CN114891647B - Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003 - Google Patents

Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003 Download PDF

Info

Publication number
CN114891647B
CN114891647B CN202210636439.8A CN202210636439A CN114891647B CN 114891647 B CN114891647 B CN 114891647B CN 202210636439 A CN202210636439 A CN 202210636439A CN 114891647 B CN114891647 B CN 114891647B
Authority
CN
China
Prior art keywords
beauveria bassiana
nano silver
silver
synthesizing
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210636439.8A
Other languages
Chinese (zh)
Other versions
CN114891647A (en
Inventor
杨宁
冯翠萍
李维宏
刘晨浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi Agricultural University
Original Assignee
Shanxi Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi Agricultural University filed Critical Shanxi Agricultural University
Priority to CN202210636439.8A priority Critical patent/CN114891647B/en
Publication of CN114891647A publication Critical patent/CN114891647A/en
Application granted granted Critical
Publication of CN114891647B publication Critical patent/CN114891647B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F1/00—Metallic powder; Treatment of metallic powder, e.g. to facilitate working or to improve properties
    • B22F1/05—Metallic powder characterised by the size or surface area of the particles
    • B22F1/054—Nanosized particles
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F9/00—Making metallic powder or suspensions thereof
    • B22F9/16—Making metallic powder or suspensions thereof using chemical processes
    • B22F9/18—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds
    • B22F9/24—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds starting from liquid metal compounds, e.g. solutions
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y40/00—Manufacture or treatment of nanostructures
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Nanotechnology (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Composite Materials (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Materials Engineering (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Manufacturing & Machinery (AREA)
  • Inorganic Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Beauveria bassiana strainBeauveria bassiana) Bb1003 strain was deposited at China general microbiological culture Collection center, with accession number: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing. The method for synthesizing the nano silver by utilizing beauveria bassiana Bb1003 and mediation thereof comprises the following steps: (1) activating strains, preparing fermentation liquor and synthesizing nano silver. The method for synthesizing the nano silver is simple and convenient to operate, green, nontoxic, environment-friendly and energy-saving; the application of fungi in the green synthesis of nano materials is expanded, a new microbial resource is provided for the biosynthesis of nano silver, and the method has important application value in the field of the biosynthesis of nano materials, especially in the field of the green synthesis of nano silver. The nano silver synthesized by the invention has an inhibition effect on various pathogenic bacteria, and has good antibacterial effect on gram-positive bacteria and gram-negative bacteria.

