CN115093973B

CN115093973B - Beauveria bassiana Bb1003 and method for synthesizing nano gold through mediation thereof

Info

Publication number: CN115093973B
Application number: CN202210636440.0A
Authority: CN
Inventors: 李维宏; 刘晨浩; 冯翠萍; 杨宁
Original assignee: Shanxi Agricultural University
Current assignee: Shanxi Agricultural University
Priority date: 2022-06-07
Filing date: 2022-06-07
Publication date: 2023-05-23
Anticipated expiration: 2042-06-07
Also published as: CN115093973A

Abstract

Beauveria bassiana strainBeauveria bassiana) Bb1003 strain was deposited at China general microbiological culture Collection center, with accession number: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing. The method for synthesizing the nano gold by using beauveria bassiana Bb1003 comprises the following steps: (1) activating strains, preparing bacterial suspension and synthesizing nano-gold. The invention provides a new microbial resource for the synthesis of nano gold, and has important application value in the field of biological synthesis of nano materials, in particular to the field of green synthesis of nano gold.

Description

Beauveria bassiana Bb1003 and method for synthesizing nano gold through mediation thereof

Technical Field

The invention relates to the field of nano materials, in particular to a method for synthesizing nano gold by using beauveria bassiana.

Background

The first time gold was extracted in the 5 th century of the male, and was at that time considered one of the most precious substances in the world. Gold is then separated into particles with a particle size less than 100 a nm a more precious material, nano gold (AuNPs). The nano gold is widely applied to various fields of industrial catalysis, biomedicine, environmental monitoring and the like by virtue of unique photoelectric characteristics, good stability and biocompatibility.

The traditional method for synthesizing the nano gold has physical and chemical methods, but both the physical method and the chemical method have respective defects, and the physical method has high energy consumption and high cost, and the chemical method is toxic and harmful and can pollute the environment. Therefore, development of a method for synthesizing nano gold, which is green, low in toxicity, low in cost and mild in reaction condition, has become more and more important. The microbial method for synthesizing the nano Jin Jiuyou effectively combines the nano technology and the biotechnology, and gradually becomes a research hot spot in the field of nano gold synthesis by virtue of the advantages of environmental friendliness, mild conditions, green low toxicity and the like.

Various microorganisms have been reported to have the ability to synthesize nanogold, including bacteria, fungi, actinomycetes, viruses, etc., which synthesize nanogold in various forms using biological components such as self-secreted proteases, reducing sugars, etc. Fungi are more advantageous in the synthesis of nanogold than other microorganisms, mainly in that (1) they have extremely strong growth activity and are capable of producing a large amount of metabolites; (2) has a very strong metal adsorption capacity; (3) Can secrete a great deal of abundant intracellular and extracellular proteins, enzymes, reducing sugar and other biomolecules, can effectively reduce metal ions and synthesize stable nano particles. (4) The synthesized nano gold has the advantages of uniform particle size range, various forms and good monodispersity. Up to now, several tens of fungi having nanogold synthesis ability have been reported, including aspergillus niger, penicillium, fusarium oxysporum, trichoderma, etc.

Disclosure of Invention

The invention aims to provide beauveria bassiana with nano-gold synthesis capability and a method for catalyzing HAuCl by adopting the beauveria bassiana ₄ The method for synthesizing the nano gold has important application value in the field of green synthesis of the nano gold.

The invention is realized by the following technical scheme.

The beauveria bassiana of the inventionBeauveria bassiana) Bb1003 strain was deposited at China general microbiological culture Collection center, with accession number: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing.

