (MIM 123841).

Wherein the CRTAP gene (MIM 605497) is located on chromosome 3p22.3, comprising 7 exons and 6 introns, the gene is 33.6kb in length, encoding a 401 amino acid cartilage related protein. CRTAP, LEPRE1 and PPIB mutations are responsible for type VII, VIII and IX, respectively, and the proteins they encode form collagen prolyl 3-hydroxylation complexes on the endoplasmic reticulum in a ratio of 1:1:1, together with participation in type I collagen posttranslational modifications. The complex is not only responsible for 3-hydroxylation of the 986 proline residue of the alpha 1 chain, but also has the activity of prolyl cis-trans isomerase and molecular chaperone function, and mutation deletion can cause delay of helix folding of type I collagen, influence mineralization and remodeling of bones, and cause diseases.

Gene mutation is an important genetic basis for the development of diseases, and gene diagnosis is a gold standard for diagnosing type VII of gristle. There is a clinical need to establish corresponding detection techniques for different mutations and for clear etiology and disease diagnosis. However, no diagnostic kit capable of specifically distinguishing between type VII patients, carriers and normal populations is reported.

Disclosure of Invention

In order to solve the problems, the invention provides a CRTAP pathogenic mutant and application thereof in preparing a diagnosis kit for the type VII of the gristle. The diagnosis kit prepared by the CRTAP pathogenic mutant provided by the invention can help screening and diagnosing the mutation of the gristle type VII gene, and can specifically distinguish the gristle type VII patients, carriers and normal people.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a CRTAP pathogenic mutant, which comprises c.24-25 insGCGGCGCT and/or c.1125dupT; said c.24_25insGCGGCGCT has a GCGGCGCT insertion mutation between positions 24 and 25 of exon1 under accession No. nm_ 000088.4; the c.1125dupT has a T repeat mutation at position 1125 of exon6 of accession No. NM-000088.4.

The invention also provides application of the CRTAP pathogenic mutant serving as a detection target in preparation of a type VII diagnosis or auxiliary diagnosis reagent or kit for the gristle.

The invention also provides application of the CRTAP pathogenic mutant serving as a therapeutic target in preparing a drug for treating the gristle syndrome VII type.

The invention also provides a primer for amplifying the CRTAP pathogenic mutant, wherein the primer comprises a primer pair 1 and/or a primer pair 2; the primer pair 1 comprises CRTAP-1F and CRTAP-1R, and the primer pair 2 comprises CRTAP-2F and CRTAP-2R; the nucleotide sequence of the CRTAP-1F is shown as SEQ ID NO. 1; the nucleotide sequence of the CRTAP-1R is shown as SEQ ID NO. 2; the nucleotide sequence of the CRTAP-2F is shown as SEQ ID NO. 3; the nucleotide sequence of the CRTAP-2R is shown as SEQ ID NO. 4.

The invention also provides application of the primer in preparation of a type VII diagnosis or auxiliary diagnosis reagent or kit for the gristle.

The invention also provides a diagnostic or auxiliary diagnostic reagent of the type VII of the gristle, and the diagnostic or auxiliary diagnostic reagent comprises the primer.

Preferably, the diagnostic or auxiliary diagnostic reagent further comprises one or more of dNTPs, PCR buffer, magnesium ion and Tap polymerase.

The invention also provides a diagnosis or auxiliary diagnosis kit of the type VII of the gristle, which comprises the reagent and the sequencing primer.

Preferably, the sequencing primer comprises sequencing primer pair 1 and/or sequencing primer pair 2; the sequencing primer pair 1 comprises CRTAP-Seq1F and CRTAP-Seq1R, and the sequencing primer pair 2 comprises CRTAP-Seq1F and CRTAP-Seq1R; the nucleotide sequence of the CRTAP-Seq1F is shown as SEQ ID NO. 5; the nucleotide sequence of the CRTAP-Seq1R is shown as SEQ ID NO. 6; the nucleotide sequence of the CRTAP-Seq2F is shown as SEQ ID NO. 7; the nucleotide sequence of the CRTAP-Seq2R is shown as SEQ ID NO. 8.

Preferably, the diagnostic or auxiliary diagnostic kit further comprises DNA1 and/or DNA2; the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9; the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.