Description

Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003
Technical Field
The invention belongs to the technical field of nano materials, and particularly relates to a method for synthesizing nano silver by using beauveria bassiana.
Background
Nano-materials refer to materials whose constituent units have at least one dimension in three dimensions ranging from 1nm to 100nm. Nano silver means that the grain size of the metallic silver is 1-100nm. In recent years, unique chemical, physical and biological properties imparted by their small size have been widely used in various fields such as biomedical, optical, magnetic, agricultural, environmental, etc.
Human knowledge of silver has been over 4000 years old. Silver is an important noble metal, and is found in the natural world as a simple substance, but is present in the silver ore for the most part in a combined form. Silver has stable physical and chemical properties, good heat and electric conductivity, soft quality, high ductility, extremely high reflectivity of more than 99 percent and a plurality of important applications. With the rapid development of nano technology, the nano silver simple substance shows unique physicochemical properties and biological properties, and becomes one of the nano materials with the most development potential.
At present, the traditional synthesis method mainly comprises a physical method and a chemical method, but with the increase of the industrial demand for nano silver, the traditional technology for synthesizing nano silver gradually exposes the defects. The physical method utilizes the physical method to produce the silver nano material and the gold nano material, and has the advantages of simple reaction principle, less impurity of obtained products, high purity and the like, but the defects are obvious, firstly, the requirements are more severe, the production cost is expensive, and the obtained products are more single. The chemical method is a method requiring more reducing agents, which have strong toxicity, are expensive and cause serious pollution to the environment. Along with the proposal of the green chemical concept, the synthesis method of the nano silver also needs to develop in the directions of economy, simplicity, high efficiency, green, non-toxicity, environmental protection and energy saving. Biological methods are therefore becoming increasingly interesting as a method of synthesizing nanoparticles that have emerged in recent years. As the microorganisms have the advantages of wide distribution, easy culture, rapid propagation and the like, the microbial preparation has great potential as a natural biological material for the intracellular or extracellular controllable synthesis research of nano silver. Up to now, studies have shown that various microorganisms including prokaryotes and eukaryotes in nature can synthesize nanosilver, such as bacteria, yeasts, fungi, etc., which have the ability to synthesize nanosilver inside or outside cells.
Disclosure of Invention
The invention provides beauveria bassiana Bb1003 and a method for synthesizing nano silver by mediation thereof, which aim to meet the green development principle, and are low in cost, high in efficiency, rapid, nontoxic and environment-friendly.
The invention is realized by the following technical scheme.
The beauveria bassiana of the inventionBeauveria bassiana) Bb1003 strain was deposited at China general microbiological culture Collection center, with accession number: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing.
The beauveria bassiana Bb1003 is separated from stiff silkworms accidentally found by farmers in the city, the Yangcheng county, the Shanxi province, the Jingcheng province and the Yingzhen silkworm breeding farmers. The strain is inoculated in a spore-producing culture medium, and is placed in a constant temperature incubator with the temperature of 26+/-1 ℃ and the total darkness and the relative humidity of 75+/-5% for culture after inoculation; after 5d, the bacterial strain is observed under an optical microscope to form hyphae and conidiophores, the bacterial colony is milky white in color, the bottom end of the bacterial colony is yellowish, the edge of the bacterial colony is thin, the middle is thick, folds are formed in the middle, and the bacterial colony grows in concentric circles (figure 1). Observation under an optical microscope shows that spore-forming cells are single-born and few clusters are generated; the spore-producing shaft is slender, the knee shape is bent, and the small tooth process is provided; the hyphae are transparent and have a septum and branches near the septum (FIG. 2). Conidia were transparent, smooth, oval or elliptical (fig. 3). The 16SrDNA sequence homology alignment is adopted, and a phylogenetic tree is drawn, as shown in figure 2, and the result shows that: the strain is gathered into a large branch with other beauveria bassiana strains in the database, which shows that the strain has higher similarity with the beauveria bassiana strains in the database. The strain is named beauveria bassiana Bb1003 by combining morphological feature identification and ITS sequence similarity analysis.
Beauveria bassiana Bb 1003%Beauveria bassiana) A method for synthesizing nano silver, comprising the steps of:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture for 2-5 days at 28-30 ℃ for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 4-7 days at the temperature of 28-30 ℃ and the speed of 150-180 rpm, centrifuging the fermentation liquor at the rotating speed of 4000rpm for 30min, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: adding 1-4 mmol/L of silver nitrate solution into the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, reacting for 2-24 hours under the condition of pH 4-9, centrifuging for 10-30 min under the centrifugation condition of 10000rpm, taking the precipitate, adding distilled water with equivalent amount for ultrasonic treatment, repeating the centrifugation for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain the nano silver powder.