The beauveria bassiana Bb1003 is separated from stiff silkworms accidentally found by farmers in the city, the Yangcheng county, the Shanxi province, the Jingcheng province and the Yingzhen silkworm breeding farmers. The strain is inoculated in a spore-producing culture medium, and is placed in a constant temperature incubator with the temperature of 26+/-1 ℃ and the total darkness and the relative humidity of 75+/-5% for culture after inoculation; after 5d, the bacterial strain is observed under an optical microscope to form hyphae and conidiophores, the bacterial colony is milky white in color, the bottom end of the bacterial colony is yellowish, the edge of the bacterial colony is thin, the middle is thick, folds are formed in the middle, and the bacterial colony grows in concentric circles (figure 1). Observation under an optical microscope shows that spore-forming cells are single-born and few clusters are generated; the spore-producing shaft is slender, the knee shape is bent, and the small tooth process is provided; the hyphae are transparent and have a septum and branches near the septum (FIG. 2). Conidia were transparent, smooth, oval or elliptical (fig. 3). The 16SrDNA sequence homology alignment is adopted, and a phylogenetic tree is drawn, as shown in figure 2, and the result shows that: the strain is gathered into a large branch with other beauveria bassiana strains in the database, which shows that the strain has higher similarity with the beauveria bassiana strains in the database. The strain is named beauveria bassiana Bb1003 by combining morphological feature identification and ITS sequence similarity analysis.

The method for synthesizing the nano gold by using beauveria bassiana Bb1003 (Beauveria bassiana) comprises the following steps:

(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture for 2-5 days at 28-30 ℃ for later use;

(2) Preparing a bacterial suspension: inoculating the activated strain prepared in the step (1) into a potato liquid culture medium, fermenting and culturing for 4-7 days at 28-30 ℃ and 150-180 rpm, centrifuging the fermentation liquor at 4000rpm for 30min, washing with sterilized ultrapure water for 2-3 times, and preparing bacterial suspension;

(3) Synthesizing nano gold: adding HAuCl4 into the bacterial suspension prepared in the step (2) to carry out bioconversion reaction to synthesize gold nanoparticles, wherein the conditions are as follows: the OD600 value of the bacterial suspension is 2.0-2.5, the HAuCl4 concentration is 1.0-2.0 mmol/L, the pH is 3-9, the reaction temperature is 30 ℃, the rotation speed of a shaking table is 160 r/min, the reaction time is 6-9 h, the reaction liquid is firstly centrifuged for 5-10 min at 3500 rmp, the supernatant is taken for 10000 rmp, the centrifugation is carried out for 10-30 min, the precipitate is taken, equal amount of distilled water is added for ultrasonic treatment, the centrifugation is repeated for two times, and the obtained precipitate product is dried overnight in a baking oven at 50 ℃, so that the obtained powder is the nano gold.

The activation medium is PDA potato solid medium.

The temperature of the activation culture is preferably 28 ℃, and the time is preferably 3-4 days.

The invention utilizes beauveria bassiana Bb1003 to catalyze HAuCl ₄ Synthesis of gold nanoparticles, which are alloys of gold nanoparticlesProvides a new microbial resource and has important application value in the field of biological synthesis of nano materials, in particular to the field of green synthesis of nano gold.

The beauveria bassiana of the inventionBeauveria bassiana) Relevant test for biosynthesis of nanogold by Bb1003 strain

