CN111117900B - Aflatoxin B capable of being efficiently degraded1And application thereof - Google Patents

Abstract

The invention aims to provide a method for efficiently degrading aflatoxin B₁The aspergillus terreus is HNGD-TM15 strain screened from soil and identified as aspergillus terreus (A.terreus)Aspergillus terrus) And is preserved in China general microbiological culture collection management center in 2019, 11 and 18 months with the preservation number of CGMCC NO: 18840; the provided HNGD-TM15 bacterial strain can be used for degrading aflatoxin B₁Specifically, the strain fermentation liquor, the fermentation supernatant, the cell suspension and the intracellular substances can degrade the aflatoxin B₁. The HNGD-TM15 strain screened by the invention is used for treating aflatoxin B₁The degradation rate of the product reaches 98.60 percent. The aflatoxin B₁The degradation rate of the degrading bacteria is high, the degradation state is stable, and the requirement of large-scale production is met.

Description

Aflatoxin B capable of being efficiently degraded1And application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a method for efficiently degrading aflatoxin B₁And its application.

Background

Aflatoxin B₁(Aflatoxin B₁，AFB₁) Is a secondary metabolite containing a bifuran ring and an o-naphthone structure and produced by aspergillus flavus, aspergillus terreus, aspergillus parasiticus and the like, and is considered as a grade I natural carcinogen by the world health organization. AFB₁It is mainly found in corn, peanut, nut and cottonseed, and has toxic effectStrong sex, wide pollution and great threat to biological environment, food safety and human health. AFB₁After entering human and animal bodies, the DNA is repaired by cell errors, DNA mutagenesis is caused, the liver becomes the most attacking target organ of the liver, and chronic toxicity can cause a series of subacute or chronic injuries to the liver and even induce liver cancer.

Currently, AFB₁The detoxification method mainly comprises a physical method, a chemical method and a biological method. The physical method mainly comprises a color selection method, a radiation method, an adsorbent adsorption method, a high-temperature heating method and the like; the chemical method is mainly to destroy AFB by chemical reagent₁Thereby decomposing the toxin into a non-toxic or low-toxic substance. At present, the more applied chemical methods mainly comprise a sodium hydroxide method, an ammonia fumigation method, an ozone fumigation method, citric acid detoxification and the like; biological methods currently have two main ways: the microbial adsorption detoxification method has the advantages that firstly, microbes such as yeasts and lactic acid bacteria are subjected to adsorption detoxification, the action mechanism of the microbial adsorption detoxification method is that bacterial cells adsorb toxins to form stable compounds, but the process is easily influenced by temperature and bacterial concentration and is reversible; secondly, the microorganism or the metabolite thereof is degraded and detoxified, and the intracellular enzyme, the extracellular enzyme and the secondary metabolite secreted by the microorganism are utilized to destroy AFB₁Toxic groups of oxanaphtalene and difurane, to AFB₁The toxicity of (2) is reduced and even degraded into nontoxic substances.

At present, a number of microorganisms have been found which are capable of adsorbing AFB₁The complex is formed mainly by yeast and lactic acid bacteria. Some yeasts and lactic acid bacteria bind and adsorb AFB1 through cell walls in a non-covalent bond mode to form a complex, and researches show that dead cells can still adsorb toxin by binding macromolecular substances, metal ions and the like through hydrophobic interaction. BovoF et al adsorbed AFB1 in citric acid-phosphoric acid buffer solution using inactive Saccharomyces cerevisiae (Saccharomyces cerevisiae) in beer fermentation residue, while comparing the effects on binding adsorption in the environment of pH3 and pH6, and showed that the adsorption detoxification rates were 69.4% and 63.8%, respectively, within 60min of adsorption time (Bovo F, Franco L T, Rosim R E, et al1[J].2015, 46(2):577-581)。

AFB₁The toxicity is extremely strong, the medicine has strong carcinogenicity, toxicity causing, mutagenicity and the like, seriously threatens the health of human beings and animals and the safety of stored grains, and the safe and effective detoxification method is found out at all times. The traditional physical and chemical method has different degrees of damage to the quality and nutrition of food, and is easy to cause chemical residue, secondary pollution, high equipment cost and the like. And biological removal of AFB₁The temperature and pH conditions are mild, the detoxification efficiency is high, the original quality of the product is not lost, and thus the AFB can be efficiently degraded₁Is of importance and the determination of the active ingredients.