The activation medium is PDA potato solid medium.
The temperature of the activation culture is preferably 28 ℃, and the time is preferably 3-4 days.
The fermentation medium is PDB potato liquid medium.
The fermentation culture is preferably carried out in a constant temperature shaking incubator, the temperature is preferably 30 ℃, the rotating speed is preferably 160rpm, and the time is preferably 5-6 days.
The beauveria bassiana Bb1003 and the method for synthesizing nano silver by mediation thereof accord with the principle of green development, and can synthesize nano silver with low cost, high efficiency, high speed, no toxicity, no pollution and environmental protection.
The beauveria bassiana of the inventionBeauveria bassiana) Relevant test for biosynthesis of nano silver by Bb1003 strain
1. Isolation and identification of strains and molecular biology identification
(1) Isolation and identification of strains
The beauveria bassiana of the inventionBeauveria bassiana) Bb1003 strain is isolated from stiff silkworm accidentally found by silkworm farmers in Yangcheng city county of Jingcheng city, shanxi province. Separating and purifying beauveria bassiana strain from silkworm naturally infected with beauveria bassiana by adopting a concentration gradient dilution method. The specific operation steps are as follows: grinding the silkworm with a sterile mortar pestle in a sterile mortar on an ultra-clean workbench, and fully grinding to obtain crushed silkworm bodies; weighing 0.1g of Bombyx Batryticatus powder, adding a small amount of 1% Tween-80 sterile water in an ultra clean bench, grinding, and making into 10mL stock solution after full grinding to obtain 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 、10 -9 . 100. Mu.L of each dilution was applied to a medium and cultured in a constant temperature incubator at 26.+ -. 1 ℃ in total darkness and 75.+ -. 5% relative humidity, followed by monospore culture. After the single spore forms the bacterial colony, the spores on each single spore colony are picked and respectively transferred to a new culture medium for culture until the morphological characteristics of the bacterial colony growing on the flat plate are consistent by visual inspection and microscopic examination, so as to obtain pure bacterial bodies, and the pure bacterial bodies are placed in a refrigerator at the temperature of 4 ℃ for standby. The strain after separation and purification is selected by an inoculating loop to be inoculated in a spore-producing culture medium, and the inoculated strain is placed in a constant temperature incubator with the temperature of 26+/-1 ℃ and the total darkness and the relative humidity of 75+/-5% to be cultivated; observing the mycelium and conidiophore morphology of the strain under an optical microscope after 5 d; mature conidia were picked after 10d and the form and size of conidia were observed. Observation under an optical microscope shows that spore-forming cells are single-born and few clusters are generated; the spore-producing shaft is slender, the knee-like bend is provided with a small tooth process, the hypha is transparent and has a septum, and branches are arranged near the septum (figure 2). Conidia were transparent, smooth, oval or elliptical (fig. 3).
(2) Molecular biology identification of strains
20mg of dried, separated and purified beauveria bassiana cells were taken, fully ground into powder with liquid nitrogen, and then DNA was extracted with a rapid extraction kit for fungal genomic DNA from Shanghai Co., ltd. Using the fungal ribosomal rDNA region universal primers ITS1 (5 '-TCCGTAGGTGA-ACCTGCGG-3') and ITS4 (5 '-TCCTCCGCTTA TTGAT-ATG C-3'), the strains were cloned containing the full sequence of ITS1-5.8S-ITS2 and fragments of the partial 18S and 28S rDNA.
The PCR reaction system 25. Mu.L comprises: 1. Mu.L of template DNA, 7. Mu. L Taq Plus DNA Polymerase (5U/. Mu.L), 0.5. Mu.L of 50mM MgSO4, 2.5. Mu.L of 10 XPCR Buffer, 2.5. Mu.L of dNTPs (each 10 mM), 1. Mu.L (20. Mu.mol/L) of each of the primers ITS1 (5 '-TCCGTAGGT GAACCT GCGG3', SQE ID No. 3)/ITS 4 (5'-TCCTCCGCTTATTGA TATGC-3', SQE ID No. 4) and ddH2O 9.5. Mu.L.
Reaction conditions: denaturation at 95℃for 5min; denaturation at 94℃for 30s, renaturation at 57℃for 30s, extension at 72℃for 90s; 30 cycles were performed and the repair was extended at 72℃for 10min.
The PCR products were detected by 1% agarose gel electrophoresis, purified and recovered using a SanPrep column type DNA gel recovery kit, and then submitted to the Shanghai Bioengineering services Co.Ltd for sequencing.
The measured rDNA ITS sequences were submitted to the GenBank website and the measured sequences were aligned to the GenBank database using BLAST software. The test strain and the strain similar to the sequence in GenBank database are taken, and a phylogenetic tree based on partial 18S rDNA-ITS 1-5.8S-ITS2 and partial 28S rDNA sequence is constructed by using the maximum likelihood method (maximum likelihood, ML) of MEGA 7.0 software. Fig. 4 is a phylogenetic tree of beauveria bassiana Bb1003.
The ITS sequence of strain Bb1003 is: ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA
The strain is clustered into a large branch with other beauveria bassiana strains in the database by adopting the homology comparison of the 16SrDNA sequences, which shows that the strain has higher similarity with the beauveria bassiana strains in the database. The strain is named beauveria bassiana Bb1003 by combining morphological feature identification and ITS sequence similarity analysis.
Affecting beauveria bassianaBeauveria bassiana) Test of factor in synthesizing nano silver by Bb1003 strain
(1) Influence of silver nitrate concentration and reaction time on synthesis of nano silver
(1) Activating strains: picking a beauveria bassiana Bb1003 inclined plane strain preserved at 4 ℃ by an inoculating loop, streaking and inoculating the beauveria bassiana Bb1003 inclined plane strain on a potato solid culture medium (PDA), and inversely culturing for 5d at 30 ℃ to activate the strain.