The beneficial effects are that:

the invention provides a CRTAP pathogenic mutant, which comprises c.24-25 insGCGGCGCT and/or c.1125dupT; said c.24_25insGCGGCGCT has a GCGGCGCT insertion mutation between positions 24 and 25 of exon1 under accession No. nm_ 000088.4; the c.1125dupT has a T repeat mutation at position 1125 of exon6 of accession No. NM-000088.4. The invention discovers that CRTAP: NM_000088.4: exon1: c.24_25insGCGGCGCT: p.L12Rfs x 2 and exon6: p.1125dupT: p.K376 site compound heterozygous mutation can lead to the type VII of the gristle, and diagnosis or auxiliary diagnosis reagent or kit prepared by taking the mutant gene as a target point can specifically distinguish the type VII of the gristle, patients, carriers and normal people, can be used for rapidly and effectively predicting or diagnosing or assisting in diagnosing the type VII of the gristle, and can provide guidance for prepotency and therapeutic intervention. On the other hand, the invention lays an important foundation for the pathogenesis research of the type VII of the gristle, and provides a brand new theoretical basis for the treatment of patients of the type VII of the gristle. In a third aspect, the CRTAP pathogenic mutant provided by the invention can provide new technical support for drug screening, drug effect evaluation and targeted treatment of the type VII of the gristle.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.

FIG. 1 is a family genetic map of Cryptosporidium VII type 1; wherein, the liquid crystal display device comprises a liquid crystal display device,

representing a male carrier, is->

Indicates female carrier, +.indicates female patient, +.>

Representing induced labor patients, ↗ representing forensics; />

FIG. 2 is a graph showing the results of detecting the genotype of the c24_25 insGCGGCGCT locus by Sanger sequencing;

FIG. 3 is a graph showing the result of detecting the genotype of the c.1125dupT locus by Sanger sequencing;

FIG. 4 is a genetic map of type VII type 2 family of Cryptosporidium; wherein, the liquid crystal display device comprises a liquid crystal display device,

representing a male carrier, is->

Representing female carrier, < >>

Representing induced labor patients, ↗ representing forensics;

FIG. 5 is a diagram showing the result of detecting genotype of the c.24_25insGCGGCGCT locus of family 2 by using the kit;

FIG. 6 is a diagram showing the result of detecting genotype of the c.1125dupT locus of line 2 by using the kit;

FIG. 7 is a family genetic map of Cryptosporidium VII type 3; wherein, the liquid crystal display device comprises a liquid crystal display device,

representing a male carrier, is->

Which is meant to be a female carrier and,

representing a labor inducing fetus (patient), ↗ representing a prover;

FIG. 8 is a graph showing the result of detecting genotype of the c.24_25insGCGGCGCT locus of family 3 by using the kit;

FIG. 9 is a diagram showing the result of detecting genotype of c.1125dupT locus of line 3 using the kit;

FIG. 10 is a genetic map of the family No.4 of Cryptosporidium VII; wherein, the liquid crystal display device comprises a liquid crystal display device,

representing a male carrier, is->

Representing female carrier, < >>

Representing a labor inducing fetus (patient), ↗ representing a prover;

FIG. 11 is a diagram showing the result of detecting genotype of the c.24_25insGCGGCGCT locus of family 4 by using the kit;

FIG. 12 is a diagram showing the result of detecting genotype of the c.1125dupT locus of line 4 using the kit;

the arrows in fig. 2, 3, 5, 6, 8, 9, 11 and 12 indicate the mutation occurrence positions.

Detailed Description

The c.24-25 insGCGGCGCT mutation refers to that 8 bases of GCGGCGCT are inserted between the 24 th base and the 25 th base of the 1 st exon of a wild CRTAP gene to form a CRTAP gene mutant; the cDNA sequence of the wild-type CRTAP gene is shown in Genbank accession No. NM-000088.4.

The mutation of c.24-25 insGCGGCGCT leads to the mutation of the 12 th amino acid of the coded protein and the protein coded by the wild CRTAP gene from leucine (L) to arginine (R), and causes the frame shift mutation, and the mutation is terminated after the subsequent 2 amino acids, which is marked as p.L12Rfs.

The c.1125dupT mutation refers to repeated mutation of 1125 th base T of a 6 th exon of a wild CRTAP gene to form a CRTAP gene mutant; the cDNA sequence of the wild-type CRTAP gene is shown in Genbank accession No. NM-000088.4.

The c.1125dupT mutation of the invention causes nonsense mutation (mutation to stop codon) of lysine (K) at 376 th amino acid of the coded protein and the protein coded by the wild CRTAP gene, which is marked as p.K376.

The CRTAP pathogenic mutant screened by the invention can distinguish the patient with the gristle disease type VII, the carrier and the normal human group, and can be used as a biomarker for diagnosing or assisting in diagnosing the gristle disease type VII; and can also provide new technical support for drug screening, drug effect evaluation and targeted treatment of the type VII of the gristle.