Disclosure of Invention

Degradation of AFB according to the invention₁In the process, a strain capable of efficiently degrading AFB is screened out₁The strain of (1) and establishes a degraded AFB₁Thereby making up for the deficiencies of the prior art.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the invention provides a method for degrading aflatoxin B₁The strain of (1) is aspergillus terreus (aspergillus terreus), and the preservation number is CGMCC NO: 18840. the preservation date is as follows: 11/18/2019, depository: china general microbiological culture Collection center, preservation Address: institute of microbiology, academy of sciences of china.

The colony morphology of the aspergillus terreus is as follows: the colony has dense velvet texture, flat or radial furrows and slightly raised central part.

The total length of the internal transcription spacer region sequence of the aspergillus terreus is 582bp, the sequence information is compared with the correlation of blast in a GeneBank database after sequencing, phylogenetic analysis is carried out, and the result shows that the homology of the internal transcription spacer region of the strain and the aspergillus terreus KP987086.1 is up to 100 percent, and the aspergillus terreus is identified.

The aspergillus terreus can degrade aflatoxin B₁The application is as follows. The method specifically comprises the following steps:

performing fermentation culture on Aspergillus terreus HNGD-TM15 to obtain fermentation liquor, and fermentingThe supernatant, cell suspension and/or intracellular material can be used for degrading aflatoxin B₁. Wherein the fermentation supernatant degrades aflatoxin B₁The capability is strongest, and the degradation rate can reach 98.60%. Each degradation of 1 mug aflatoxin B₁The used fermentation supernatant is 40-390 mu L, the degradation time is 72h, and the fermentation supernatant is obtained by inoculating the strain to a fermentation culture medium for culture in an inoculum size of 5% and then centrifuging.

The fermentation medium used for fermentation contains 5-7 g of glucose, 2-4 g of beef extract, 5-15 g of peptone, 4-6 g of NaCl and the balance of water per liter, the pH value of the fermentation medium is 3-8, the fermentation temperature of the strain is 30-40 ℃, and the fermentation time is 2-10 days.

The aspergillus terreus can be used for preparing aflatoxin B₁The degradation agent is applied.

The invention has the beneficial effects that:

the invention obtains the high-efficiency degradation AFB through screening by two steps of primary screening and secondary screening₁The Aspergillus terreus of (1). The fermentation liquor, fermentation supernatant, cell suspension and/or intracellular substances of the strain can be applied to degrading AFB₁Wherein in AFB₁The initial concentration is 2.5-20 mug/mL, and the degradation rate of the fermentation liquor can reach 98.60% at the highest under the condition that the degradation time is 72 hours.

Aflatoxin B₁The degradation rate of the degrading bacteria is high, the degradation state is stable, and the requirement of large-scale production is met.

Drawings

FIG. 1 shows the morphology of the HNGD-TM15 strain on primary screening medium.

FIG. 2 shows the degradation of AFB by HNGD-TM15₁Compare the figures before and after.

FIG. 3 is AFB₁The degradation effect of (2). The supernatant represents the fermentation supernatant, the cells represent the cell suspension, and the intracellular fluid represents the intracellular material.

FIG. 4 is an electrophoretogram of HNGD-TM 15. In the figure, MK represents Marker, and IS025-2 represents an amplification product of the internal transcribed spacer of A.terreus of the present invention.

FIG. 5 is a phylogenetic tree of the strain HNGD-TM 15.

FIG. 6 is a colony morphology of the HNGD-TM strain.

FIG. 7 is an optical microscope photograph of the HNGD-TM15 strain.

FIG. 8 is a scanning electron micrograph of the strain HNGD-TM 15.