1. Isolation and identification of strains and molecular biology identification

(1) Isolation and identification of strains

The beauveria bassiana of the inventionBeauveria bassiana) Bb1003 strain is isolated from stiff silkworm accidentally found by silkworm farmers in Yangcheng city county of Jingcheng city, shanxi province. Separating and purifying beauveria bassiana strain from silkworm naturally infected with beauveria bassiana by adopting a concentration gradient dilution method. The specific operation steps are as follows: grinding the silkworm with a sterile mortar pestle in a sterile mortar on an ultra-clean workbench, and fully grinding to obtain crushed silkworm bodies; weighing Bombyx Batryticatus powder 0.1, g, adding small amount of 1% Tween-80 sterile water in ultra clean bench, grinding, and making into 10 mL stock solution, 10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 、10 ^-7 、10 ^-8 、10 ^-9 . 100. Mu.L of each dilution was applied to a medium and cultured in a constant temperature incubator at 26.+ -. 1 ℃ in total darkness and 75.+ -. 5% relative humidity, followed by monospore culture. After the single spore forms the bacterial colony, the spores on each single spore colony are picked and respectively transferred to a new culture medium for culture until the morphological characteristics of the bacterial colony growing on the flat plate are consistent by visual inspection and microscopic examination, so as to obtain pure bacterial bodies, and the pure bacterial bodies are placed in a refrigerator at the temperature of 4 ℃ for standby. The strain after separation and purification is selected by an inoculating loop to be inoculated in a spore-producing culture medium, and the inoculated strain is placed in a constant temperature incubator with the temperature of 26+/-1 ℃ and the total darkness and the relative humidity of 75+/-5% to be cultivated; 5d, observing the mycelium and conidiophore morphology of the strain under an optical microscope; 10 And d, picking mature conidia to observe the form and the size of the conidia. Observation under an optical microscope shows that spore-forming cells are single-born and few clusters are generated; the spore-producing shaft is slender, the knee-like bend is provided with a small tooth process, the hypha is transparent and has a septum, and branches are arranged near the septum (figure 2). Conidia were transparent, smooth, oval or elliptical (fig. 3).

(2) Molecular biology identification of strains

The 20 mg dry separated and purified beauveria bassiana thalli is fully ground into powder by liquid nitrogen, and then DNA is extracted by a fungus genome DNA rapid extraction kit of biological engineering (Shanghai) stock company. Using the fungal ribosomal rDNA region universal primers ITS1 (5 '-TCCGTAGGTGA-ACCTGCGG-3') and ITS4 (5 '-TCCTCCGCTTA TTGAT-ATG C-3'), the strains were cloned containing the full sequence of ITS1-5.8S-ITS2 and fragments of the partial 18S and 28S rDNA.

The PCR reaction system 25. Mu.L comprises: 1. Mu.L of template DNA, 7. Mu. L Taq Plus DNA Polymerase (5U/. Mu.L), 0.5. Mu.L of 50 mM MgSO ₄ 2.5. Mu.L of 10 XPCR Buffer, 2.5. Mu.L of dNTPs (each 10 mM), 1. Mu.L (20. Mu. Mol/L) of primer ITS1 (5 '-TCCGTAGGT GAACCT GCGG3', SQE ID No. 3)/ITS 4 (5'-TCCTCCGCTTATTGA TATGC-3', SQE ID No. 4) each, ddH2O 9.5. Mu.L.

Reaction conditions: denaturation at 95℃for 5 min; denaturation at 94℃for 30 s, renaturation at 57℃for 30 s, extension at 72℃for 90 s; 30 cycles were performed and the repair was extended at 72℃for 10 min.

The PCR products were detected by 1% agarose gel electrophoresis, purified and recovered using a SanPrep column type DNA gel recovery kit, and then submitted to the Shanghai Bioengineering services Co.Ltd for sequencing.

The measured rDNA ITS sequences were submitted to the GenBank website and the measured sequences were aligned to the GenBank database using BLAST software. The test strain and the strain similar to the sequence in GenBank database are taken, and a phylogenetic tree based on partial 18S rDNA-ITS 1-5.8S-ITS2 and partial 28S rDNA sequence is constructed by using the maximum likelihood method (maximum likelihood, ML) of MEGA 7.0 software. Fig. 4 is a phylogenetic tree of beauveria bassiana Bb1003.

The ITS sequence of beauveria bassiana Bb1003 is as follows: ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA

The strain is clustered into a large branch with other beauveria bassiana strains in the database by adopting the homology comparison of the 16SrDNA sequences, which shows that the strain has higher similarity with the beauveria bassiana strains in the database. The strain is named beauveria bassiana Bb1003 by combining morphological feature identification and ITS sequence similarity analysis.

Affecting beauveria bassianaBeauveria bassiana) Experiment of Bb1003 strain for synthesizing nanogold factor

(1) Effect of chloroauric acid concentration and reaction time on synthetic nanoparticles

(1) Activating strains: picking a beauveria bassiana Bb1003 inclined plane strain preserved at 4 ℃ by an inoculating loop, streaking and inoculating the beauveria bassiana Bb1003 inclined plane strain on a potato solid culture medium (PDA), and inversely culturing for 5d at 30 ℃ to activate the strain.