The invention also provides application of the CRTAP pathogenic mutant in the scheme as a detection target in preparation of a diagnosis or auxiliary diagnosis reagent or kit for the type VII of the gristle. A specific amplification primer or a specific detection probe is designed according to the upstream and downstream sequences of the CRTAP pathogenic mutant gene mutation site, so that the type VII patient with the gristle symptom, a carrier and a normal human group can be distinguished.

The invention also provides application of the CRTAP pathogenic mutant in the scheme as a therapeutic target in preparing a medicine for treating the gristle syndrome VII type.

The invention provides a primer for amplifying the CRTAP pathogenic mutant, wherein the primer comprises a primer pair 1 and/or a primer pair 2; the primer pair 1 comprises CRTAP-1F and CRTAP-1R, and the primer pair 2 comprises CRTAP-2F and CRTAP-2R;

the nucleotide sequence of the CRTAP-1F is shown in SEQ ID NO. 1: aaatcgtcagacctccacccc;

the nucleotide sequence of the CRTAP-1R is shown as SEQ ID NO. 2: cctttggcagggctggatg;

the nucleotide sequence of the CRTAP-2F is shown in SEQ ID NO. 3: taggcaaactcaccactt;

the nucleotide sequence of the CRTAP-2R is shown in SEQ ID NO. 4: tgtcactgaaacacccac.

The primer 1 provided by the invention can specifically amplify CRTAP genes containing c.24-25 insGCGGCGCT sites or wild CRTAP genes, and the primer 2 can specifically amplify CRTAP genes containing c.1125dupT sites or wild CRTAP genes, so that the patient, carrier and normal population suffering from the gristle disease VII can be specifically distinguished, the invention can be used for rapidly and effectively predicting, diagnosing or assisting in diagnosing the gristle disease VII, and can provide instruction of prenatal and postnatal care and therapeutic intervention.

The invention also provides a diagnostic or auxiliary diagnostic reagent of the type VII of the gristle, and the reagent comprises the primer.

In the present invention, the diagnostic or auxiliary diagnostic reagent preferably further includes other reagents in the PCR amplification reaction, including, but not limited to dNTPs, PCR buffer, magnesium ion and Tap polymerase. In the specific implementation process of the invention, other reagents can be routinely selected according to actual needs.

The invention also provides a diagnosis or auxiliary diagnosis kit of the type VII of the gristle, which comprises the reagent and a sequencing primer.

In the present invention, the sequencing primer includes a sequencing primer pair 1 and/or a sequencing primer pair 2; the sequencing primer pair 1 comprises CRTAP-Seq1F and CRTAP-Seq1R, and the sequencing primer pair 2 comprises CRTAP-Seq1F and CRTAP-Seq1R;

the nucleotide sequence of the CRTAP-Seq1F is shown in SEQ ID NO. 5: gcgtcgcaccgtcctcttt;

the nucleotide sequence of the CRTAP-Seq1R is shown in SEQ ID NO. 6: ctccaggtagcccacgctct;

the nucleotide sequence of the CRTAP-Seq2F is shown in SEQ ID NO. 7: tacagccattaccactatc;

the nucleotide sequence of the CRTAP-Seq2R is shown in SEQ ID NO. 8: tcccctctgtttcttacttca.

The sequencing primer 1 provided by the invention can specifically sequence CRTAP genes or wild CRTAP genes containing c.24-25 insGCGGCGCT sites, and the primer 2 can specifically sequence CRTAP genes or wild CRTAP genes containing c.1125dupT sites.

In the present invention, the diagnostic or auxiliary diagnostic kit preferably further comprises c.24_25insGCGGCGCT site positive mutation reference DNA1 and/or c.1125dupt site positive mutation reference DNA2;

the single-stranded nucleotide sequence of the DNA1 is preferably as shown in SEQ ID NO. 9:

the single-stranded nucleotide sequence of the DNA2 is preferably shown in SEQ ID NO. 10:

wherein, single underlined base is the position of the primer at the upstream and downstream of PCR amplification, the base in the square frame is the mutation site, and double underlined base is the position of the primer at the upstream and downstream of sequencing.

The present invention preferably also provides a method for identifying the genotype of the CRTAP pathogenic mutant, comprising the steps of:

taking the DNA of the sample to be detected as a template, and carrying out PCR amplification by using the primer to obtain an amplification product;

sequencing the amplified product to determine the genotype of the CRTAP pathogenic mutant.

In the present invention, the reaction system for PCR amplification preferably comprises, in 20. Mu.L, 10 XPCR buffer 2. Mu. L, dNTPs 0.4, 0.4. Mu. L, CRTAP-1F or CRTAP-2F 0.5. Mu. L, CRTAP-1R or CRTAP-2R 0.5. Mu.L, template 1. Mu. L, taq enzyme 0.2. Mu.L and the balance ddH ₂ O。

In the present invention, when the primer pair in the reaction system of the PCR amplification is CRTAP-1F and CRTAP-1R, the reaction progress of the PCR amplification preferably includes: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 63℃for 30s, elongation at 72℃for 60s,30 cycles; reacting for 7min at 72 ℃;

when the primer pair in the reaction system of the PCR amplification is CRTAP-2F and CRTAP-2R, the reaction process of the PCR amplification preferably comprises: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 48℃for 30s, elongation at 72℃for 60s,30 cycles; the reaction was carried out at 72℃for 7min.

In the present invention, the PCR buffer preferably comprises KCl500mmol/L, tris-HCl100mmol/L and MgCl ₂ 15mmol/L; the pH of Tris-HCl is preferably 8.3.

In the present invention, the sample preferably includes blood or amniotic fluid.

The invention can preferably determine the correlation between an individual providing a sample to be tested and the type VII of the gristle according to the genotype of the CRTAP gene c.24_25insGCGGCGCT site, and specifically comprises the following steps: comparing the sequencing result with the sequences of the DNA1 and the DNA2 in the scheme, wherein if the sequences of the mutation site of the c.24-25 insGCGGCGCT and the DNA1 are identical, the mutation site of the c.24-25 insGCGGCGCT is generated, and if the sequences of the mutation site of the c.1125dupT and the DNA2 are identical, the mutation site of the c.1125dupT is generated;

when the genotype of the c.1125dupt site is wild type (i.e., no c.1125dupt mutation occurs), the genotype of the c.24_25insGCGGCGCT site is wild type (i.e., no c.24_25insGCGGCGCT mutation occurs), the individual providing the sample to be tested is a normal individual;

when the genotype of the c.1125dupT locus is a c.1125dupT heterozygous mutation (one gene is mutated c.1125dupT and the allele thereof is not mutated c.1125dupT), the genotype of the c.24_25insGCGGCGCT locus is a c.24_25insGCGGCGCT heterozygous mutation (one gene is mutated c.24_25insGCGGCGCT and the allele thereof is not mutated c.24_25 insGCGGCGCT), and the two mutated loci are on two chromosomes,

or the genotype of the c.1125dupT locus is a c.1125dupT homozygous mutation, the genotype of the c.24_25insGCGGCGCT locus is a c.24_25insGCGGCGCT heterozygous mutation,

or the genotype of the c.1125dupT locus is a homozygous mutation of c.1125dupT, the genotype of the c.24_25insGCGGCGCT locus is a wild type,

or the genotype of the c.1125dupT locus is wild type, the genotype of the c.24_25insGCGGCGCT locus is homozygous mutation of the c.24_25insGCGGCGCT locus,

or the genotype of the c.1125dupT locus is a c.1125dupT heterozygous mutation, the genotype of the c.24_25insGCGGCGCT locus is a c.24_25insGCGGCGCT homozygous mutation,

or when the genotype of the c.1125dupT locus is the homozygous mutation of the c.1125dupT locus and the genotype of the c.24_25insGCGGCGCT locus is the homozygous mutation of the c.24_25insGCGGCGCT, the individual providing the sample to be tested is a patient with the type VII of the gristle;

when the genotype of the c.1125dupT locus is c.1125dupT heterozygous mutation, the genotype of the c.24_25insGCGGCGCT locus is c.24_25insGCGGCGCT heterozygous mutation, and the two mutated loci are on the same chromosome,

or when the genotype of the c.1125dupT locus is wild-type and the genotype of the c.24_25insGCGGCGCT locus is a heterozygous mutation of c.24_25insGCGGCGCT,

or c.1125dupT locus is c.1125dupT heterozygous mutation, and c.24_25insGCGGCGCT locus is wild type, the individual providing the sample to be tested is a gristle type VII carrier.

The invention screens and detects 210 individuals in 56 skeletal system dysplasia families in advance, and finds that 4 families are CRTAP genes c24_25insGCGGCGCT and c.1125dupT compound heterozygous mutation.