FIG. 9 is a graph showing the growth of the strain HNGD-TM.

FIG. 10 is an AFB of the present invention₁A flow chart for screening high-efficiency degrading strains.

Preservation information:

preservation time: 11/18/2019;

the name of the depository: china general microbiological culture Collection center;

the preservation number is: CGMCC NO. 18840;

the address of the depository: institute of microbiology, national academy of sciences;

and (3) classification and naming: aspergillus terreus.

Detailed Description

The following examples are intended to better illustrate the technical solutions of the present invention, but not to limit the scope of the present invention.

Example 1 AFB₁Screening of high-efficiency degrading strains

The invention provides a strain capable of efficiently degrading AFB₁The screening process of the strain comprises AFB₁Primary screening and secondary screening of high-efficiency degradation strains. The design concept is shown in fig. 10.

The culture medium used in this example:

prescreening medium (modified Chao's medium) (L)^-1)：0.25g KH₂PO₄，1.0g NH₄NO₃，1.0g CaCl₂，0.25g MgSO_4.7H₂O，1.0mgFeSO₄20g of agar and 1g of coumarin are added with water at normal temperature to make up to 1L, and the pH value is 7.0.

Seed culture solution (PDB) (L)^-1): 200g of potato and 20g of glucose, adding water to complement to 1L at normal temperature, and keeping the pH natural.

Fermentation Medium (L)^-1): beef extract 3g, peptone10g, 6g of glucose and 5g of sodium chloride, and water is added to make up to 1L at normal temperature, and the pH value is 7.0.

(1) Preliminary screening

Due to AFB₁The standard substance has high price and high toxicity, so the AFB with low price and low toxicity is adopted₁Structural analogue coumarin substituted for AFB₁Carbon and energy sources as primary screening media (coumarins, i.e., phthalazone, each AFB₁The molecules all contain a coumarin molecule), and thus, strains that can grow on primary screening media have degraded AFB₁The potential of (2).

Removing impurities from soil samples collected from different habitats, and grinding. Weighing 10g of sample, placing the sample in 90mL of sterile physiological saline (250mL of triangular flask), shaking at a constant temperature of 150r/min for 1h, absorbing 0.20mL of mixed solution, activating the mixed solution in 5mL of sterilized seed culture solution, setting the culture conditions of a gas bath shaker at 150r/min, 37 ℃ and 24h, absorbing 0.2mL of seed culture solution, coating the seed culture solution in a primary screening culture medium plate, standing for 30min, culturing in an incubator at 37 ℃ for 7d in an inverted mode, and observing the growth condition of the strain. Selecting strains with good growth, continuously streaking on a primary screening culture medium plate, storing pure culture after 3 passages in a strain preservation culture medium (2% of potato, 0.2% of glucose and 0.5% of sodium chloride), and preserving at-20 deg.C.

As shown in FIG. 1, the pure culture was sandy brown, the colony had a dense velvet-like texture, flat or radially grooved, slightly raised in the center, and dark yellow to tan in the reverse side. This strain was labeled as HNGD-TM 15.

(2) Functional verification

A single primary screening strain was selected and inoculated into seed medium at a rate of 150r/min, 37 ℃ for 24 hours, followed by inoculation into 100mL fermentation medium (250mL Erlenmeyer flask) at 5% inoculum size at 150r/min, 37 ℃ for 48 hours. 975. mu.L of strain fermentation liquor and 25. mu.L of AFB are taken₁The sample (100. mu.g/mL) was placed in a sterilized 1.5mL brown centrifuge tube and vortexed for 30s to allow AFB₁The concentration is 2.5 mug/mL, and AFB is added into a sterile fermentation medium₁As a blank control. The air bath shaking table is arranged in the darkThe culture conditions are set as 150r/min, 37 ℃ and 72h, and 3 groups of parallel experiments are carried out. Extracting with equal volume of dichloromethane by vortex for 3 times, each time for 30s, placing dichloromethane layer in 15mL test tube, placing in nitrogen blowing instrument, blowing slowly with nitrogen at 35 deg.C, dissolving residue (twice concentrated) with 0.5mL mobile phase (water: methanol: acetonitrile ═ 6: 2: 2), filtering with 0.22 μm organic phase filter membrane, mixing well and injecting sample.