(2) Preparing a fermentation liquid: the activated strain was inoculated in 250mL of a flask containing 100mL of PDB liquid medium in an ultra clean bench, and cultured with shaking at 30℃and 160rpm for 4d to obtain a fermentation broth. The fermentation broth was centrifuged at 4000rpm for 30min and the supernatant was collected by filtration with filter paper.
(3) Synthesizing nano silver: adding silver nitrate solution into the supernatant of the prepared fermentation broth as a reaction matrix to ensure that the concentration of silver ions is respectively 0.5mmol/L, 1.0mmol/L, 2.0mmol/L, 4.0mmol/L and 8.0mmol/L, adjusting the pH to 3, 4, 7 and 9, and carrying out light-shielding reaction for 24 hours at 30 ℃. Observing the color change of the reaction liquid in the synthesis process, respectively scanning the reaction liquid at full wavelength of 0.5h, 1h, 2h, 4h, 8h, 16h and 24h by using an ultraviolet-visible spectrophotometer, wherein the detection range is 300-800 nm, the scanning interval is 0.5nm, and comparing the full wavelength scanning results of 5 groups of reaction liquids. The results are shown in FIGS. 5-11.
From FIGS. 5-11, it can be seen that fermentation broth of beauveria bassiana strain and AgNO 3 The solution is mixed and reacted for 2 hours, and the synthesis of nano silver is started, which fully shows that the fermentation liquor of the beauveria bassiana strain can be utilized for biologically synthesizing the nano silver. And the peak value of the synthesized nano silver is gradually increased along with the extension of the reaction time, which indicates that the yield of the synthesized nano silver is gradually increased along with the extension of the reaction time. The peak was seen to be significantly higher at 16h for 2h, indicating that a large amount of nano silver had been synthesized. And the concentration of silver nitrate is 2mmol/L, the peak value is higher than other concentrations at all times, thus determining 2.0mmol/L AgNO 3 The solution is most suitable for synthesizing nano silver.
(2) Influence of pH value on synthesis of nano silver
(1) And (2) the two steps are the same as (1) the influence of the concentration and the reaction time of the silver nitrate on the synthesis of the nano silver.
(3) Synthesis of nano silver: and B, adding silver ions into the supernatant of the beauveria bassiana Bb1003 prepared in the step B to enable the concentration of the silver ions to be 2.0mmol L, respectively adjusting the pH values to be 3, 4, 7 and 9, and carrying out light-shielding reaction for 16 hours at 30 ℃. And observing the color change of the final reaction liquid in the synthesis process, scanning the reaction liquid with an ultraviolet-visible spectrophotometer at the full wavelength, wherein the detection range is 300-800 nm, the scanning interval is 0.5nm, and comparing the full-wavelength scanning results of the 4 groups of reaction liquids, wherein the result is shown in fig. 12. As can be seen from fig. 12, no peak occurs at pH 3, indicating that nano silver is not synthesized; the peak appears when the pH value is 4, which indicates that the nano silver is synthesized; at pH7, the peak value is between ph=4 and ph=9, and the synthesis efficiency is higher than that of acidic condition and lower than that of alkaline condition; at pH9, the synthesis efficiency of nano silver is the largest and the peak value is the highest. FIG. 13 shows the color change after 16h of reaction under different pH conditions, the pH values are 3, 4, 7 and 9 in order from left to right, and the color is gradually changed with the increase of the pH value. From the above experimental results, it can be demonstrated that the pH is alkaline and is relatively suitable for the synthesis of nanosilver.
(3) Stability experiment for synthesizing nano silver by beauveria bassiana biological method
The synthesized nano silver is placed in a dark place at room temperature of 25 ℃ for 30d. And then, the nano silver has better dispersibility, no precipitation and no obvious change in color, and the ultraviolet full-wavelength scanning detection result is shown in figure 14, which shows that the nano silver synthesized by the bacteria biological method has good stability.
(4) X-ray powder diffraction (XRD) characterization analysis of nanosilver
Drying the synthesized nano silver powder, grinding the dried nano silver powder into powder, and performing XRD detection and analysis on the condition that CuK alpha is used as a radiation source (lambda= 1.54056A); the voltage of the Cu target X-ray tube is less than or equal to 40 kV, and the current is less than or equal to 40 mA; the scanning range of the 2 theta angle is 5-90 degrees. From analysis of the TEM pattern (fig. 15) and XRD pattern (fig. 16) of nano-silver, it was found that the four diffraction peaks appearing at 38.136 °, 46.175 °, 64.356 ° and 77.068 ° were characteristic diffraction peaks of silver after comparison with JCPDS standard card. The nano silver crystal has four crystal faces, which correspond to the (111), (200), (220) and (311) crystal faces respectively, and belongs to a polycrystalline structure.
(5) Fourier Transform Infrared (FTIR) spectral characterization analysis
Mixing the synthesized nano silver powder with potassium bromide according to the proportion of 1:100, grinding uniformly, tabletting and then placing in an infrared spectrometer for detection and analysis. Provided that the mid-infrared beam splitter: 4000-500 cm -1 The method comprises the steps of carrying out a first treatment on the surface of the Potassium bromide spectroscopic beam resolution of 0.4 cm -1 The method comprises the steps of carrying out a first treatment on the surface of the The detector is DTGS; signal to noise ratio11000:1. As shown in FIG. 17, the FTIR spectrum of nano-silver is 4000-500 cm in wavelength range -1 There are some distinct absorption peaks that are caused by stretching vibrations of different types of chemical bonds. 3260.66 cm -1 The vibration peak at the point comes from-O-H which probably mediates the reduction of silver ions into nano silver; 1566.35 cm -1 And 1734.40 cm -1 The vibrational peaks at these are derived from-N-H and-c=o of the amide bond in protein amide I and amide II, respectively. This suggests that bioactive components (e.g., proteins) secreted by beauveria bassiana Bb1003 cells may play a key role in the reduction process of silver ions, and may also coat the surfaces of the formed nano-silver particles, while preventing their agglomeration, and also imparting unique biological properties thereto.