(2) Preparing a bacterial suspension: the activated strain was inoculated in 250mL of a flask containing 100mL of PDB liquid medium in an ultra clean bench, and cultured with shaking at 30℃and 160rpm for 4d to obtain a fermentation broth. Centrifuging the fermentation liquor at 4000rpm for 30min, collecting thalli, washing with sterilized ultrapure water for 2-3 times, and adding 20g of wet thalli into 100mL ultrapure water to obtain bacterial suspension;

(3) synthesizing nano gold: the prepared bacterial suspension is used as a reaction matrix, chloroauric acid solution and the bacterial suspension are mixed according to the volume ratio of 1:1, so that the chloroauric acid concentration in the system is respectively 0.5 mmol/L, 1.0 mmol/L, 2.0 mmol/L, 4.0 mmol/L and 8.0 mmol/L, and the mixture is subjected to light-shielding reaction in a 160 rmp shaking table at 30 ℃ for 18 h. In the synthesis process, the color change of the reaction solution is observed (the color of the generated nano gold is purple and deep purple), the reaction mixture solution with different chloroauric acid concentrations is centrifuged at 3000 rpm for 5 min, nano gold particles can be left in the supernatant, and larger gold particles and thalli are collected in the bottom sediment. And (3) carrying out full-wavelength scanning on the reaction liquid by adopting ultraviolet-visible spectrophotometers at the positions of 1h, 3h, 6h, 9h, 12h and 18h respectively, wherein the detection range is 350-800 nm, the scanning interval is 1.0nm, and comparing full-wavelength scanning results of 5 groups of reaction liquids. The results are shown in FIGS. 5 to 10. The result shows that the strain and chloroauric acid of different concentration systems do not generate nano gold at the time of 1h, the reaction liquid with the chloroauric acid concentration of 1.0 mmol/L and 2.0 mmol/L generates nano gold at the time of 3h, the full-wavelength scanning result shows that the generated purple substance has characteristic absorption peaks between 500 and 600 nm, the generation of gold nano particles is proved, and the amount of nano gold generated by the increase of the reaction time is not obviously increased. And too high or too low chloroauric acid concentration is unfavorable for synthesizing gold nanoparticles.

(2) Influence of pH value on the Synthesis of nanogold

(1) And (2) the two steps are the same as (1) the influence of chloroauric acid concentration and reaction time on the synthesis of nanometer.

(3) Synthesizing nano gold: chloroauric acid is added into the beauveria bassiana Bb1003 bacterial suspension prepared above to enable the concentration of the beauveria bassiana Bb1003 bacterial suspension to be 2.0 mmol/L, the pH values of the beauveria bassiana Bb1003 bacterial suspension are respectively regulated to be 2, 3.1 (natural pH), 7 and 9, and the beauveria bassiana Bb1003 bacterial suspension reacts for 6 hours at 30 ℃ in a dark place. In the synthesis process, the color change of the reaction solution (the color of the generated nano gold is purple and deep purple) is observed, the reaction mixture is centrifuged at 3000 rpm for 5 min, the reaction solution is subjected to full-wavelength scanning by an ultraviolet-visible spectrophotometer, the detection range is 350-800 nm, the scanning interval is 1.0nm, and the full-wavelength scanning results of 4 groups of reaction solutions are compared, so that the result is shown in FIG. 11. The color change is shown in fig. 12. The results showed that no peak occurred when ph=2, indicating that no gold nanoparticles were generated in conjunction with the color change of fig. 12. As the pH of the reaction system increases, the peak value of the absorption peak of the ultraviolet absorption spectrum curve of the nanogold increases and decreases, the peak value is largest at ph=7, and the color is deepest, and the peak value is lowest at ph=9 times, and the color is light purple at ph=3.1 (natural pH). From the above experimental results, it can be explained that ph=7 is relatively suitable for the synthesis of nanogold.

(3) Stability experiment for synthesizing nano gold by beauveria bassiana biology

The synthesized nano Jin Shiwen ℃ is placed for 30 days in a dark place. And then, the gold nanoparticles are better in dispersibility, no precipitation occurs, the color is not changed obviously, and the ultraviolet full-wavelength scanning detection result is shown in figure 13, which shows that the gold nanoparticles synthesized by the bacteria biological method are good in stability.

(4) X-ray powder diffraction (XRD) characterization analysis of nanosilver

Drying the synthesized nano gold powder, grinding the powder into powder, and performing XRD detection and analysis on the condition that CuK alpha is used as a radiation source (lambda= 1.54056A); the voltage of the Cu target X-ray tube is less than or equal to 40 kV, and the current is less than or equal to 40 mA; the scanning range of the 2 theta angle is 5-90 degrees. From analysis of the TEM (fig. 14) and XRD patterns (fig. 15) of the nanogold, it can be seen that 5 diffraction peaks, which occur at 38.32 °, 44.40 °, 64.76 °, 77.68 ° and 81.90 °, are characteristic diffraction peaks of gold, corresponding to Au (111), (200), (220), (311) and (222) crystal planes of a face-centered cubic (FCC) structure, respectively, after comparison with JCPDS standard cards, thereby determining that the product is elemental gold.

(5) Fourier Transform Infrared (FTIR) spectral characterization analysis

Mixing the synthesized nano gold powder with potassium bromide according to the proportion of 1:100, grinding uniformly, tabletting and then placing in an infrared spectrometer for detection and analysis. As shown in FIG. 16, the FTIR spectrum of the nano-gold is 4000-500 cm in wavelength range ^-1 There are some distinct absorption peaks that are caused by stretching vibrations of different types of chemical bonds. 3000-3500 cm ^-1 A strong and broad absorption band appears in the region of 1632.48cm ^-1 Has strong and narrow absorption peak corresponding to the stretching vibration of the hydroxyl group and the stretching vibration of the carbon-oxygen double bond at 2166.54 cm ^-1 The absorption peak at the position is the expansion vibration of carbon-nitrogen bond (amino), which shows that polyhydroxy compound and protein substances participate in the reduction reaction process in the reaction process of synthesizing noble metal nano gold particles by reducing beauveria bassiana Bb1003. The adsorptivity of beauveria bassiana itself has a certain inhibition effect on the agglomeration of gold particles.

(6) Antibacterial property test of nanogold

Activation of the test strain: respectively selecting Escherichia coli, bacillus subtilis and Staphylococcus aureus, inoculating 3 test bacteria stored on 4 ℃ inclined plane into LB liquid medium, and shake culturing 24h to activate the strain.

And (3) bacteriostasis circle test: the antibacterial activity of the nano gold on pathogenic bacteria is tested by adopting a filter paper bacteriostasis method. 3 strains of pathogenic bacteria (such as escherichia coli, bacillus subtilis and staphylococcus aureus) are respectively inoculated in a 100mLLB liquid culture medium for shaking culture at 37 ℃ and 160rpm for 24 hours on a super clean bench, 10 mu L of bacterial liquid is respectively transferred and evenly coated on an LB solid culture medium, sterilized filter paper sheets are placed on the solid culture medium by forceps, the filter paper sheets are soaked in 500mg/L of nano gold solution in advance, the filter paper sheets are used as a control group, the test is repeated for 3 times to measure a bacteriostasis ring, the average value is calculated, and the results are shown in figures 17-19 and table 1, and the upper left colony in figures 17-19 is the control group.

Table 1 antibacterial activity of nanogold synthesized by the method of the invention against pathogenic bacteria (n=3)

Pathogenic bacteria	500mg/L nano gold	Beauveria bassiana fermentation liquor
			Coli bacterium	11.3±0.58	/
Bacillus subtilis	12.1±0.85	/
			Staphylococcus aureus	11.8±1.25	/

Note that: diameter of inhibition zone (unit mm)

As can be seen from Table 1 and FIGS. 14 to 16, the nano gold synthesized by the method of the present invention has an inhibitory effect on both gram-positive bacteria (Staphylococcus aureus, bacillus subtilis) and gram-negative bacteria (Escherichia coli).

Minimum Inhibitory Concentration (MIC) determination: the minimum inhibitory concentration of the nano gold prepared by the invention on three bacteria of escherichia coli, bacillus subtilis and staphylococcus aureus is tested by adopting a test tube dilution method. Preparing nano gold solutions with different concentrations, adding LB liquid medium 3 ml into each test tube, wherein the final concentration of the nano gold is 50, 100, 300, 500 and 1000 mg/L. Then 10 mu L of test bacterial suspension is added into each test tube respectively, the test bacterial suspension is uniformly vibrated, and the test bacterial suspension is placed in a constant temperature shaking table at 37 ℃ for culturing 24 h. Meanwhile, a negative control without adding test bacteria and a positive control without adding nano gold for adding bacteria are arranged. The results determined that MIC values were the lowest antimicrobial concentration in the test tube at which no bacterial growth was observed with the naked eye. The results are shown in Table 2, and the MBC values of the nano gold prepared by the invention on the escherichia coli, the bacillus subtilis and the staphylococcus aureus are all 300 mg/L.

TABLE 2 results of minimum inhibitory test of nanogold synthesized by the method of the invention on pathogenic bacteria

Note that "+" represents bacterial growth and "-" represents aseptic growth.

From the above examples, the present invention provides beauveria bassiana Bb1003 and an application thereof in mediating nano-gold biosynthesis. The invention discovers that beauveria bassiana separated and purified from white stiff silkworm has the capacity of biologically synthesizing nano gold for the first time, and the nano gold obtained by optimizing the conditions affecting the synthesis of the nano gold has higher yield and smaller size. The nano gold has an inhibiting effect on escherichia coli, bacillus subtilis and staphylococcus aureus, and can be used as a nano antibacterial material.

Drawings

FIG. 1 is a colony morphology of beauveria bassiana Bb1003 of the present invention.

FIG. 2 is a diagram showing the mycelium morphology of beauveria bassiana Bb1003 according to the present invention.

FIG. 3 is a spore morphology of beauveria bassiana Bb1003 of the present invention.

FIG. 4 is a phylogenetic tree of beauveria bassiana Bb1003 of the present invention.

FIG. 5 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 1 h.

FIG. 6 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 3 hours.

FIG. 7 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 6 hours.

FIG. 8 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 9 hours.

FIG. 9 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 12 hours.

FIG. 10 is an ultraviolet absorption spectrum diagram of the synthesis of nano gold when beauveria bassiana Bb1003 bacterial suspension is used as a reaction solution and reacts with chloroauric acid with different concentrations for 18 hours.

FIG. 11 is an ultraviolet absorption spectrum diagram of the synthesis of nanogold by using beauveria bassiana Bb1003 bacterial suspension as a reaction solution under different pH conditions.

FIG. 12 shows the color change of the beauveria bassiana Bb1003 suspension as a reaction solution under different pH reaction conditions.

FIG. 13 is an ultraviolet absorption spectrum of the beauveria bassiana Bb1003 bacterial suspension as a nano-gold synthesized by the reaction solution after being placed for 30 days.

Fig. 14 is a TEM image of nanogold synthesized by using beauveria bassiana Bb1003 fermentation broth as a reaction solution.

Fig. 15 is an XRD pattern of the nanogold synthesized by using beauveria bassiana Bb1003 fermentation broth as a reaction solution.

FIG. 16 is a FTIR spectrum of the nanogold synthesized by taking beauveria bassiana Bb1003 fermentation broth as a reaction solution.

FIG. 17 is a graph showing the antibacterial effect of the gold nanoparticles synthesized by the invention on Escherichia coli.

FIG. 18 is a graph showing the bacteriostatic effect of the gold nanoparticles synthesized according to the present invention on Bacillus subtilis.

Figure 19 shows the bacteriostatic effect of the gold nanoparticles synthesized according to the invention on staphylococcus aureus.

Detailed Description

The invention is further illustrated below with reference to examples.

Example 1

The beauveria bassiana Bb1003 is separated from stiff silkworms accidentally found by farmers in the city, the Yangcheng county, the Shanxi province, the Jingcheng province and the Yingzhen silkworm breeding farmers. The 16SrDNA sequence homology alignment is adopted and identified asBeauveria bassiana. The strain is preserved in China general microbiological culture Collection center of China Committee for culture Collection of microorganisms (China) for 9 and 30 days of 2021, and the preservation number is: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing.

Example 2

(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into a PDA potato solid medium, and performing activation culture for 2-5 days at 28-30 ℃ for later use;

(2) Preparing a bacterial suspension: inoculating the activated strain prepared in the step (1) into a potato liquid culture medium, fermenting and culturing for 4-7 days at 28-30 ℃ and 150-180 rpm, centrifuging the fermentation liquor at 4000rpm for 30min, washing for 2-3 times by using sterilized ultrapure water, and preparing bacterial suspension;

Example 3

(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into a PDA potato solid medium, and performing activation culture for 3-4 days at 28 ℃ for later use;

(2) Preparing a bacterial suspension: inoculating the activated strain prepared in the step (1) into a potato liquid culture medium, fermenting and culturing for 5-6 days at 28-29 ℃ and 170-180 rpm, centrifuging the fermentation liquor for 30min at 4000rpm, washing for 3 times with sterilized ultrapure water, and preparing bacterial suspension;

(3) Synthesizing nano gold: adding HAuCl4 into the bacterial suspension prepared in the step (2) to carry out bioconversion reaction to synthesize gold nanoparticles, wherein the conditions are as follows: the OD600 value of the bacterial suspension is 2.0-2.5, the HAuCl4 concentration is 1.0-2.0 mmol/L, the pH is 3-9, the reaction temperature is 30 ℃, the rotation speed of a shaking table is 160 r/min, the reaction time is 6-9 h, the reaction liquid is firstly centrifuged for 5-10 min at 3500 rmp, the supernatant is taken for 10000 rmp, the supernatant is centrifuged for 25-30 min, the precipitate is taken, equal amount of distilled water is added for ultrasonic treatment, the centrifugation is repeated for two times, and the obtained precipitate product is dried overnight in a baking oven at 50 ℃, so that the obtained powder is the nano gold.

Sequence listing

<110> Shanxi university of agriculture

ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA

<120> beauveria bassiana Bb1003 and method for mediating and synthesizing nano gold by using same

<141> 2022-06-07

<160> 0

<170> SIPOSequenceListing 1.0

Claims

1. Using beauveria bassianaBeauveria bassiana) A method for synthesizing nano-gold by Bb1003, comprising the following steps:

(3) Synthesizing nano gold: adding HAuCl4 into the bacterial suspension prepared in the step (2) to carry out bioconversion reaction to synthesize gold nanoparticles, wherein the conditions are as follows: the OD600 value of the bacterial suspension is 2.0-2.5, the HAuCl4 concentration is 1.0-2.0 mmol/L, the pH is 3-9, the reaction temperature is 30 ℃, the rotation speed of a shaking table is 160 r/min, the reaction time is 6-9 h, the reaction liquid is firstly centrifuged for 5-10 min at 3500 rpm, the supernatant is taken and centrifuged for 10-30 min at 10000 rpm, the precipitate is taken, equal amount of distilled water is added for ultrasonic treatment, the centrifugation is repeated for two times, and the obtained precipitate product is dried overnight in a baking oven at 50 ℃, so that the obtained powder is nano gold;

the beauveria bassiana is @ beauveria bassianaBeauveria bassiana) The preservation number of Bb1003 is CGMCC No.23269.