For further explanation of the present invention, the CRTAP pathogenic mutants and the application thereof in preparing a diagnostic kit of type VII of brittle bone disease provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

The experimental procedures, which do not address the specific conditions in the examples below, are generally followed by conventional conditions such as those described in Sambrook et al, molecular cloning, A laboratory Manual (third edition; new York: cold Spring Harbor LaboratoryPress, 2014), or by the manufacturer's recommendations.

Example 1

Sample acquisition

The clinical information of 1 family member of the gristle syndrome VII (abbreviated as 1) and family member is shown in Table 1. FIG. 1 is a family chart of Cryptosporidium VII.

1. Diagnostic criteria:

reference may be made to the "human monogenic genetic diseases" 2010 edition and the "rare disease diagnosis and treatment guide" 2019 edition:

clinical diagnosis of gristle is based mainly on disease manifestations and imaging features. The diagnosis basis mainly comprises: history of small illness, recurrent brittle fracture; blue sclera; dentinal dysplasia; hearing loss; family history of positive fractures. Diagnosis of brittle bone disease should be combined with bone imaging. The patient with the gristle disease can carry out bone density, bone X-ray and bone metabolism biochemical index examination to evaluate the severity of the disease and is helpful for differential diagnosis. If necessary, the detection of gene mutation can be performed, and further, the molecular diagnosis can be clarified. The gene diagnosis is an important means for accurate diagnosis and treatment of the gristle symptom, and is beneficial to identification of gene mutation, accurate typing of diseases, revealing pathogenesis and promoting genetic counseling. Notably, since the causative gene of brittle bone disease is not yet completely discovered at present, gene diagnosis cannot replace clinical diagnosis. Those with negative gene tests cannot rule out the possibility of developing brittle bone disease.

TABLE 1 clinical information of Cryptosporidium VII type 1 family Member

As shown in FIG. 1, the numbers I (first generation) and II (second generation) are adopted.

The peripheral blood DNA of family 1 personnel I1 (male parent of the first-wittedly), I2 (mother of the first-wittedly) and II 3 (mother of the first-wittedly) were used for sequencing analysis.

Exon sequencing

2. The instrument is shown in table 2.

Table 2 list of instruments and devices

3. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different model tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (tengen), agarose (tengen), EB dye solution (amerco).

4. Reagent formulation

A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 3 5 XTBE electrophoresis liquid formula

Reagent(s)	Tris	Boric acid	EDTA(pH8.0,0.5mol/L)	ddH ₂ O
					Volume/weight	5.4g	750mg	2mL	90mL

With ddH ₂ O adjusts the final volume to 100mL.

0.5 XTBE working solution was run on ddH ₂ O is diluted by 10 times.

10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 4 10 Xerythrocyte lysate formula

Reagent(s)	NH ₄ Cl	KHCO ₃	EDTA	Adding ddH ₂ O
					Volume/weight	82.9g	10g	0.37g	To 1000mL

Autoclaving and storing at 4deg.C.

1 Xnuclear lysate was prepared according to Table 5.

Table 5 1 XNuclear lysate formula

Reagent(s)	2MTris-HCl，pH8.2	4MNaCl	2mMEDTA
				Volume/weight	0.5mL	10mL	0.4mL

5. Experimental procedure

After signing the informed consent, 3-5 mL of peripheral blood I1, I2 and II 3 in family 1 is collected as a study sample.

5.1 sample DNA extraction

1) 3-5 mL of peripheral blood is put into a 15mL centrifuge tube, and 1 Xerythrocyte lysate with the volume of 2-3 times is added, evenly mixed, and kept stand on ice for 30min until the solution becomes transparent. If the amniotic fluid sample is directly taken to the next step.

2) Centrifuge at 3000rpm for 10min at 4℃and carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of proteinase K at 20mg/mL and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by shaking, and centrifuging at 3000rpm for 10min at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, and an equal volume of phenol/chloroform mixture (phenol: chloroform=1:1, v/v) was added and mixed well and centrifuged at 3000rpm for 10min at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5min, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

5.2 exon sequencing

Refer to the manual of the human whole exon sequencing kit (Agilent) and the manual of molecular cloning laboratory.

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting glue, and recovering 150-250 bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

5.3 results

Finally obtaining the gene composite heterozygous mutation CRTAP with pathogenic significance, NM_000088.4:exon1:c.24_25insGCGGCGCT:p.L12Rfs.2 (hereinafter denoted as c.24_25 insGCGGCGCT) and exon6:c.1125dupT:p.K376 (hereinafter denoted as c.1125dupT), respectively from alleles of parent source and parent source of the patient; wherein the mutation of c.24_25insGCGGCGCT is that the 8 bases of GCGGCGCT are inserted between 24 th base and 25 th base, so that the 12 th amino acid is mutated from leucine (L) to arginine (R), and the frame shift mutation is caused, and the sequence is terminated after the following 2 amino acids; the 1125dupT mutation is a repeated mutation of the 1125 th base T, resulting in nonsense mutation at 376 th base T (which becomes a stop codon). The genotypes at the c.24_25insGCGGCGCT and c.1125dupt sites of family 1 patient (precursor) are the "c.24_25insGCGGCGCT heterozygote+c.1125dupt heterozygote" complex heterozygote mutations; the genotype of this site in the line 1 carrier was either the "c.24_25insGCGGCGCT" heterozygous mutation or the "c.1125dupT" heterozygous mutation.

Example 2

Sanger sequencing validation

The c.24-25 insGCGGCGCT and c.1125dupT sites were further verified using Sanger sequencing for exome sequencing results. The genotypes of the c24_25insGCGGCGCT and c.1125dupT loci were detected in 3 persons in the line 1 and in 100 persons outside the line 1 of example 1.

The specific method comprises the following steps:

1. DNA extraction

Normal human genomic DNA was extracted as in example 1.

2. Candidate primer design, verification and preference

2.1 candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome e, or http:// genome. Ucsc. Edu/cgi-bin/hgGateway.

2.2 14 and 15 pairs of candidate primers were designed for mutation sites c.24-25 insGCGGCGCT and c.1125dupT, respectively (see Table 6), and the merits of each pair of candidate primers were verified and evaluated by PCR experiments.

TABLE 6 list of candidate primer base conditions and validation experiment results for each pair

/>

2.3 candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

the first step: 95 ℃ for 5min;

and a second step of: 30 cycles (95 ℃,30sec→tm,30sec→72 ℃,60 sec); (PCR amplification parameters were set according to the Tm values of the primers in Table 6).

And a third step of: 72 ℃ for 7min;

fourth step: 4℃until sampling.

2.4 candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding electrophoresis buffer solution to make the liquid level 1-2 mm higher than the rubber surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) Cutting off the power supply, taking out the gel, putting the gel into an EB water solution with the concentration of 0.5g/ml, and dyeing for 10-15 min.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 evaluation of results:

1) If only one bright band appears in the tube No.7 and no other bands exist, judging that the pair of primers and a response system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No.7 tube has a primer dimer band outside the target band and also has a primer dimer band in the No.2, 3, 4, 5 and 6 partial tubes, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No.7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No.5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No.7, and primer dimer and non-specific band also appear in the tube No.2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 based on the results of statistics after the verification test of Table 6 (the results are shown in Table 6), two optimal pairs were selected, of which SEQ ID NO.1 and SEQ ID NO.2 were used as primers for c.24-25 insGCGGCGCT site detection, and SEQ ID NO.3 and SEQ ID NO.4 were used as primers for c.1125dupT site detection. Although the results of the verification and detection of primer pair 1-3 at the c.1125dupT locus are identical,

primer pair

2 and 3 are somewhat more difficult to design (shorter fragments or less likely to select good quality sequencing primers) than primer pair 1, and primer pair 1 (i.e., the primers shown in SEQ ID NO.3 and SEQ ID NO. 4) is more advantageous for the subsequent design and screening of nested primers (sequencing primers).

3. PCR amplification of mutation sites in family personnel and 100 off-family personnel

Sample DNAs of the family 1 person and the 100 off-family person were obtained according to step 5.1 of example 1, and PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation site PCR reaction system

Reaction conditions: the reaction system was put into a PCR instrument, and the following reaction procedure was performed:

for the c24_25 insGCGGCGCT site: the first step: 95 ℃ for 5min; and a second step of: 30 cycles (95 ℃,30 s- & gt 63 ℃,30 s- & gt 72 ℃ 60 s); and a third step of: 72 ℃ for 7min; fourth step: 4℃until sampling.

For c.1125dupT site: the first step: 95 ℃ for 5min; and a second step of: 30 cycles (95 ℃,30 s- > 48 ℃,30 s- > 72 ℃,60 s); and a third step of: 72 ℃ for 7min; fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to the 5. Mu.LPCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15min and inactivated at 85℃for 15min.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

TABLE 9BigDye reaction System

Sequencing PCR cycling conditions:

the first step: 96 ℃ for 1min;

and a second step of: 33 cycles (96 ℃,30sec to 55 ℃,15sec to 60 ℃,4 min);

and a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to the bottom of the tube, followed by 1. Mu.L of 3mol/LNaAc (Ph 5.2);

2) Adding 70 μL 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15min;

3) 3000g, centrifuging at 4 ℃ for 30min; immediately inverting the 96-well plate, and centrifuging 185g for 1min;

4) Standing at room temperature for 5min, volatilizing residual alcohol at room temperature, adding 10 mu LHi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on a machine.

8. Sequencing

DNA sequencing is carried out on the purified BigDye reaction product, and a sequencing primer is used as a sequencing primer by designing a nest primer (a second primer set is designed within the range of the product sequence obtained by amplifying the first primer set) on the basis of the PCR preferred primer.

The sequencing primer sequences for the c.24-25 insGCGGCGCT site are shown as SEQ ID NO.5 and SEQ ID NO.6, and the sequencing primer sequences for the c.1125dupT site are shown as SEQ ID NO.7 and SEQ ID NO. 8.

9. Analysis of results

Sanger sequencing results are shown in FIGS. 2 and 3. As can be seen from FIG. 2, the genotype of the mother and precursor c.24_25insGCGGCGCT locus in family 1 is "c.24_25insGCGGCGCT heterozygous", and the genotype of the father c.24_25insGCGGCGCT locus is wild type; as can be seen from the figure, the father and forerunner c.1125dupT locus genotype in line 1 is the "c.1125dupT heterozygote", and the mother c.1125dupT locus genotype is the wild type.

Example 3

Cryptosporidium VII type diagnostic kit and application

1. The kit comprises the following components:

1) Amplification primers: as shown in 2.6 of example 2, the concentrations and volumes are as in table 8;

2) Buffer concentrations and volumes are as in table 8;

3) Taq enzyme concentration and volume are as in Table 8;

4) dNTPs concentrations and volumes are as in Table 8;

5) c.24_25insGCGGCGCT and c.1125dupT positive mutation reference DNA, wherein the c.24_25insGCGGCGCT positive reference is a section of double-stranded DNA, and the specific sequence is shown as SEQ ID NO. 9; c.1125dupT positive reference is a double-stranded DNA, and the specific sequence is shown as SEQ ID NO. 10.

6) Sequencing primer: as shown in SEQ ID NO. 5-8.

2. The using method comprises the following steps: clinical information for members of family 2, type vii, no.2, no.3 and No.4, applied to family 2, is shown in table 10.

Table 10 clinical information of Cryptosporidium VII family members No.2, no.3 and No.4

As shown in fig. 4, 7 and 10, the numbers i (first generation) and ii (second generation) are used.

Family 2 personnel I1 (father), I2 (mother) peripheral blood DNA and II 1 (induced labor fetus) amniotic fluid DNA are used for sequencing analysis;

family 3 personnel I1 (father), I2 (mother) peripheral blood DNA and II 1 (induced labor fetus) DNA were used for sequencing analysis;

family 4 personnel I1 (father), I2 (mother) peripheral blood DNA and II 1 (induced labor fetus) DNA were used for sequencing analysis.

1) Genomic DNA extraction: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;

3) Purifying the PCR amplification product;

4) Performing BigDye reaction on the PCR product purified by the sequencing primer;

5) Purifying the BiyDye reaction product;

6) Sequencing the BiyDye reaction product, and comparing the sequenced sequence with a normal sequence; the specific procedures of steps 2) to 6) are described with reference to steps 3 to 8 in example 2. The sequencing results are shown in fig. 5, 6, 8, 9, 11 and 12.

The detection result of the kit of FIG. 5 shows that the genotype of the c.24-25 insGCGGCGCT locus of the father and fetus of the family 2 is a "c.24-25 insGCGGCGCT heterozygote", and the genotype of the c.24-25 insGCGGCGCT locus of the mother is a wild type.

The detection result of the kit of FIG. 6 shows that the genotype of the c.1125dupT locus of the mother and the fetus of family 2 is "c.1125dupT heterozygote", and the locus of the father c.1125dupT locus is wild type.

The detection result confirms that the family 2 fetus is a patient with the gristle VII, and the mother and father of the family 2 fetus are mutation gene carriers; the genetic counseling opinion is that the probability of the wife to re-grow the fragile bone disease VII type patient is 1/4, the probability of the child carrier offspring is 1/2, the probability of the child to finish normal individuals is 1/4, and the genetic diagnosis or auxiliary diagnosis before embryo implantation and the later hospital prenatal diagnosis or auxiliary diagnosis after pregnancy are suggested when the wife is scheduled to re-grow.

The detection result confirms that the induced labor fetus of the family 3 is a patient with the gristle type VII, and the mother and father of the induced labor fetus are mutation gene carriers (fig. 8 and 9); the genetic counseling opinion is that the probability of the wife to re-grow the fragile bone disease VII type patient is 1/4, the probability of the child carrier offspring is 1/2, the probability of the child to finish normal individuals is 1/4, and the genetic diagnosis or auxiliary diagnosis before embryo implantation and the later hospital prenatal diagnosis or auxiliary diagnosis after pregnancy are suggested when the wife is scheduled to re-grow.

The detection result confirms that the induced labor fetus of the family 4 is a patient with the gristle type VII, and the mother and father of the induced labor fetus are mutation gene carriers (fig. 11 and 12); the genetic counseling opinion is that the probability of the wife to re-grow the fragile bone disease VII type patient is 1/4, the probability of the child carrier offspring is 1/2, the probability of the child to finish normal individuals is 1/4, and the genetic diagnosis or auxiliary diagnosis before embryo implantation and the later hospital prenatal diagnosis or auxiliary diagnosis after pregnancy are suggested when the wife is scheduled to re-grow.

In conclusion, the diagnosis or auxiliary diagnosis kit prepared by using the CRTAP pathogenic mutant provided by the invention can help screening and diagnosis or auxiliary diagnosis of the mutation of the type VII gene of the gristle, and can specifically distinguish patients, carriers and normal people of the type VII.

While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.

Claims

1. A CRTAP pathogenic mutant, wherein the CRTAP pathogenic mutant comprises c.24_25insGCGGCGCT and/or c.1125dupt;

said c.24_25insGCGGCGCT has a GCGGCGCT insertion mutation between positions 24 and 25 of exon1 under accession No. nm_ 000088.4;

the c.1125dupT has a T repeat mutation at position 1125 of exon6 of accession No. NM-000088.4.

2. Use of the CRTAP pathogenic mutant of claim 1 as a detection target in the preparation of a diagnostic or auxiliary diagnostic reagent or kit for type vii of griseous.

3. Use of the CRTAP pathogenic mutant of claim 1 as a therapeutic target for preparing a medicament for treating gristle type vii.

4. Primers for amplifying the CRTAP pathogenic mutant of claim 1, wherein the primers comprise primer pair 1 and/or primer pair 2; the primer pair 1 comprises CRTAP-1F and CRTAP-1R, and the primer pair 2 comprises CRTAP-2F and CRTAP-2R;

the nucleotide sequence of the CRTAP-1F is shown as SEQ ID NO. 1;

the nucleotide sequence of the CRTAP-1R is shown as SEQ ID NO. 2;

the nucleotide sequence of the CRTAP-2F is shown as SEQ ID NO. 3;

the nucleotide sequence of the CRTAP-2R is shown as SEQ ID NO. 4.

5. The use of the primer according to claim 4 for preparing a diagnostic or auxiliary diagnostic reagent or kit for type VII of griseous.

6. A diagnostic or auxiliary diagnostic reagent for type VII of griseous, characterized in that it comprises the primer according to claim 4.

7. The diagnostic or diagnostic aid of claim 6, further comprising one or more of dntps, PCR buffers, magnesium ions, and Tap polymerase.

8. A diagnostic or auxiliary diagnostic kit of the type vii of griseous, characterized in that it comprises the reagents and sequencing primers of claim 6 or 7.

9. The diagnostic or diagnostic aid kit of claim 8, wherein the sequencing primer comprises sequencing primer pair 1 and/or sequencing primer pair 2; the sequencing primer pair 1 comprises CRTAP-Seq1F and CRTAP-Seq1R, and the sequencing primer pair 2 comprises CRTAP-Seq1F and CRTAP-Seq1R;

the nucleotide sequence of the CRTAP-Seq1F is shown as SEQ ID NO. 5;

the nucleotide sequence of the CRTAP-Seq1R is shown as SEQ ID NO. 6;

the nucleotide sequence of the CRTAP-Seq2F is shown as SEQ ID NO. 7;

the nucleotide sequence of the CRTAP-Seq2R is shown as SEQ ID NO. 8.

10. The diagnostic or auxiliary diagnostic kit according to claim 8 or 9, characterized in that the diagnostic or auxiliary diagnostic kit further comprises DNA1 and/or DNA2; the single-stranded nucleotide sequence of the DNA1 is shown as SEQ ID NO. 9; the single-stranded nucleotide sequence of the DNA2 is shown as SEQ ID NO. 10.