(6) Antibacterial property test of nano silver
Activation of the test strain: the test strain is selected from Escherichia coli, bacillus subtilis and Staphylococcus aureus. 3 test bacteria stored on a 4℃slant were inoculated into LB liquid medium and cultured with shaking 24h to activate the strain.
And (3) bacteriostasis circle test: the oxford cup bacteriostasis method is adopted to test the bacteriostasis activity of the nano silver on pathogenic bacteria. 3 strains of pathogenic bacteria (such as escherichia coli, bacillus subtilis and staphylococcus aureus) are respectively inoculated in 100mL of LB liquid medium for shake cultivation for 24 hours at 37 ℃ and 160rpm, 100 mu L of bacterial liquid is respectively transferred and evenly coated on LB solid medium, sterilized oxford cups are placed on the medium, 50 mu L of nano silver solution with the concentration of 500mg/L is added into each oxford cup, the comparison is beauveria bassiana fermentation liquor, the test is repeated for 3 times, the antibacterial circle is measured, the average value is calculated, and the results are shown in the decomposition of figures 18-23 and the table 1.
Figure 928311DEST_PATH_IMAGE001
As can be seen from FIGS. 18-23 and Table 1, the nano silver synthesized by using beauveria bassiana Bb1003 of the present invention has an inhibitory effect on various pathogenic bacteria, and shows good inhibitory effects on both gram-positive bacteria (Staphylococcus aureus, bacillus subtilis) and gram-negative bacteria (Escherichia coli).
Minimum Inhibitory Concentration (MIC) determination: the prepared nano silver has the minimum antibacterial concentration to three bacteria of escherichia coli, bacillus subtilis and staphylococcus aureus by adopting a test tube dilution method. Preparing nano silver solutions with different concentrations, adding LB liquid medium 3 ml into each test tube, wherein the final concentration of nano silver is 50, 100, 300, 500 and 1000 mg/L. Then 10 mu L of test bacterial suspension is added into each test tube respectively, the test bacterial suspension is uniformly vibrated, and the test bacterial suspension is placed in a constant temperature shaking table at 37 ℃ for culturing 24h. Meanwhile, a negative control without adding test bacteria and a positive control without adding nano silver are arranged. The results determined that MIC values were the lowest antimicrobial concentration in the test tube at which no bacterial growth was observed with the naked eye. The results are shown in Table 2, and the MBC values of the nano silver prepared by the invention on escherichia coli, bacillus subtilis and staphylococcus aureus are respectively 300, 300 and 500 mg/L.
Figure 235664DEST_PATH_IMAGE002
The invention has the beneficial effects that: (1) The invention discloses beauveria bassiana Bb1003 strain capable of biosynthesizing nano silver. (2) The invention discloses a method for biosynthesizing nano silver by using beauveria bassiana Bb1003 strain, which is simple and convenient to operate, green, nontoxic, environment-friendly and energy-saving. (3) The invention expands the application of fungi in the green synthesis of nano materials, provides a new microbial resource for the biosynthesis of nano silver, and has important application value in the field of the biosynthesis of nano materials, in particular to the field of the green synthesis of nano silver. (4) The nano silver synthesized by the invention has inhibition effect on various pathogenic bacteria, and has good antibacterial effect on gram-positive bacteria (staphylococcus aureus and bacillus subtilis) and gram-negative bacteria (escherichia coli).
Drawings
FIG. 1 is a colony morphology of beauveria bassiana Bb1003 of the present invention.
FIG. 2 is a diagram showing the mycelium morphology of beauveria bassiana Bb1003 according to the present invention.
FIG. 3 is a spore morphology of beauveria bassiana Bb1003 of the present invention.
FIG. 4 is a phylogenetic tree of beauveria bassiana Bb1003 of the present invention.
FIG. 5 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is a reaction liquor and reacts with silver nitrate with different concentrations for 0.5 h.
FIG. 6 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is taken as a reaction liquor and reacts with silver nitrate with different concentrations for 1 h.
FIG. 7 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is used as a reaction liquor and reacts with silver nitrate with different concentrations for 2 hours.
FIG. 8 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is used as a reaction liquor and reacts with silver nitrate with different concentrations for 4 hours.
FIG. 9 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is used as a reaction liquor and reacts with silver nitrate with different concentrations for 8 hours.
FIG. 10 is an ultraviolet absorption spectrum of the synthesized nano silver when beauveria bassiana Bb1003 fermentation broth is used as a reaction solution and reacts with silver nitrate with different concentrations for 16 hours.
FIG. 11 is an ultraviolet absorption spectrum chart of the synthesis of nano silver when beauveria bassiana Bb1003 fermentation liquor is used as a reaction liquor and reacts with silver nitrate with different concentrations for 24 hours.
FIG. 12 is an ultraviolet absorption spectrum chart of the synthesis of nano silver under different pH conditions by taking beauveria bassiana Bb1003 fermentation liquor as a reaction liquid.