As shown in FIG. 2, the fermentation broth of the screened strain degrades AFB₁The degradation rate of the product reaches 98.60 percent.

Example 2 AFB₁Verification test of high-efficiency degrading strain

The screened AFB₁The high-efficiency degradation strain is cultured according to the following steps:

1. activation of bacterial strains

Inoculating the strain into seed culture medium (each liter of seed culture medium contains potato 200g and glucose 20g, adding water at normal temperature to make up to 1L, and naturally adjusting pH), activating, and shake culturing at 37 deg.C for 24 hr.

2. Fermentation of bacterial strains

Inoculating the activated strain (inoculum size is 5%) into a fermentation medium (each liter of the fermentation medium contains 3g of beef extract, 10g of peptone, 6g of glucose and 5g of sodium chloride, adding water at normal temperature to supplement to 1L, and culturing at 37 ℃ for 48h in a shaking table.

3. Fermentation broth degradation experiment

975. mu.L of fermentation broth and 25. mu.L of 100. mu.g/mL AFB₁Mixing the standard substances to obtain AFB₁Was cultured in a shaker at 37 ℃ for 72 hours in the dark at a final concentration of 2.5. mu.g/mL. After the reaction is finished, extracting dichloromethane with the same volume for 3 times by vortex oscillation, each time for 30s, putting a dichloromethane layer into a 15mL test tube, placing the test tube in a nitrogen blowing instrument, slowly drying the test tube at 35 ℃ by nitrogen, dissolving residues with 0.5mL of mobile phase (water: methanol: acetonitrile: 6: 2: 2), filtering the solution with a 0.22 mu m organic phase filter membrane, detecting the solution by a high performance liquid chromatograph, determining the peak appearance time, quantifying the peak area, and calculating the degradation rate.

Calculating the formula:

4. degradation experiment of fermentation supernatant

A single primary screening strain was selected and inoculated into seed medium at a rate of 150r/min, 37 ℃ for 24 hours, followed by inoculation into 100mL fermentation medium (250mL Erlenmeyer flask) at 5% inoculum size at 150r/min, 37 ℃ for 48 hours. Centrifuging the strain fermentation liquid at 4 deg.C and 12000r/min for 20min, collecting 975 μ L strain supernatant and 25 μ L AFB₁The sample (100. mu.g/mL) was placed in a sterilized 1.5mL brown centrifuge tube and vortexed for 30s to allow AFB₁The concentration was 2.5. mu.g/mL. The air bath shaking table is placed in the dark, the culture conditions are set to be 150r/min, 37 ℃ and 72h, and 3 groups of parallel experiments are carried out. After the reaction is finished, extracting dichloromethane with the same volume for 3 times by vortex shaking for 30s each time, putting a dichloromethane layer into a 15mL test tube, placing the test tube in a nitrogen blowing instrument, slowly drying the test tube at 35 ℃ by nitrogen, dissolving residues (concentrated once) by using 0.5mL mobile phase (water: methanol: acetonitrile: 6: 2: 2), filtering the solution by using a 0.22 mu m organic phase filter membrane, and uniformly mixing and injecting samples.

