CN115216536A

CN115216536A - Novel NIPBL mutant gene and diagnostic reagent thereof

Info

Publication number: CN115216536A
Application number: CN202210779084.8A
Authority: CN
Inventors: 曾桥; 李婵艺; 刘鑫林
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2022-10-21

Abstract

The invention provides a novel NIPBL mutant gene and a diagnostic reagent thereof, belonging to the technical field of medical diagnosis. The invention discovers for the first time that the mutation of NIPBL-NM-133433.4. The research result of the invention can be used for genetic diagnosis of the delaunay syndrome, provides a new basis and approach for the research on pathogenesis of the delaunay syndrome, provides a new theoretical basis for the treatment of the delaunay syndrome, and can provide a possible drug target for the treatment of the delaunay syndrome.

Description

Novel NIPBL mutant gene and diagnostic reagent thereof

Technical Field

The invention belongs to the technical field of medical diagnosis, and particularly relates to a novel NIPBL mutant gene and a diagnostic reagent thereof.

Background

The german fever syndrome (Corneliade Lange syndrome, cdLS) (MIM 122470) is a relatively rare inherited disease, and the first generalized summary of infants with the same clinical characteristics was made by Cornelia de Lange, the pediatrician in the netherlands in 1933, and the disease was named by its name. The disease is a hereditary disease with involvement of a multi-organ system, shows remarkable genetic heterogeneity and has mild and severe clinical manifestations, and typical patients have the characteristics of special face, severe growth lag, limb deformity and the like. The incidence of CdLS is estimated to be (1.6-2.2)/10 ten thousand, but the precise incidence is not clear since mild patients may not be diagnosed. CdLS is dominant inheritance, mostly sporadic, and also has been reported to cause familial morbidity. It is mainly caused by the associated genetic variation of the mucin complex.

At least 7 genes [ NIPBL (NIPPD-B-like protein) gene, SMC1A gene, SMC3 gene, RAD21 gene, bromodomain-binding protein4 (BRD 4) gene, histone deacetylase 8 (HDAC8) gene, ankyrin repeat domain 11 (ANDKR11) gene ] are found to be associated with CdLS, wherein the SMC1A gene, SMC3 gene, RAD21 gene encode components of fibronectin, the NIPBL gene, HDAC8 gene are regulators of fibronectin, and the most common mutant gene is NIPBL gene mutation.

The NIPBL (MIM 608667) gene variation was first identified as the causative agent of CdLS. The NIPBL gene is located on chromosome 5p13.2, comprises 47 exons and 46 introns, is 189.6kb in gene length, encodes 2804 amino acid NIPBL protein, belongs to the family of chromosomal adhesins, and is involved in the formation of heterodimeric complexes required for the loading of the cohesin onto the chromosome. NIPBL gene variation was present in about 70% of CdLS patients. More than three hundred variations have been reported, including missense variations, nonsense variations, splice variations, insertions, deletions/duplications, etc. The NIPBL gene dose effect is extremely important for human development, and a 15% reduction in gene expression can lead to the CdLS phenotype. In the disease-causing mechanism of NIPBL gene variation, the NIPBL can affect the transcriptional regulation through two ways: the regulation is influenced indirectly by the loading effect on the mucin or directly by the action on the promoter.

Therefore, gene mutation is an important genetic basis for the development of diseases, and gene diagnosis is an important genetic standard for the definitive diagnosis of the Delaunay syndrome. Clinically, corresponding detection techniques need to be established for different mutations and used for determining the cause and disease diagnosis.

Disclosure of Invention

In view of the above, the present invention aims to provide a new NIPBL mutant gene and a diagnostic reagent thereof, which discover for the first time that a new mutation in NIPBL can cause delayer's syndrome, develop a corresponding diagnostic kit based on the new NIPBL mutant gene, assist in screening and diagnosing delayer's syndrome gene mutation, and provide a new technical support for drug screening, drug efficacy evaluation and targeted therapy.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a novel inducible gene of a German fever syndrome, which comprises mutations at the positions of NIPBL, NM-133433.4.

The c.111_112insCA mutation refers to the insertion of two bases, namely C and A, at the 111 < 112 > position of the No.3 exon of a wild-type NIPBL gene to form a NIPBL gene mutant, wherein the nucleotide sequence of the NIPBL gene mutant is preferably shown as SEQ ID NO.6 (AACTACACAAAGAGC).

Compared with the protein coded by a wild type NIPBL gene, the amino acid at the 38 th position is mutated into glutamine (Q) from lysine (K) to cause frame shift mutation and is terminated after the following 8 amino acids, namely the NIPBL mutant protein contains p.K38Qfs 8 mutation, and the mutation is caused by the frame shift mutation of c.111_112 insCA; the amino acid sequence of the NIPBL mutant protein is shown in SEQ ID NO.7 (TQRAFSLMHE).

The invention also provides a detection reagent for the Delang fever syndrome triggered by the novel induced gene, which comprises a specific amplification primer designed aiming at the mutation site of the novel induced gene.

Preferably, the specific amplification primer comprises NIPBL-F and NIPBL-R, the nucleotide sequence of the NIPBL-F is shown as SEQ ID NO.1, and the nucleotide sequence of the NIPBL-R is shown as SEQ ID NO. 2.

The invention also provides a detection kit for the Delang fever syndrome, which comprises the detection reagent.

Preferably, the kit further comprises reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

Preferably, the sequencing primer comprises NIPBL-Seq1 and NIPBL-Seq2, wherein the nucleotide sequence of the NIPBL-Seq1 is shown as SEQ ID NO.3, and the nucleotide sequence of the NIPBL-Seq2 is shown as SEQ ID NO. 4.

The invention also provides an application of the detection reagent or the detection kit in preparing a diagnostic reagent for the Delang fever syndrome.

Preferably, the test sample of the diagnostic reagent includes blood or amniotic fluid.

Has the advantages that: the invention screens the pathogenic gene mutation highly related to the Delang fever syndrome by using exon sequencing, and in order to avoid the occurrence of false positive results, the pathogenic gene mutation of the Delang fever syndrome is finally obtained by Sanger sequencing verification, wherein the sequence of the pathogenic gene mutation is NIPBL, NM-133433.4. The patient with the delaunay fever syndrome can be distinguished from the normal population in the pathogenic gene mutation screened by the invention, so that the pathogenic gene mutation can be used as a biomarker for diagnosing the delaunay fever syndrome. The invention can be used for screening or diagnosing the genetic diagnosis of the Delang fever syndrome by detecting whether a subject carries the mutation or not so as to guide the treatment. The diagnostic kit provided by the invention can be used for quickly and effectively predicting or diagnosing the Delang fever syndrome. The invention lays an important foundation for the research of pathogenesis of the German fever syndrome and provides a brand new theoretical basis for the treatment of the German fever syndrome patient. The invention can provide possible drug targets for treating the Delang fever syndrome.

Drawings

FIG. 1 shows the pedigree genetic map of Delang fever syndrome No. 1; wherein □ denotes a male normal individual,. Smallcircle denotes a female normal individual,. ■ denotes a male patient,. ↗ denotes a proband,. Diamond denotes a fetus;

FIG. 2 shows a graph of the results of the Sanger sequencing for the genotype of the locus NIPBL family 1, NM-133433.4;

FIG. 3 shows the pedigree genetic map of Delang fever syndrome No. 2; wherein □ represents a normal male individual, ∘ represents a normal female individual, ● represents a female patient, ↗ represents a proband;

FIG. 4 shows a graph of the results of the detection of the genotype of the NIPBL family 2, NM-133433.4.

Detailed Description

The invention provides a novel inducible gene of a Delang fever syndrome, which comprises a mutation at the NIPBL site of NM-133433.4.

The novel inducible gene utilizes exon sequencing to screen pathogenic gene mutation highly related to the Delang fever syndrome, and in order to avoid the occurrence of false positive results, the novel inducible gene is finally obtained through Sanger sequencing verification. In the invention, the DNA sequencing result of a sample to be detected is compared with the DNA sequence of a normal human genome, and if the genotype of the NIPBL-NM-133433.4; if the site has no mutation, the NIPBL gene is judged to be wild type, and the individual is a normal person.

The specific amplification primer of the invention preferably comprises:

NIPBL-F(SEQ ID NO.1):TCCCAAAATACAGATAAGCAC；

NIPBL-R(SEQ ID NO.2):CCCCAAGATAAGTTCAAAAGA。

The detection kit of the invention preferably further comprises reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing. Wherein, the sequencing primer preferably comprises:

NIPBL-Seq1(SEQ ID NO.3):CCAAAATACAGATAAGCACTAA，

NIPBL-Seq2 (SEQ ID NO. 4): GAAATAAAACCAGGAATACG. The detection kit of the invention preferably further comprises other conventional reagents in PCR amplification reaction, such as dNTP, PCR buffer solution, magnesium ions, tap polymerase and the like.

The test sample of the diagnostic reagent of the present invention preferably includes blood or amniotic fluid. When the diagnostic reagent of the present invention is used for diagnosing delaunay syndrome, it preferably includes: 1) Extracting sample genome DNA;

2) Amplifying NIPBL gene sequence;

3) DNA sequencing;

4) Comparing the DNA sequencing result of a sample to be detected with a normal human genome DNA sequence, and if the genotype of the NIPBL at the site of NM-133433.4; if the site has no mutation, the NIPBL gene is judged to be wild type, and the individual is a normal person.

The method for amplifying the NIPBL gene sequence is preferably a PCR amplification method, and the system is calculated by 20 mu L, and preferably comprises the following steps: 10 XPCR buffer 2.0. Mu.L, 10mmol/L dNTPs

mu.L 0.4. Mu.L 100 ng/. Mu.L IPBL-F0.5. Mu.L 100 ng/. Mu.L IPBL-R0.5. Mu.L 100 ng/. Mu.L peripheral blood extract DNA 1.0. Mu.L 5 u/. Mu.L LTaq enzyme 0.2. Mu.L and the balance ddH ₂ And O. The system is placed in a PCR instrument, and the program is set as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, extension at 72 ℃ for 60 seconds, and 30 cycles; the extension was carried out at 72 ℃ for 7 minutes. The method for sequencing the DNA is not particularly limited, and the DNA is preferably sequenced by using a conventional sequencing means in the field, such as sanger sequencing.

The present invention provides a novel NIPBL mutant gene and a diagnostic reagent thereof, which will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention. In the present invention, the term "diagnosis" includes prediction of the risk of a disease, diagnosis of the presence or absence of the disease, and evaluation of the prognosis of the disease; the term "mutation" refers to a change in the sequence of a wild-type polynucleotide to a variant, which may be naturally occurring or non-naturally occurring; "primer" refers to a polynucleotide fragment, typically an oligonucleotide, for amplifying a target nucleic acid in a PCR reaction, e.g., a polynucleotide fragment containing at least 5 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases. The primer does not have to be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene. In the present invention, the term "specifically amplifying" means that the primers are capable of amplifying a gene of interest by a PCR reaction without amplifying other genes. For example, specifically amplifying the NIPBL gene means that primers amplify only the NIPBL gene in a PCR reaction without amplifying other genes.

Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the laboratory Manual (New York: cold Spring Harbor laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1 sample acquisition

The inventor finds a delaunar fever syndrome family (called NIPBL family for short), and the clinical information of partial members of the NIPBL family is shown in Table 2. FIG. 1 shows a NIPBL pedigree in which □ denotes a male normal individual,. Smallcircle denotes a female normal individual, ■ denotes a male patient, ↗ denotes a proband,. Diamond denotes a fetus.

1. Diagnostic criteria:

reference can be made to the 2010 edition of human monogenic genetic diseases and the 2018 edition of CdLS International consensus:

the CdLS phenotype is divided into clinical and physical signs, with the phenotype being divided into a main and suggestive trait. The main features refer to the most typical features of CdLS patients, each scoring 2 points in the score, and include the brow or dense eyebrows, depressed nasal bridge, short and short nose with forward nostrils, shallow or long person, thin lips and drooping angle of mouth, little or no finger, congenital diaphragmatic hernia. The suggestive characteristics mean that the expressions are not typical enough, each item has 1 point, and the suggestive characteristics mainly comprise intrauterine growth retardation, postnatal growth retardation, mental retardation, microcephaly, little hand and foot, and the 5 th finger is short and hairy. Based on phenotypic scores, clinical diagnostic criteria for CdLS were established (see table 1).

TABLE 1 clinical diagnostic criteria for Delang fever syndrome

Diagnostic classification	Score of
		Classics type	Score ≧ 11, and there are 3 main characteristics
Classics of classics	The score is 9-10, and 2 main characteristics exist
		Should be subjected to gene detection	Score 4-8, with 1 major feature present
It is not necessary to perform gene detection	Score of<4 is divided into
		Clinical diagnosis	The score is more than or equal to 11 no matter whether the variation of the pathogenic gene exists or not

TABLE 2 clinical information of family members of the Delang fever syndrome

As shown in FIG. 1, I (first generation) and II (second generation) are used as the numbering.

Pedigrees I1 (father), I2 (mother), II 1 (proband) peripheral blood and II 2 (fetus) amniotic fluid DNA were used for sequencing analysis.

Example 2 exon sequencing

1. The instrumentation is shown in table 3.

Table 3 Instrument and Equipment List

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96-well plate (Axygen), different model tips (Axygen), 200 μ L centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye terminator v3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN), EB stain (amereco).

3. Reagent formulation

A stock solution of 5 XTBE electrophoresis solution was prepared as shown in Table 4.

TABLE 4 formulation of 5 XTBE electrophoretic solutions

Reagent	Volume/weight
		Tris	5.4g
Boric acid	750mg
		EDTA(pH8.0,0.5mol/L)	2mL
ddH ₂ O	90mL

By ddH ₂ O adjusted the final volume to 100mL.

Working solution of 0.5 XTBE electrophoresis solution, ddH ₂ Diluting with O10 times.

10 × erythrocyte lysates were prepared according to table 5.

TABLE 5 erythrocyte lysate formulation

Autoclaving, and storing at 4 deg.C.

1 × cell nucleus lysate was prepared as in Table 6.

TABLE 6 formulation of cell nucleus lysate

Reagent	Volume/weight
		2M Tris-HCl,pH8.2	0.5mL
4M NaCl	10mL
		2mM EDTA	0.4mL

4. Experimental procedure

After signing the informed consent, 3-5 mL of peripheral blood and 5-10mL of II 2 (fetus) amniotic fluid of members in the family, such as I1 (father), I2 (mother), II 1 (proband) and the like, are collected.

4.1 sample DNA extraction

1) If the sample is heparin anticoagulated peripheral blood, 3-5 mL of peripheral blood is put into a 15mL centrifuge tube, 1 Xerythrocyte lysate with 2-3 times volume is added, the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent. Amniotic fluid specimens were directly subjected to the next step.

2) Centrifuge at 3000 rpm for 10 minutes at 4 ℃ and carefully remove the supernatant. The pellet was mixed with 1mL of 1 Xcell nucleus lysate, followed by addition of 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS, and the mixture was shaken until it became viscous and transparent. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion was carried out at 37 ℃ for more than 6 hours or overnight.

3) Adding equal volume of saturated phenol, shaking gently, mixing, and centrifuging at 3000 r/min for 10 min.

4) The supernatant was carefully transferred to another centrifuge tube, mixed with an equal volume of phenol/chloroform (1 v/v), and centrifuged at 3000 rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and, if it was not clear, extracted once more with an equal volume of chloroform.

6) The supernatant was transferred to another centrifuge tube, and two times the volume of absolute ethanol was added thereto, followed by shaking to obtain white flocculent DNA. The DNA was hooked out using a flame-sterilized glass hook needle, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. Measuring the OD value by ultraviolet.

7) TE-solubilized DNA can be stored at 4 ℃ for one year, and if long-term storage is required, 2 times the volume of absolute ethanol is added and the DNA is stored at-70 ℃.

4.2 exon sequencing

1) Taking 2 mu g of DNA, mechanically breaking the DNA to ensure that the size of the fragment is about 200bp, cutting the gel and recovering a 150-250bp fragment;

2) Carrying out end repair on the DNA fragment and adding A at the 3' end;

3) Connecting a sequencing joint, purifying a connecting product, performing PCR amplification, and purifying an amplification product;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing agarose gel electrophoresis on a small sample for quality control analysis;

5) NextSeq500 sequencer and data analysis.

4.3 results

Finally, 1 pathogenic gene mutation NIPBL is obtained, wherein the mutation NIPBL is NM-133433.4; the insertion of 2 bases "CA" between bases 111 and 112 results in the amino acid 38 being changed from lysine to glutamine and a frameshift mutation is made and terminates after the next 8 amino acids, the mutated protein having 2758 amino acid residues less than the normal protein. The genotype at the NIPBL-133433.4 site in the pedigree patient was a "c.111_112insCA heterozygote" mutation.

Example 3 Sanger sequencing validation

The NIPBL: NM — 133433.4. The genotype tests of the NIPBL-NM-133433.4 site, NM-111/112insCA, p.K38Qfs 8 site were performed on family members such as I1, I2, II 1, II 2, and 100 family-outside normal persons in example 1, respectively.

The method comprises the following specific steps:

1. DNA extraction

Genomic DNA was extracted according to the method of example 2.

2. Candidate primer design, validation and optimization

2.1 primer design reference human genome sequence database hg 19/built 36.3, primer sequence was synthesized by Shanghai Biotechnology.

2.2 designing 19 pairs of candidate primers for the c.111_112insCA sites respectively (see Table 7), and verifying and evaluating the quality of each pair of candidate primers by using PCR experiment

TABLE 7 basic conditions of each pair of candidate primers and a list of results of the verification experiment

Note: only one specific band exists after electrophoresis of a normal PCR amplification result, and if a primer dimer band and a non-specific product band appear, the primer dimer band and the non-specific product band are both the results of primer abnormal reaction; the target primer avoids this as much as possible. The optimal primer pair is additionally evaluated and selected comprehensively with reference to the following principles:

(1) the length of the primer is 15-30nt, and is usually about 20 nt;

(2) the content of G + C is preferably 40-60%, the amplification effect is poor when the content of G + C is too small, and a non-specific band is easy to appear when the content of G + C is too large. ATGC is preferably randomly distributed;

(3) avoid a tandem reference of more than 5 purine or pyrimidine nucleotides;

(4) no complementary sequence should appear inside the primer;

(5) complementary sequences should not exist between the two primers, especially to avoid complementary overlapping at the 3' end;

(6) the homology of the primer with the sequence of the non-specific amplification region does not exceed 70 percent, and the continuous 8 bases at the tail end of the primer 3' can not have a complete complementary sequence outside the region to be amplified, otherwise, the non-specific amplification is easily caused;

2.3 candidate primer PCR validation reactions

Performing PCR according to the reaction system in Table 8 and keeping the reaction system on ice; 8 reaction test tubes (Nos. 1 to 8 in Table 8) were provided for each pair of primers.

TABLE 8 primer detection PCR reaction System

Reaction conditions are as follows: placing the test reaction tube into a PCR instrument, and executing the following reaction procedures:

the first step is as follows: 5 minutes at 95 ℃;

the second step is that: 30 cycles (95 ℃,30 seconds → Tm,30 seconds → 72 ℃,60 seconds); (the PCR amplification parameters were set according to the Tm values of the primers in Table 6, and the Tm average value was taken for the double primers).

The third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

2.4 agarose gel electrophoresis detection of the candidate primer PCR results to assess the effectiveness, specificity of the primer reaction:

1) The two ends of the cleaned and dried gel sample applicator are sealed by an adhesive tape, the gel sample applicator is placed on a horizontal table, and a comb is placed at a position of about 1cm of one end of the sample applicator.

2) Weighing 2g agar powder into a conical flask, adding 100mL 0.5 XTBE electrophoresis buffer, shaking, heating in microwave oven or electric furnace (adding asbestos gauze), boiling, shaking, heating until the gel is completely melted, and cooling at room temperature.

3) And when the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sample injector to ensure that the thickness is about 5 mm.

4) The gel was solidified to remove the tape and the gel was placed in the electrophoresis tank together with the sample applicator.

5) Adding electrophoresis buffer solution to make the liquid level 1-2mm higher than the glue surface, and pulling out the comb upwards; and (3) respectively and uniformly mixing the sample and the DNA size standard substance with the sample carrying liquid by using a micropipette, and adding the mixture into each sample adding hole, wherein the DNA sinks into the bottom of the hole due to the large specific gravity of the sucrose in the sample carrying liquid.

6) Covering the electrophoresis tank, switching on the power supply, adjusting to proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrier liquid, and determining whether to terminate the electrophoresis.

7) The power was turned off, the gel was taken out and stained in 0.5g/ml EB aqueous solution for 10-15 minutes.

8) The gel was placed under a transmission ultraviolet irradiator to observe the result at a wavelength of 254nm, and photographed with a camera with a red color filter or the electrophoresis result was recorded with a gel scanning system.

2.5 evaluation of results:

1) If only one bright and clear target band appears in the No.7 tube and no other band exists, the pair of primers and the reaction system are judged to have good effectiveness and strong specificity;

2) If no target band appears in the No.7 tube, judging that the pair of primers and the reaction system are invalid;

3) If the primer-primer dimer band outside the target entry appears in the No.7 tube and the primer-dimer band also appears in the No.2, 3, 4, 5 and 6 tubes, the effectiveness of the pair of primers and the reaction system is judged to be poor;

4) If the non-specific band outside the target band appears in the No.7 tube and the non-specific band also appears in the No.5 and No.6 tubes, the specificity of the pair of primers and the reaction system is judged to be poor;

5) If the primer dimer and the non-specific band appear outside the target band in the No.7 tube, and the primer dimer and the non-specific band also appear in the No.2, 3, 4, 5, and 6 tubes, the effectiveness and the specificity of the pair of primers and the reaction system are judged to be poor.

2.6 according to the results of statistics after the verification test in Table 7, the optimal pair (primer No.1 in Table 7) was selected as the primer for mutation family detection, and the primer sequences for the NIPBL: NM-133433.4 at c.111 w 112instCA p.K38Qfs 8 site were as follows:

5’-TCCCAAAATACAGATAAGCAC-3’(SEQ ID NO.1)

5’-CCCCAAGATAAGTTCAAAAGA-3’(SEQ ID NO.2)

3. PCR amplification of mutation sites of family No.1 and 100 family members

PCR was performed according to the reaction system in Table 9 while keeping the reaction system on ice.

TABLE 9 mutant site PCR reaction System

Reaction conditions are as follows: the reaction system was placed in a PCR instrument and the following reaction sequence was performed:

the first step is as follows: 5 minutes at 95 ℃;

the second step: 30 cycles (95 ℃,30 seconds → 54 ℃,30 seconds → 72 ℃,60 seconds);

the third step: 72 ℃ for 7 minutes;

the fourth step: 4 ℃ until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. And (3) carrying out enzymolysis purification on the PCR product: mu.L of exonuclease I (Exo I) and 1. Mu.L of alkaline phosphatase (AIP) were added to 5. Mu.L of the LPCR product, and the mixture was digested at 37 ℃ for 15 minutes and the enzyme was inactivated at 85 ℃ for 15 minutes, respectively.

6. BigDye reaction

The BigDye reaction system is shown in table 10.

TABLE 10 BigDye reaction System

Reagent	Amount of the composition
		DNA after purification of PCR product	2.0μL
3.2 pmol/. Mu.L sequencing primer	1.0μL
		BigDye	0.5μL
5 × BigDye sequencing buffer	2.0μL
		ddH ₂ O	4.5μL

Sequencing PCR cycling conditions:

the first step is as follows: at 96 ℃ for 1 minute;

the second step is that: 33 cycles (96 ℃,30 sec → 55 ℃,15 sec → 60 ℃,4 min);

the third step: 4 ℃ until sampling.

7. Purification of BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, to the bottom of the tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added;

2) Adding 70 μ L70% ethanol, shaking and mixing for 4 times, standing at room temperature for 15 min;

3) 3000g, centrifuging at 4 ℃ for 30 minutes; immediately invert the 96-well plate and centrifuge at 185g for 1 min;

4) The mixture was allowed to stand at room temperature for 5 minutes, the residual alcohol was allowed to evaporate at room temperature, 10. Mu.L of Hi-Di formamide was added to dissolve the DNA, denaturation was carried out at 96 ℃ for 4 minutes, the mixture was quickly placed on ice for 4 minutes, and sequencing was carried out on a machine.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, designing a nested primer (the second group of primers are designed in the range of the product sequence obtained by amplifying the first group of primers) as a sequencing primer on the basis of the PCR optimal primer, wherein the primer sequence is as follows: .

5’-CCAAAATACAGATAAGCACTAA-3’(SEQ ID NO.3)

5’-GAAATAAAACCAGGAATACG-3’(SEQ ID NO.4)

9. Analysis of results

The Sanger sequencing results in figure 2 show that the genetype at position NIPBL NM — 133433.4. The positions indicated by arrows in the sequence diagram of FIG. 2 show that the NIPBL of the patient with the C-layer German fever syndrome, NM-133433.4, exon3, c.111_112insCA, p.K38Qfs, 8 site genotype is the "c.111-112 insCA heterozygote" mutation.

Example 4NIPBL Gene c.111_112insCA mutation diagnosis kit and application

1. The kit comprises the following components:

1) An amplification primer: as shown in example 3

2) Buffer solution

3) Taq enzyme

4)dNTPs

5) NIPBL (N-terminal-binding protein) c.111-112 insCA (terminal protein binding protein) positive mutation reference substance DNA which is a section of double-stranded DNA, and the specific sequence is shown in SEQ ID NO. 5.

6) Sequencing primer: as shown in example 3

2. The using method comprises the following steps:

the method is applied to detection of the mutation of the No.2 family gene.

TABLE 11 clinical information of family Member of Delang fever syndrome No.2

As shown in FIG. 3, I (first generation) and II (second generation) are used as the numbering.

The peripheral blood DNA of family personnel I1 (father), I2 (mother) and II 1 (proband) is used for the detection of the kit.

1) Extracting genome DNA: and extracting the genomic DNA of the sample.

2) Firstly, carrying out PCR amplification reaction by adopting the PCR amplification primer, taq enzyme, buffer solution, dNTPs, sample genome DNA and the like;

3) Purifying PCR amplification products;

4) Carrying out BigDye reaction on the purified PCR product by adopting the sequencing primer;

5) Purifying the BiyDye reaction product;

6) The BiyDye reaction products were sequenced and the sequence compared to the normal sequence.

The test result of the kit (figure 4) shows the result of the genotype of the NIPBL locus of family No.2, NM-133433.4. Genetic counseling suggests that the mutation is a new mutation, the probability of regeneration of like children is low, but the possibility of reproduction chimerism cannot be excluded.

As can be seen from the results of the above examples, the present invention has found a new mutation in the NIPBL gene and confirmed that the new mutation is closely related to the onset of the Delang fever syndrome, and the pathogenic mutant can be used for molecular diagnosis of the Delang fever syndrome and differential diagnosis of related diseases.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> Hunan Jiahui Biotech Ltd

<120> a novel NIPBL mutant gene and diagnostic reagent therefor

<160> 43

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcccaaaata cagataagca c 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccccaagata agttcaaaag a 21

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccaaaataca gataagcact aa 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaataaaac caggaatacg 20

<210> 5

<211> 502

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcccaaaata cagataagca ctaaagagac ttctatagtc actcaatttc taataatctg 60

attttattcc aaatagtcct gaaccagctg cctcttccat ctcctttacc tgctacaact 120

acacaaagag ccttctcttt aatgcacgaa tagcagaaga ggtgaactgc cttttggctt 180

gtagggatga caatttggtt tcacagcttg tccatagcct caaccaggta tcaacagatc 240

acatgtaagt atgatcaatt ttatatctac tataagtgaa aagttttggc cttactaaga 300

gaatccgtat tcctggtttt atttcagaaa tttttagata catagtttat tttttaaaaa 360

tatccatatc cgagggagaa tatagtctta ttgcaataat agattaatga gatttaagta 420

ggcaatattt atttttagat aataattctg acccatgtag ctctatggat attttttcag 480

ctcttttgaa cttatcttgg gg 502

<210> 6

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aactacacaa agagc 15

<210> 7

<211> 10

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Thr Gln Arg Ala Phe Ser Leu Met His Glu

1 5 10

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aagaaatgaa aagcaaggat 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaaataaaac caggaatacg 20

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgaaaagcaa ggatgaata 19

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaataaaacc aggaatacg 19

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tatttgtttg tatgagcgta 20

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ctgttgatac ctggttgag 19

<210> 14

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgaaaagcaa ggatgaata 19

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tctgaaataa aaccaggaa 19

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

aagaaatgaa aagcaagga 19

<210> 17

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tctgaaataa aaccaggaa 19

<210> 18

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tagggttgat tgaggtttg 19

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tccatagagc tacatgggt 19

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tatttgtttg tatgagcgta 20

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

atctgttgat acctggttg 19

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ttaagaaatg aaaagcaagg 20

<210> 23

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aaataaaacc aggaatacg 19

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgaaaagcaa ggatgaata 19

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ctgaaataaa accaggaata 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ttaagaaatg aaaagcaagg 20

<210> 27

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

tctgaaataa aaccaggaa 19

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

tatttgtttg tatgagcgta 20

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

atgggtcaga attattatct 20

<210> 30

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

tgtagggttg attgaggtt 19

<210> 31

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

catagagcta catgggtca 19

<210> 32

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tcccaaaata cagataagc 19

<210> 33

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

cttgatctcg tgatccacc 19

<210> 34

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

attatggtcc aagtgatgt 19

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

atgggtcaga attattatct 20

<210> 36

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

tgtatgagcg tactattga 19

<210> 37

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

ggctatggac aagctgtga 19

<210> 38

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

tgtatgagcg tactattga 19

<210> 39

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

ctcccaaagt gctgggatt 19

<210> 40

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

tcttgctaaa gtgaggtatt t 21

<210> 41

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ggacaagctg tgaaaccaaa t 21

<210> 42

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 42

aagttttgta gggttgattg a 21

<210> 43

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 43

ctcccaaagt gctgggatta c 21

Claims

1. A novel inducible gene of Delang fever syndrome, comprising a mutation at the NIPBL NM-133433.4.

2. A reagent for detecting Delang fever syndrome induced by the novel inducible gene of claim 1, wherein the reagent comprises a specific amplification primer designed for the mutation site of the novel inducible gene.

3. The detection reagent according to claim 1, wherein the specific amplification primer comprises NIPBL-F and NIPBL-R, the nucleotide sequence of the NIPBL-F is shown as SEQ ID No.1, and the nucleotide sequence of the NIPBL-R is shown as SEQ ID No. 2.

4. A kit for detecting Delang fever syndrome, comprising the detection reagent according to claim 2 or 3.

5. The detection kit according to claim 4, further comprising reagents for PCR amplification reaction, and/or reagents and sequencing primers required for DNA sequencing.

6. The detection kit according to claim 5, wherein the sequencing primer comprises NIPBL-Seq1 and NIPBL-Seq2, the nucleotide sequence of the NIPBL-Seq1 is shown as SEQ ID No.3, and the nucleotide sequence of the NIPBL-Seq2 is shown as SEQ ID No. 4.

7. Use of the detection reagent according to claim 2 or 3 or the detection kit according to any one of claims 4 to 6 for the preparation of a diagnostic reagent for the delaunay syndrome.

8. The use of claim 7, wherein the test sample of the diagnostic reagent comprises blood or amniotic fluid.