FIG. 13 shows the color change of the beauveria bassiana Bb1003 fermentation broth as a reaction broth under different pH reaction conditions.
FIG. 14 is an ultraviolet absorption spectrum of the beauveria bassiana Bb1003 fermentation broth of the invention after the nano silver synthesized by the reaction solution is placed for 16h and 30d.
Fig. 15 is a TEM image of nano silver synthesized by using beauveria bassiana Bb1003 fermentation broth as a reaction solution.
Fig. 16 is an XRD pattern of nano silver synthesized by using beauveria bassiana Bb1003 fermentation broth as a reaction solution.
FIG. 17 is a FTIR spectrum of nano silver synthesized by using beauveria bassiana Bb1003 fermentation broth as a reaction solution.
Fig. 18 is a diagram showing the antibacterial effect of nano silver synthesized by using beauveria bassiana Bb1003 fermentation liquor as a reaction liquid on escherichia coli.
FIG. 19 is a graph showing the antibacterial effect of the fermentation broth of beauveria bassiana Bb1003 on Escherichia coli according to the present invention.
Fig. 20 is a diagram showing the antibacterial effect of nano silver synthesized by using beauveria bassiana Bb1003 fermentation liquor as a reaction liquid on bacillus subtilis.
FIG. 21 is a graph showing the comparison of the fermentation broth of beauveria bassiana Bb1003 of the present invention against Bacillus subtilis.
Fig. 22 is a graph showing the antibacterial effect of nano silver synthesized by using beauveria bassiana Bb1003 fermentation liquor as a reaction liquid on staphylococcus aureus.
FIG. 23 is a graph showing the comparison of the fermentation broth of beauveria bassiana Bb1003 against Staphylococcus aureus.
Detailed Description
The invention is further illustrated below with reference to examples.
Example 1
The beauveria bassiana Bb1003 is separated from stiff silkworms accidentally found by farmers in the city, the Yangcheng county, the Shanxi province, the Jingcheng province and the Yingzhen silkworm breeding farmers. The 16SrDNA sequence homology alignment is adopted and identified asBeauveria bassiana. The strain is preserved in China general microbiological culture Collection center of China Committee for culture Collection of microorganisms (China) for 9 and 30 days of 2021, and the preservation number is: CGMCC No.23269, preservation address: the institute of microorganisms of national academy of sciences of China, no. 1, no.3, north Chen West Lu, the Korean region of Beijing.
Example 2
Beauveria bassiana Bb 1003%Beauveria bassiana) A method for synthesizing nano silver, comprising the steps of:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 28 ℃ for 5 days for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 4 days at 28 ℃ and 180rpm, centrifuging the fermentation liquor for 30min at the rotating speed of 4000rpm, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: taking the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, adding 4 mmol/L silver nitrate solution, reacting for 24 hours under the condition of pH7, centrifuging at 10000rpm for 20min, taking the precipitate, adding distilled water with equal amount, carrying out ultrasonic treatment, repeating the centrifugation for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain the powder which is nano silver.
Example 3
Beauveria bassiana Bb 1003%Beauveria bassiana) A method for synthesizing nano silver, comprising the steps of:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 30 ℃ for 2 days for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 7 days at 30 ℃ and 150rpm, centrifuging the fermentation liquor for 30min at the rotating speed of 4000rpm, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: taking the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, adding 1 mmol/L silver nitrate solution, reacting for 2 hours under the condition of pH9, centrifuging at 10000rpm for 20min, taking the precipitate, adding distilled water with equal amount, carrying out ultrasonic treatment, repeating the centrifugation for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain the powder which is nano silver.
Example 4
Beauveria bassiana Bb 1003%Beauveria bassiana) A method for synthesizing nano silver, comprising the steps of:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture for 3 days at 29 ℃ for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 5 days at 29 ℃ and 160rpm, centrifuging the fermentation liquor for 30min at the rotating speed of 4000rpm, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: taking the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, adding 2mmol/L silver nitrate solution, reacting for 12 hours under the condition of pH8, centrifuging at 10000rpm for 20min, taking the precipitate, adding distilled water with equal amount, carrying out ultrasonic treatment, repeating the centrifugation for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain the powder which is nano silver.
Example 5
Beauveria bassiana Bb 1003%Beauveria bassiana) A method for synthesizing nano silver, comprising the steps of:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture for 4 days at 28 ℃ for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 6 days at 30 ℃ and 1700rpm, centrifuging the fermentation liquor at the rotating speed of 4000rpm for 30min, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: taking the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, adding 3 mmol/L of silver nitrate solution, reacting for 8 hours under the condition of pH9, centrifuging for 20min under the centrifugation condition of 10000rpm, taking the precipitate, adding distilled water with equal amount, carrying out ultrasonic treatment, repeating the centrifugation for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain the powder which is nano silver.
Sequence listing
<110> Shanxi university of agriculture
ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA
<120> beauveria bassiana Bb1003 and method for mediating and synthesizing nano silver by using same
<141> 2022-06-07
<160> 0
<170> SIPOSequenceListing 1.0