5. Cell suspension degradation experiments

A single primary screening strain was selected and inoculated into seed medium at a rate of 150r/min, 37 ℃ for 24 hours, followed by inoculation into 100mL fermentation medium (250mL Erlenmeyer flask) at 5% inoculum size at 150r/min, 37 ℃ for 48 hours. 2) Centrifuging the strain fermentation liquid at 4 deg.C and 12000r/min for 20min, discarding supernatant, dissolving cells with phosphate (50mmol/L, pH7.0) to obtain bacterial suspension, mixing 975 μ L bacterial suspension with 25 μ L AFB₁The sample (100. mu.g/mL) was placed in a sterilized 1.5mL brown centrifuge tube and vortexed for 30s to allow AFB₁The concentration was 2.5. mu.g/mL. The air bath shaking table is placed in the dark, the culture conditions are set to be 150r/min, 37 ℃ and 72h, and 3 groups of parallel experiments are carried out. After the reaction is finished, extracting dichloromethane with the same volume for 3 times by vortex shaking for 30s each time, putting a dichloromethane layer into a 15mL test tube, placing the test tube in a nitrogen blowing instrument, slowly drying the test tube at 35 ℃ by nitrogen, dissolving residues (concentrated once) by using 0.5mL mobile phase (water: methanol: acetonitrile: 6: 2: 2), filtering the solution by using a 0.22 mu m organic phase filter membrane, and uniformly mixing and injecting samples.

6. Intracellular substance degradation experiments

A single primary screening strain was selected and inoculated into seed medium at a rate of 150r/min, 37 ℃ for 24 hours, followed by inoculation into 100mL fermentation medium (250mL Erlenmeyer flask) at 5% inoculum size at 150r/min, 37 ℃ for 48 hours. 2) Centrifuging the strain fermentation liquid for 20min at 4 ℃ and 12000r/min, discarding the supernatant, washing the centrifuged precipitate twice by using a phosphate (50mmol/L, pH7.0) buffer solution, finally dissolving the precipitate in the phosphate buffer solution to prepare a bacterial cell suspension, crushing the cell suspension on ice by using an ultrasonic cell crusher (5s, 33min, 2 times), then freezing and centrifuging for 20min at 12000r/min, taking the supernatant, and performing sterile suction filtration by using a 0.22 mu m suction filter to obtain a filtrate, namely the intracellular extract. Mixing 975 μ L intracellular extract with 25 μ L AFB₁(100. mu.g/mL) and vortexed for 30s to induce AFB₁The final concentration of (2.5 mu g/mL) was determined, sterile phosphate solution was used as a blank control, after the reaction was completed, the same volume of dichloromethane was extracted by vortex shaking for 3 times, each time for 30s, the dichloromethane layer was placed in a 15mL test tube, placed in a nitrogen blower, slowly dried at 35 ℃ with nitrogen, the residue was dissolved in 0.5mL mobile phase (water: methanol: acetonitrile: 6: 2: 2), filtered through a 0.22 mu m organic phase filter, and the sample was added by mixing.

The above degradation effect is shown in fig. 3. The results show that the degradation rate of the fermentation liquor is 85.27%, the degradation rate of the fermentation supernatant is 98.60%, the degradation rate of the cell suspension is 27.63%, and the degradation rate of intracellular substances is 5.05%. The degradation effect of the fermentation supernatant is optimal, and the degradation rate is obviously higher than that of fermentation liquor, cell suspension and intracellular substances.

7. Different amounts of fermentation supernatants to different concentrations of AFB₁Degradation experiment of

A single primary screening strain was selected and inoculated into seed medium at a rate of 150r/min, 37 ℃ for 24 hours, followed by inoculation into 100mL fermentation medium (250mL Erlenmeyer flask) at 5% inoculum size at 150r/min, 37 ℃ for 48 hours. Centrifuging the strain fermentation liquid at 4 deg.C and 12000r/min for 20min, and collecting 950 μ L, 900 μ L, and 800 μ L fermentation supernatantRespectively 50 μ L, 100 μ L, 200 μ L AFB₁The sample (100. mu.g/mL) was placed in a sterilized 1.5mL brown centrifuge tube and vortexed for 30s to allow AFB₁The concentrations were 5. mu.g/mL, 10. mu.g/mL, and 20. mu.g/mL, respectively. The air bath shaking table is placed in the dark, the culture conditions are set to be 150r/min, 37 ℃ and 72h, and 3 groups of parallel experiments are carried out. After the reaction is finished, extracting dichloromethane with the same volume for 3 times by vortex shaking for 30s each time, putting a dichloromethane layer into a 15mL test tube, placing the test tube in a nitrogen blowing instrument, slowly drying the test tube at 35 ℃ by nitrogen, dissolving residues (concentrated once) by using 0.5mL mobile phase (water: methanol: acetonitrile: 6: 2: 2), filtering the solution by using a 0.22 mu m organic phase filter membrane, and uniformly mixing and injecting samples.

The results showed that 950. mu.L, 900. mu.L, and 800. mu.L of fermentation supernatant were treated with AFB at concentrations of 5. mu.g/mL, 10. mu.g/mL, and 20. mu.g/mL, respectively₁The degradation rates of (A) were 90.5%, 87.7% and 80.3%, respectively.

Example 3 AFB₁Identification of highly effective degrading strains

1. Genomic DNA extraction

(1) 20mg of dried mycelium was ground into powder with liquid nitrogen and added to a 1.5ml centrifuge tube. Add 200 u LBuffer digest and 20 u L beta mercaptoethanol, then add 20 u L protease K solution, shake and mix. The cells were completely lysed by bathing in 56 ℃ water for 1 h.

(2) Add 100. mu.L Buffer PF, mix well by inversion, -20 ℃ refrigerator for 5 min.

(3) Centrifuge at 10000rpm for 5min at room temperature and transfer the supernatant to a new 1.5ml centrifuge tube.

(4) Add 200. mu.L of Buffer BD and mix well by inversion.

(5) Add 200. mu.L of absolute ethanol and mix well by inversion.

(6) Putting the adsorption column into a collecting pipe, adding the solution and the semitransparent fibrous suspended matters into the adsorption column by a liquid transfer device, standing for 2min, centrifuging at 10000rpm at room temperature for 1min, and pouring off waste liquid in the collecting pipe.

(7) The adsorption column was returned to the collection tube, 500. mu.L of PW Solution was added, and the collection tube was centrifuged at 10000rpm for 30s to discard the waste liquid.

(8) The adsorption column was returned to the collection tube, 500. mu.L of Wash Solution was added, and the collection tube was centrifuged at 10000rpm for 30s to discard the waste Solution.

(9) The column was replaced in the collection tube and centrifuged at 12000rpm for 2min at room temperature to remove the remaining Washsolution.

(10) Taking out the adsorption column, placing into a new 1.5ml centrifuge tube, adding 50 μ L TE Buffer, standing for 3min, centrifuging at 12000rpm for 2min at room temperature, collecting DNA solution, and immediately performing next experiment or storing at-20 deg.C.

2. PCR amplification

(1) Primer and method for producing the same

Primer name	Sequence (5 '-3')
		ITS1(F)	TCCGTAGGTGAACCTGCGG
ITS4(R)	TCCTCCGCTTATTGATATGC

The primer pair is used for amplifying transcription spacers 1 and 2 in the strain, and the size is about 600 bp.

(1) PCR reaction system

Reagent	Volume (μ L)
		Template (genome DNA 20-50 ng/. mu.L)	0.5
10×Buffer(with Mg2+)	2.5
		dNTPs (2.5 mM each)	1
Enzyme	0.2
		F(10uM)	0.5
R(10uM)	0.5
		Double steam adding H2O to	25

(3) PCR cycling system

(4) Gel electrophoresis

Taking 5 mu L of 1% agarose gel for electrophoresis of PCR products, and the electrophoresis parameters are as follows: and (3) carrying out electrophoresis observation at 150V and 100mA for 10-20 min. As a result, the amplification product was about 600bp in size, as shown in FIG. 4.

(5) Purification and recovery

First, the DNA fragment was separated from other fragments as much as possible by agarose gel electrophoresis, and the agarose gel electrophoresis piece containing the target DNA was cut with a clean scalpel blade, and placed in a 1.5ml centrifuge tube and weighed.

Secondly, adding 300-600 mu L of Buffer B2 into 100mg of agarose (if the mass is less than 100mg, the water is used for supplementing to 100mg) according to the weight and the concentration of the gel mass.

And thirdly, placing the centrifugal tube in a water bath at 50 ℃ for 5-10 min, and mixing the materials uniformly at intervals until the glue blocks are completely dissolved.

Fourthly, transferring all the dissolved solution into an adsorption column, and centrifuging for 30sec at 8000 Xg. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.

Fifthly, adding 500 mu L of Wash Solution into the adsorption tube, and centrifuging for 30sec at 9000 Xg. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.

Sixthly, repeating the step 5 once.

Seventhly, placing the air adsorption column and the collecting pipe into a centrifuge, and centrifuging for 1min at 9000 Xg.

Eighthly, adding 15-40 mu L of precipitation Buffer in the center of the adsorption film, standing at room temperature for 1-2 min, and centrifuging at 9000 Xg

For 1 min. The resulting DNA solution was stored at-20 ℃ or used for subsequent experiments.

3. Sequencing

PCR sequencing reaction system

Purified PCR product	10ng/μL	1μL
			BigDye	2.5×	4μL
BigDyeSeq Buffer	5×	2μL
			Sequencing primer	3.2pmol/μL	1μL
Sterilizing deionized water	/	12μL
			Total volume	/	20μL

PCR sequencing reaction parameters

4. Sequencing product purification

Add 2. mu.L 125mM EDTA and 2. mu.L 3M NaAc to the solution in sequence per 96 wells, add 50. mu.L 100% ethanol, cover, shake 4 times, room temperature 15 min. Centrifuging at 3000 Xg 4 deg.C for 30 min; immediately invert the 96-well plate, centrifuge to 185Xg, immediately turn off the power supply to the centrifuge, and stop the centrifugation. Adding 70 μ L70% ethanol, centrifuging at 3000 Xg 4 deg.C for 15 min; immediately invert the 96-well plate and centrifuge to 185Xg, turn off the centrifuge power. This step can be repeated 1 time. The alcohol was allowed to evaporate clean at room temperature, and 10. mu.L of Hi-Di Formamide was added to dissolve the DNA. Denaturation on PCR instrument: 95 ℃ for 4min and 4 ℃ for 4 min.

5. And (5) electrophoresis on a machine.

6. The data analysis shows that the sequence result is shown in SEQ ID NO. 1.

7. As shown in FIG. 5, the homology between the internal transcription blocker of the strain HNGD-TM15 and Aspergillus terreus KP987086.1 is as high as 100%, and the strain is determined to be Aspergillus terreus by combining the colony characteristics.

Example 4 morphological Observation of HNGD-TM15

1. Observation of colony morphology

Observations of colony morphology were performed on primary sieve (modified Chao's) medium and potato dextrose solids (PDA) medium, respectively. The results are shown in FIG. 6.

Efficient degradation of AFB₁The aspergillus terreus HNGD-TM15 bacterial colony has compact velvet texture, flat or radial furrows, slightly raised central part and dark yellow to tan colony reverse surface.

After the strain is cultured for 7 days, the colony morphology is changed, the front side of the colony gradually changes from white to light yellow, and the back side of the colony is dark yellow.

2. Observation with an optical microscope

An appropriate amount of the strain HNGD-TM15 was picked up and placed on a glass slide, covered with a cover slip, fixed on an alcohol burner flame, and placed on an optical microscope for observation, and the results are shown in FIG. 7.

Under a microscope, conidiophores, short pedicel stems, hemispheric top sacs, spherical or nearly spherical conidiophores are grown from the substrate.

3. Observation by scanning electron microscope

As shown in FIG. 9, the hyphae of this strain covered a large number of spores.

Example 5 growth Curve determination of the HNGD-TM15 Strain

Potato dextrose agar Medium (PDA) (L)^-1): 200g of potato, 20g of glucose and 20g of agar, adding water at normal temperature to complement to 1L, and keeping the pH natural;

fermentation Medium (L)^-1): 3g of beef extract, 10g of peptone, 6g of glucose and 5g of sodium chloride, and water is added to make up to 1L at normal temperature, and the pH value is 7.0.

The HNGD-TM15 strain grown on the PDA medium was gently scraped into a triangular flask (250mL) containing 100mL of sterilized physiological saline using a sterile inoculating loop, the triangular flask was placed in a gas bath constant temperature shaking table (28 ℃, 150r/min), shaken for 1h, 5. mu.L of the solution was pipetted and inoculated into a fermentation culture triangular flask (250mL) containing 100mL, the triangular flask was placed in a gas bath constant temperature shaking table (37 ℃, 150r/min), shaking-cultured, and one flask of culture was taken every 12h for measurement. When the determination is carried out, all cultures in the triangular flask are filtered on a piece of filter paper, then the obtained filtered substance is put into an oven with the temperature of 80 ℃ to be dried to constant weight, and finally an analytical balance is used for weighing to calculate the biomass of the thalli (when the mass of the filter paper is subtracted when the biomass of the thalli is calculated). As shown in FIG. 10, the time periods 0-24 h are lag periods, 24-72 h are logarithmic periods, 72-132 h are stationary periods, and 132-168 h are decay periods. It was further verified that the fermentation time of 48h for the HNGD-TM15 strain was suitable.

The above embodiments are merely preferred embodiments of the present invention, and not intended to limit the scope of the invention, so that equivalent changes or modifications made based on the structure, characteristics and principles of the invention should be included in the claims of the present invention.

Sequence listing

<110> industrial university of Henan

<120> bacterial strain for efficiently degrading aflatoxin B1 and application thereof

<130> do not

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>582

<212>DNA

<213> Aspergillus terreus (Aspergillus terreus)

<400>1

tgcggaagga tcattaccga gtgcgggtcc tcgtggccca acctcccacc cgtgactatt 60

gtaccttgtt gcttcggcgg gcccgccagc ttgctggccg ccggggggcg tctcgccccc 120

gggcccgtgc ccgccggaga ccccaacatg aaccctgttc tgaaagcttg cagtctgagt 180

tgtgattctt tgcaatcagt taaaactttc aacaatggat ctcttggttc cggcatcgat 240

gaagaacgca gcgaaatgcg ataactaatg tgaattgcag aattcagtga atcatcgagt 300

ctttgaacgc acattgcgcc ccctggtatt ccggggggca tgcctgtccg agcgtcattg 360

ctgccctcaa gcccggcttg tgtgttgggt cctcgtcccc cggctcccgg gggacgggcc 420

cgaaaggcag cggcggcacc gcgtccggtc ctcgagcgta tggggctttg tcttccgctc 480

tgtaggcccg gccggcgccc gccgacgcat ttttttgcaa cttgtttttt tccaggttga 540

cctcggatca ggtagggata cccgctgaac ttaagcatat ca 582

Claims (7)

1. Aflatoxin B capable of being efficiently degraded₁The strain of (1), wherein the strain is Aspergillus terreus (Aspergillus terreus)Aspergillus Terreus) HNGD-TM15, the preservation number is CGMCC NO: 18840.

2. the strain of claim 1 degrading aflatoxin B₁The use of (1).

3. Use according to claim 2, characterized in that the fermentation product of the strain is used for the degradation of aflatoxin B₁The fermentation product is fermentation liquor, fermentation supernatant, cell suspension and/or intracellular substances.

4. Use according to claim 2, characterized in that the fermentation product of the strain is used for the degradation of aflatoxin B₁And the fermentation product is fermentation supernatant.

5. Use according to claim 4, characterized in that aflatoxin B is present at 1 μ g per degradation₁The used fermentation supernatant is 40-390 mu L, the degradation time is 72h, and the fermentation supernatant is obtained by inoculating the strain to a fermentation medium for culture in an inoculum size of 5% v/v and then centrifuging.

6. The application of claim 3, wherein the fermentation medium used for fermentation contains 5-7 g of glucose, 2-4 g of beef extract, 5-15 g of peptone and 4-6 g of NaCl per liter, and the balance is water, the pH value of the fermentation medium is 3-8, the fermentation temperature of the strain is 30-40 ℃, and the fermentation time is 2-10 days.

7. The bacterium according to claim 1Preparation of aflatoxin B by strain₁Application in a degradation agent.

Images