Claims (1)

1. Using beauveria bassianaBeauveria bassiana) The method for synthesizing nano silver by Bb1003 comprises the following steps:
(1) Activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture for 2-5 days at 28-30 ℃ for later use;
(2) Preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 4-7 days at the temperature of 28-30 ℃ and the speed of 150-180 rpm, centrifuging the fermentation liquor at the rotating speed of 4000rpm for 30min, and filtering and collecting supernatant by using filter paper for later use;
(3) Synthesizing nano silver: adding 1-4 mmol/L of silver nitrate solution into the supernatant of the fermentation broth prepared in the step (2) as a reaction matrix, reacting for 2-24 hours under the condition of pH 4-9, centrifuging for 10-30 min at 10000rpm, taking the precipitate, adding distilled water with equal amount for ultrasonic treatment, repeatedly centrifuging for two times, and drying the obtained precipitate product at 50 ℃ overnight to obtain powder, namely nano silver;
the beauveria bassiana is @ beauveria bassianaBeauveria bassiana) The preservation number of Bb1003 is CGMCC No.23269.
CN202210636439.8A 2022-06-07 2022-06-07 Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003 Active CN114891647B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210636439.8A CN114891647B (en) 2022-06-07 2022-06-07 Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210636439.8A CN114891647B (en) 2022-06-07 2022-06-07 Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003

Publications (2)

Publication Number Publication Date
CN114891647A CN114891647A (en) 2022-08-12
CN114891647B true CN114891647B (en) 2023-04-25

Family

ID=82729141

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210636439.8A Active CN114891647B (en) 2022-06-07 2022-06-07 Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003

Country Status (1)

Country Link
CN (1) CN114891647B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115093973B (en) * 2022-06-07 2023-05-23 山西农业大学 Beauveria bassiana Bb1003 and method for synthesizing nano gold through mediation thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114540203B (en) * 2022-02-22 2023-04-14 山西农业大学 Beauveria bassiana with young silkworm infection function, microbial inoculum and application thereof, and preparation method of white muscardine silkworm
CN115093973B (en) * 2022-06-07 2023-05-23 山西农业大学 Beauveria bassiana Bb1003 and method for synthesizing nano gold through mediation thereof

Also Published As

Publication number Publication date
CN114891647A (en) 2022-08-12

Similar Documents

Publication Publication Date Title
Kumar et al. Biosynthesis of silver nanoparticles from marine yeast and their antimicrobial activity against multidrug resistant pathogens
CN109456921B (en) Paenibacillus polymyxa, application thereof, microbial agent, powder and granules
CN114891647B (en) Beauveria bassiana Bb1003 and method for synthesizing nano silver by mediation of beauveria bassiana Bb1003
KR101313786B1 (en) Composition for rice bacterial blight suppressing activity
CN110373359A (en) A kind of streptomyces albus X-18 and the method using bacterium production epsilon-polylysine
Andayani et al. Antibacterial, antifungal and anticancer activity of five strains of soil microorganisms isolated from tangkuban perahu mountain by fermentation
CN115093973B (en) Beauveria bassiana Bb1003 and method for synthesizing nano gold through mediation thereof
CN105907668A (en) Screening and identification method of microorganism for synthesizing silver nanoparticles and characterization of silver nanoparticles
CN110317747B (en) Bacillus amyloliquefaciens JT68 and application thereof in prevention and treatment of tea anthracnose
CN103627664A (en) Bacillus amyloliquefaciens strain capable of preparing nano silver by reduction
CN112646741B (en) Bacillus subtilis subspecies desertae S2 and application thereof
CN112094756B (en) Lancetera FL15 and application thereof in mediating nano-silver biosynthesis
CN109536392B (en) Aspergillus versicolor ZJB16085 and application thereof in synthesis of R-2- (4-hydroxyphenoxy) propionic acid
CN109182216B (en) Marine streptomyces SCFJ-05 with inhibition effect on succulent plant stem rot
JPH05236980A (en) Production of trans-4-hydroxy-l-proline
CN112195137B (en) Bacillus belgii for antagonizing magnaporthe grisea and producing gamma-polyglutamic acid and application thereof
CN102492639A (en) Mutant capable of raising cyclic lipopeptides antibiotic output by using RNA polymerase mutation, its preparation method and its application
Lin et al. Chitosan production from Paecilomyces saturatus using three monosaccharides via mixture design
CN110305797B (en) Anthocyanin producing strain CJ6 and application thereof
CN110964646B (en) Sclerotinia sclerotiorum, application, fermentation medium and preparation method of PF1022A
CN110468055B (en) Huperzia serrata colletotrichum and application thereof
CN112159765B (en) Ageratum endophytic fungus Letenadraea sp.WZ07 and application thereof in nano silver synthesis
CN105076220B (en) A kind of hypha extract of marine fungi umbrella branch trichoderma strain culture
RU2737856C1 (en) Bacillus pumilus strain producing wide-spectrum antibiotic amikumacin
CN101709058B (en) Polyene macrolides compound, preparation and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant