CN114891647A

CN114891647A - Beauveria bassiana Bb1003 and method for synthesizing nano-silver through mediation of Beauveria bassiana Bb1003

Info

Publication number: CN114891647A
Application number: CN202210636439.8A
Authority: CN
Inventors: 杨宁; 冯翠萍; 李维宏; 刘晨浩
Original assignee: Shanxi Agricultural University
Current assignee: Shanxi Agricultural University
Priority date: 2022-06-07
Filing date: 2022-06-07
Publication date: 2022-08-12
Anticipated expiration: 2042-06-07
Also published as: CN114891647B

Abstract

Beauveria bassiana (balsamo) Vuillemin ((B))Beauveria bassiana) Bb1003, which is preserved in China general microbiological culture Collection center (CGMCC) at 30 months 9 and 2021, with the preservation number as follows: CGMCC No.23269, preservation address: the institute of microbiology, national academy of sciences No.3, Xilu No. 1, Beijing, Chaoyang, Beijing. Beauveria bassiana Bb1003 and mediated synthesis of sodiumA method of making nanosilver, comprising the steps of: (1) activating the strain, preparing fermentation liquor and synthesizing nano silver. The method for synthesizing the nano-silver is simple and convenient to operate, green, non-toxic, environment-friendly and energy-saving; expands the application of fungi in the green synthesis of nano materials, provides a new microbial resource for the biosynthesis of nano silver, and has important application value in the field of the biosynthesis of nano materials, particularly the green synthesis of nano silver. The nano silver synthesized by the invention has an inhibiting effect on various pathogenic bacteria, and shows good inhibiting effect on gram-positive bacteria and gram-negative bacteria.

Description

Beauveria bassiana Bb1003 and method for synthesizing nano-silver through mediation of Beauveria bassiana Bb1003

Technical Field

The invention belongs to the technical field of nano materials, and particularly relates to a method for synthesizing nano silver by utilizing beauveria bassiana.

Background

The nano material refers to a material of which the constituent units have at least one dimension in the range of 1nm-100 nm in a three-dimensional space. The nano silver is crystal metal silver with the size of 1-100 nm. In recent years, unique chemical, physical and biological properties, which are imparted due to their small size, have been widely used in various fields such as biomedicine, optics, magnetism, agriculture, and the environment.

Silver has been recognized by humans for over 4000 years. Silver is an important precious metal, and exists as a simple substance in nature, but exists in a silver ore in a combined state for the most part. The silver has stable physical and chemical properties, good heat conduction and electric conductivity, soft quality, ductility and extremely high light reflection rate which can reach more than 99 percent, and has a plurality of important purposes. With the rapid development of nanotechnology, the nano-silver simple substance exhibits unique physicochemical and biological properties, and becomes one of the most promising nano-materials.

At present, traditional synthesis methods including physical methods and chemical methods are mainly adopted for synthesizing nano silver, but with the increase of industrial demand for nano silver, the defects of the traditional nano silver synthesis technology are gradually exposed. The physical method for producing the silver nano material and the gold nano material by using the physical method has the advantages of simple reaction principle, less impurities of obtained products, high purity and the like, but has obvious defects, firstly, the required requirements are harsh, the production cost is high, and the obtained products are single. The chemical method is a method which needs more reducing agents, and the reducing agents not only have stronger toxicity, but also are expensive and cause serious pollution to the environment. With the proposal of green chemical concept, the synthesis method of nano silver also develops towards the direction of economy, simplicity, convenience, high efficiency, greenness, no toxicity, environmental protection and energy conservation. Biological methods have therefore received increasing attention as a method for synthesizing nanoparticles that is emerging in recent years. As the microorganism has the advantages of wide distribution, easy culture, rapid propagation and the like, the microorganism has great potential as a natural biological material for the intracellular or extracellular controllable synthesis research of the nano-silver. Until now, it has been shown that various microorganisms including prokaryotes and eukaryotes in nature can synthesize nano-silver, such as bacteria, yeasts, fungi, etc., and they all have the ability to synthesize nano-silver inside or outside cells.

Disclosure of Invention

The invention provides beauveria bassiana Bb1003 and a method for synthesizing nano-silver by mediation, aiming at synthesizing the nano-silver which accords with the green development principle, has low cost, high efficiency, rapidness, no toxic pollution and environmental protection.

The invention is realized by the following technical scheme.

Beauveria bassiana (Beauveria bassiana) of the inventionBeauveria bassiana) Bb1003, which is preserved in China general microbiological culture Collection center (CGMCC) at 30 months 9 and 2021, with the preservation number as follows: CGMCC No.23269, preservation address: the institute of microbiology, national academy of sciences No.3, Xilu No. 1, Beijing, Chaoyang, Beijing.

The beauveria bassiana Bb1003 is separated from the bombyx batryticatus accidentally discovered by silkworm breeding farmers in the subying town of Yangcheng county in Shanxi province. The strain is inoculated in a spore-producing culture medium, and is cultured in a constant-temperature incubator with the temperature of 26 +/-1 ℃, total darkness and relative humidity of 75 +/-5 percent after being inoculated; and (5) observing the shapes of hypha and conidiophores of the strains under an optical microscope after 5d, wherein the color of the bacterial colony is milky white, the bottom end of the bacterial colony is light yellow, the edge of the bacterial colony is thin, the middle of the bacterial colony is thick, the middle of the bacterial colony is provided with folds, and the bacterial colony grows in a concentric circle (figure 1). Observing under an optical microscope, and finding that the spore-forming cells are single and rarely clustered; the conidiophores are fine, the knee is bent, and the conidiophores have small odontoid processes; the hyphae were transparent and had a septum and a branch near the septum (FIG. 2). The conidia are transparent, smooth, oval or elliptical (fig. 3). Using 16SrDNA sequence homology alignment and drawing a phylogenetic tree, as shown in fig. 2, the results show that: the strain and other beauveria bassiana strains in the database are gathered into a big branch, which shows that the strain and the beauveria bassiana strains in the database have higher similarity. The strain is named beauveria bassiana Bb1003 by combining morphological characteristic identification and ITS sequence similarity analysis.

Using beauveria bassiana Bb1003 (Beauveria bassiana) The method for synthesizing the nano silver comprises the following steps:

(1) activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 28-30 ℃ for 2-5 days for later use;

(2) preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 4-7 days at 28-30 ℃ and 150-180 rpm, centrifuging the fermentation liquor at the rotation speed of 4000rpm for 30min, filtering by using filter paper, and collecting supernatant for later use;

(3) and (3) synthesizing nano silver: taking the supernatant of the fermentation liquor prepared in the step (2) as a reaction substrate, adding 1-4 mmol/L silver nitrate solution, reacting for 2-24 h under the condition of pH 4-9, centrifuging for 10-30 min under the centrifugation condition of 10000rpm, taking the precipitate, adding equivalent distilled water for ultrasonic treatment, repeatedly centrifuging twice, drying the obtained precipitate at 50 ℃ overnight, and obtaining powder, namely nano silver.

The activation culture medium is a PDA potato solid culture medium.

The activation culture temperature is preferably 28 ℃, and the activation culture time is preferably 3-4 days.

The fermentation medium is a PDB potato liquid medium.

The fermentation culture is preferably carried out in a constant-temperature shaking incubator, the temperature is preferably 30 ℃, the rotating speed is preferably 160rpm, and the time is preferably 5-6 days.

The beauveria bassiana Bb1003 and the method for synthesizing nano-silver by mediating the beauveria bassiana Bb1003 accord with the green development principle, and the nano-silver can be synthesized with low cost, high efficiency, rapidness, no toxic pollution and environmental protection.

The invention relates to beauveria bassiana (balsamo) Vuillemin)Beauveria bassiana) Related test for biosynthesis of nano-silver by Bb1003 strain

1. Isolation and identification of strains and molecular biology identification

(1) Isolation and identification of strains

Beauveria bassiana (Beauveria bassiana) of the inventionBeauveria bassiana) Bb1003 strain is separated from Bombyx Batryticatus accidentally discovered by silkworm breeding farmers in the subying town of Yangcheng county in Shanxi province. A concentration gradient dilution method is adopted to separate and purify the beauveria bassiana strain from the silkworms naturally infected with the beauveria bassiana. The method comprises the following specific operation steps: grinding the white muscardine silkworm in a sterile mortar by using a sterile mortar pestle on a superclean bench, and fully grinding to obtain a crushed worm body; weighing 0.1g of Bombyx Batryticatus powder, adding small amount of 1% Tween-80 sterile water in a clean bench, grinding, and making into 10mL stock solution ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 、10 ^-7 、10 ^-8 、10 ^-9 . Coating 100 μ L of each dilution on culture medium, culturing in constant temperature incubator with temperature of 26 + -1 deg.C, total darkness and relative humidity of 75 + -5%, and culturing for monospore. After monospore is formed into colonies, spores on each monospore colony are picked and transferred to a new culture medium for culture respectively until the morphological characteristics of the colonies growing on the plate are determined to be consistent by visual inspection and microscopic examination, pure strains are obtained and stored in a refrigerator at 4 ℃ for later use. Inoculating the separated and purified strain in a spore production culture medium by using an inoculating loop, and culturing in a constant-temperature incubator with the temperature of 26 +/-1 ℃, total darkness and relative humidity of 75 +/-5 percent after inoculation; observing the shapes of hypha and conidiophores of the strain under an optical microscope after 5 d; after 10 days, picking mature conidia and observing the shape and size of the conidia. Observing under an optical microscope, and finding that the spore-forming cells are single and rarely clustered; coniferous axis is fine, knee-like and bent, with small odontoid process, transparent hypha with septum, and branch near septum (FIG. 2). Conidium penetrates throughBright, smooth, oval or elliptical (fig. 3).

(2) Molecular biological identification of strains

20mg of dried, separated and purified beauveria bassiana thallus is taken, fully ground into powder by using liquid nitrogen, and then DNA is extracted by using a fungal genome DNA rapid extraction kit of biological engineering (Shanghai) GmbH. The fungal ribosomal rDNA region universal primers ITS1 (5 '-TCCGTAGGTGA-ACCTGCGG-3') and ITS4 (5 '-TCCTCCGCTTA TTGAT-ATG C-3') were used to clone strains containing the full sequence of ITS1-5.8S-ITS2 and fragments including part of the 18S and 28S rDNAs.

The PCR reaction system of 25. mu.L included: mu.L of template DNA, 7. mu.L of Taq Plus DNA Polymerase (5U/. mu.L), 0.5. mu.L 50mM MgSO4, 2.5. mu.L 10 XPCR Buffer, 2.5. mu.L dNTP (each 10mM), 1. mu.L each (20. mu. mol/L) of primers ITS1 (5 '-TCCGTAGGT GAACCT GCGG3', SQE ID No. 3)/ITS 4 (5'-TCCTCCGCTTATTGA TATGC-3', SQE ID No. 4), and ddH2O 9.5.5. mu.L.

Reaction conditions are as follows: denaturation at 95 deg.C for 5 min; denaturation at 94 ℃ for 30s, renaturation at 57 ℃ for 30s, and extension at 72 ℃ for 90 s; 30 cycles are carried out, and the restoration and extension are carried out for 10min at 72 ℃.

The PCR product was detected by 1% agarose gel electrophoresis, purified and recovered using a SanPrep column DNA gel recovery kit, and then sequenced by Shanghai Biotechnology engineering services Ltd.

The determined rDNA ITS sequences were submitted to the GenBank website and aligned to the GenBank database using BLAST software. Test strains and strains with similar sequences in a GenBank database are taken, and a phylogenetic tree based on partial 18S rDNA-ITS 1-5.8S-ITS2 and partial 28S rDNA sequences is constructed by using the maximum likelihood Method (ML) of MEGA 7.0 software. FIG. 4 is a phylogenetic tree of Beauveria bassiana Bb 1003.

The ITS sequence of the strain Bb1003 is as follows: ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA

The 16SrDNA sequence homology comparison is adopted, the strain and other beauveria bassiana strains in the database are gathered into a big branch, and the strain and the beauveria bassiana strains in the database have higher similarity. The strain is named beauveria bassiana Bb1003 by combining morphological characteristic identification and ITS sequence similarity analysis.

Affecting beauveria bassiana (Beauveria bassiana) Experiment of Bb1003 strain for synthesizing nano-silver factor

(1) Influence of silver nitrate concentration and reaction time on synthesis of nano-silver

Activating strains: a strain of beauveria bassiana Bb1003 stored at 4 ℃ is picked by an inoculating loop and streaked on a potato solid culture medium (PDA), and the strain is reversely cultured for 5 days at 30 ℃ to activate the strain.

Preparing fermentation liquor: the activated strain was inoculated into 250mL of a Erlenmeyer flask containing 100mL of PDB liquid medium on a clean bench, and shake-cultured at 30 ℃ and 160rpm for 4 days to obtain a fermentation broth. The fermentation broth was centrifuged at 4000rpm for 30min and the supernatant was collected by filtration through filter paper.

③ synthesizing the nano-silver: taking the supernatant of the prepared fermentation liquor as a reaction substrate, adding a silver nitrate solution to ensure that the silver ion concentration is respectively 0.5mmol/L, 1.0mmol/L, 2.0mmol/L, 4.0mmol/L and 8.0mmol/L, adjusting the pH to be 3, 4, 7 and 9, and reacting for 24 hours at 30 ℃ in a dark place. And observing the color change of the reaction liquid in the synthesis process, respectively scanning the reaction liquid at full wavelength for 0.5h, 1h, 2h, 4h, 8h, 16h and 24h by using an ultraviolet-visible spectrophotometer, wherein the detection range is 300-800 nm, the scanning interval is 0.5nm, and comparing the full wavelength scanning results of 5 groups of reaction liquid. The results are shown in FIGS. 5 to 11.

From FIGS. 5 to 11, it can be seen that the fermentation broth of Beauveria bassiana strain and AgNO ₃ The solution is mixed and reacts for 2 hours, and the synthesis of nano silver begins, which fully indicates that the fermentation liquor utilizing the beauveria bassiana strain can be biologically synthesizedForming the nano silver. And the peak value of the synthesized nano silver is gradually increased along with the prolonging of the reaction time, which shows that the yield of the synthesized nano silver is gradually increased along with the prolonging of the reaction time. The peak value is obviously higher by 2h in 16h, which indicates that a large amount of nano silver is synthesized. And when the concentration of silver nitrate is 2mmol/L, the peak value is higher than other concentrations every moment, so that 2.0mmol/L AgNO is determined ₃ Solution, which is most suitable for the synthesis of nano silver.

(2) Influence of pH value on synthesis of nano silver

The first step and the second step are the same as the first step and the second step, and the influence of the silver nitrate concentration and the reaction time on the synthesis of the nano silver is also realized.

③ synthesizing the nano-silver: and D, adding silver ions into the supernatant of the beauveria bassiana Bb1003 prepared in the step B, enabling the concentration of the silver ions to be 2.0mmol L, adjusting the pH values to be 3, 4, 7 and 9 respectively, and reacting for 16h in a dark place at the temperature of 30 ℃. And (3) observing the color change of the final reaction liquid in the synthesis process, carrying out full-wavelength scanning on the reaction liquid by using an ultraviolet-visible spectrophotometer, wherein the detection range is 300-800 nm, the scanning interval is 0.5nm, and comparing the full-wavelength scanning results of 4 groups of reaction liquids, wherein the result is shown in figure 12. As can be seen from fig. 12, no peak occurred at pH 3, indicating that nano silver was not synthesized; when the pH value is 4, a peak appears, which indicates that the nano silver is synthesized; at pH7, the peak is between pH =4 and pH =9, the synthesis efficiency is higher than under acidic conditions than under basic conditions; when the pH value is 9, the synthesis efficiency of the nano silver is the maximum, and the peak value is the highest. FIG. 13 is the color change after 16h reaction under different pH reaction conditions, wherein the pH values from left to right are 3, 4, 7 and 9, and the color is gradually darker with the increase of the pH value. The above experimental results can be combined to show that the method is relatively suitable for the synthesis of nano silver when the pH is alkaline.

(3) Stability experiment for synthesizing nano silver by beauveria bassiana biological method

And placing the synthesized nano silver at room temperature of 25 ℃ in the dark for 30 days. Then, the nano silver is observed by naked eyes, the dispersibility is good, no precipitation occurs, the color is not obviously changed, and the ultraviolet full-wavelength scanning detection result is shown in figure 14, which shows that the nano silver synthesized by the bacterium biological method is good in stability.

(4) X-ray powder diffraction (XRD) characterization and analysis of nano-silver

Drying the synthesized nano silver powder, grinding the dried nano silver powder into powder, and performing XRD detection analysis under the condition that CuK alpha is used as a radiation source (lambda = 1.54056A); the voltage of the Cu target X light tube is less than or equal to 40 kV, and the current is less than or equal to 40 mA; the 2 theta angle scanning range is 5-90 degrees. According to analysis of a TEM image (figure 15) and an XRD (figure 16) pattern of the nano-silver, after being compared with a JCPDS standard card, four diffraction peaks of the silver are found at 38.136 degrees, 46.175 degrees, 64.356 degrees and 77.068 degrees in terms of 2 theta. The nano silver crystal has four crystal faces, which respectively correspond to the (111), (200), (220) and (311) crystal faces and belong to a polycrystalline structure.

(5) Fourier Transform Infrared (FTIR) spectral characterization analysis

And mixing the synthesized nano silver powder and potassium bromide in a ratio of 1: 100, grinding uniformly, tabletting, and then placing in an infrared spectrometer for detection and analysis. The conditions were mid-infrared beam splitter: 4000-500 cm ^-1 (ii) a The resolution of the potassium bromide light splitting beam is 0.4 cm ^-1 (ii) a The detector is DTGS; the signal-to-noise ratio was 11000: 1. As shown in FIG. 17, the FTIR spectrum of nano-silver is 4000-500 cm in wavelength range ^-1 There are some distinct absorption peaks that are caused by stretching vibrations of different types of chemical bonds. 3260.66 cm ^-1 The vibration peak is from-O-H which can mediate the reduction of silver ions into nano silver; 1566.35 cm ^-1 And 1734.40 cm ^-1 The vibrational peaks at (a) are from-N-H and-C = O of the amide bond in protein amide I and amide II, respectively. This shows that the bioactive components (such as protein) secreted by the beauveria bassiana Bb1003 thallus can play a key role in the reduction process of silver ions, and can also coat the surface of the formed nano silver particles, so that the aggregation of the nano silver particles is prevented, and the unique biological characteristics are also endowed.

(6) Antibacterial property test of nano silver

Activation of the test strain: the tested strains are selected from escherichia coli, bacillus subtilis and staphylococcus aureus. 3 test bacteria preserved at a 4 ℃ slant were inoculated into LB liquid medium and cultured with shaking for 24 hours to activate the strain.

The zone of inhibition test: and (3) testing the bacteriostatic activity of the nano-silver on pathogenic bacteria by adopting an Oxford cup bacteriostatic method. Respectively inoculating 3 pathogenic bacteria (escherichia coli, bacillus subtilis and staphylococcus aureus) in an ultra-clean bench in 100mL LB liquid culture medium at 37 ℃ and 160rpm for shake cultivation for 24 hours, respectively transferring 100 muL of bacterial liquid to be uniformly coated on the LB solid culture medium, placing sterilized Oxford cups on the culture medium, adding 50 muL of nano-silver solution with the concentration of 500mg/L into each Oxford cup, taking beauveria bassiana fermentation liquor as a control, repeating the test for 3 times to measure the inhibition zone, and calculating the average value, wherein the results are shown in decomposition of 18-23 and table 1.

As can be seen from fig. 18 to 23 and table 1, the nano silver synthesized by using beauveria bassiana Bb1003 according to the present invention has an inhibitory effect on various pathogenic bacteria, and shows a good inhibitory effect on both gram-positive bacteria (staphylococcus aureus, bacillus subtilis) and gram-negative bacteria (escherichia coli).

Minimum Inhibitory Concentration (MIC) assay: the minimum inhibitory concentration of the prepared nano-silver to escherichia coli, bacillus subtilis and staphylococcus aureus is tested by adopting a test tube dilution method. Preparing nano silver solutions with different concentrations, and adding 3 ml of LB liquid culture medium into each test tube, wherein the final concentration of the nano silver is 50, 100, 300, 500 and 1000 mg/L. Then, 10 muL of test bacteria suspension is added into each test tube respectively, the test bacteria suspension is uniformly oscillated and placed in a constant temperature shaking table at 37 ℃ for cultivation for 24 h. Meanwhile, a negative control without adding test bacteria and a positive control without adding nano silver are set. As a result, the MIC value was determined as the lowest concentration of the antibacterial agent at which no bacterial growth was observed in the test tube with the naked eye. As shown in Table 2, the MBC values of the nano-silver prepared by the invention on Escherichia coli, Bacillus subtilis and Staphylococcus aureus are 300, 300 and 500mg/L respectively.

The invention has the beneficial effects that: (1) the invention discloses a beauveria bassiana Bb1003 strain capable of biologically synthesizing nano-silver. (2) The invention discloses a method for biologically synthesizing nano-silver by using beauveria bassiana Bb1003 strain, which is simple and convenient to operate, green, nontoxic, environment-friendly and energy-saving. (3) The invention expands the application of fungi in the green synthesis of nano materials, provides a new microbial resource for the biosynthesis of nano silver, and has important application value in the field of the biosynthesis of nano materials, particularly the green synthesis of nano silver. (4) The nano silver synthesized by the invention has an inhibiting effect on various pathogenic bacteria, and shows good antibacterial effect on gram-positive bacteria (staphylococcus aureus and bacillus subtilis) and gram-negative bacteria (escherichia coli).

Drawings

FIG. 1 is a colony morphology of Beauveria bassiana Bb1003 of the present invention.

FIG. 2 is a hyphal morphology of Beauveria bassiana Bb1003 according to the present invention.

FIG. 3 is a spore morphology of Beauveria bassiana Bb1003 according to the present invention.

FIG. 4 is a phylogenetic tree of Beauveria bassiana Bb1003 according to the present invention.

FIG. 5 is an ultraviolet absorption spectrum diagram of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquor of the invention is reaction liquid and reacts with silver nitrate with different concentrations for 0.5 h.

FIG. 6 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquid of the invention is a reaction liquid and reacts with silver nitrate with different concentrations for 1 h.

FIG. 7 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquid of the invention is a reaction liquid and reacts with silver nitrate with different concentrations for 2 h.

FIG. 8 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquor of the invention is reaction liquid and reacts with silver nitrate with different concentrations for 4 h.

FIG. 9 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquid of the invention is a reaction liquid and reacts with silver nitrate with different concentrations for 8 h.

FIG. 10 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquid of the invention is a reaction liquid and reacts with silver nitrate with different concentrations for 16 h.

FIG. 11 is a graph of the ultraviolet absorption spectrum of the synthetic nano-silver when the beauveria bassiana Bb1003 fermentation liquid of the invention is a reaction liquid and reacts with silver nitrate with different concentrations for 24 h.

FIG. 12 is a diagram of the ultraviolet absorption spectrum of the reaction solution of Beauveria bassiana Bb1003 of the invention for synthesizing nano-silver under different pH conditions.

FIG. 13 shows the color change of the fermentation liquid of Beauveria bassiana Bb1003 of the invention under the reaction conditions of different pH values.

FIG. 14 is a graph of the ultraviolet absorption spectrum of nano-silver synthesized by using beauveria bassiana Bb1003 fermentation liquor as a reaction solution for 16h and 30 d.

FIG. 15 is a TEM image of nano-silver synthesized by using a beauveria bassiana Bb1003 fermentation liquid of the present invention as a reaction liquid.

FIG. 16 is an XRD pattern of nano silver synthesized by using beauveria bassiana Bb1003 fermentation liquor as reaction liquid.

FIG. 17 is an FTIR spectrum of nano-silver synthesized by using beauveria bassiana Bb1003 fermentation liquid as reaction liquid.

FIG. 18 is a diagram of the bacteriostatic effect of nano silver synthesized by using beauveria bassiana Bb1003 fermentation liquid as reaction liquid on Escherichia coli.

FIG. 19 is a comparison chart of the bacteriostasis of the fermentation liquor of beauveria bassiana Bb1003 to Escherichia coli.

FIG. 20 is a diagram of the bacteriostatic effect of nano silver on Bacillus subtilis synthesized by using a beauveria bassiana Bb1003 fermentation liquid as a reaction liquid.

FIG. 21 is a comparison chart of the bacteriostasis of the fermentation liquor of beauveria bassiana Bb1003 to the bacillus subtilis.

FIG. 22 is a diagram of the bacteriostatic effect of nano silver on Staphylococcus aureus, which is synthesized by using a beauveria bassiana Bb1003 fermentation liquid as a reaction liquid.

FIG. 23 is a comparison chart of the fermentation broth of Beauveria bassiana Bb1003 of the present invention against Staphylococcus aureus.

Detailed Description

The invention is further illustrated by the following examples.

Example 1

The beauveria bassiana Bb1003 is separated from the bombyx batryticatus accidentally discovered by silkworm breeding farmers in the subying town of Yangcheng county in Shanxi province. The 16SrDNA sequence homology alignment is adopted to identify the gene asBeauveria bassiana. The strain is preserved in China general microbiological culture Collection center (CGMCC) at 9 months and 30 days in 2021, and the preservation numbers are as follows: CGMCC No.23269, preservation Address: the institute of microbiology, national academy of sciences No.3, Xilu No. 1, Beijing, Chaoyang, Beijing.

Example 2

(1) activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 28 ℃ for 5 days for later use;

(2) preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 4 days at 28 ℃ and 180rpm, centrifuging the fermentation liquor for 30min at the rotation speed of 4000rpm, and filtering by using filter paper to collect supernatant for later use;

(3) and (3) synthesizing nano silver: taking the supernatant of the fermentation liquor prepared in the step (2) as a reaction substrate, adding 4 mmol/L silver nitrate solution, reacting for 24h under the condition of pH7, centrifuging for 20min under the condition of 10000rpm, taking the precipitate, adding equivalent distilled water for ultrasound, repeating the centrifugation for two times, drying the obtained precipitate at 50 ℃ overnight, and obtaining powder which is the nano-silver.

Example 3

(1) activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 30 ℃ for 2 days for later use;

(2) preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 7 days at 30 ℃ and 150rpm, centrifuging the fermentation liquor for 30min at the rotation speed of 4000rpm, and filtering by using filter paper to collect supernatant for later use;

(3) and (3) synthesizing nano silver: taking the supernatant of the fermentation liquor prepared in the step (2) as a reaction substrate, adding 1 mmol/L silver nitrate solution, reacting for 2h under the condition of pH9, centrifuging for 20min under the condition of 10000rpm, taking the precipitate, adding equivalent distilled water for ultrasound, repeating the centrifugation for two times, drying the obtained precipitate at 50 ℃ overnight, and obtaining powder which is the nano-silver.

Example 4

(1) activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 29 ℃ for 3 days for later use;

(2) preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 5 days at 29 ℃ and 160rpm, centrifuging the fermentation liquor for 30min at the rotation speed of 4000rpm, and filtering by using filter paper to collect supernatant for later use;

(3) and (3) synthesizing nano silver: taking the supernatant of the fermentation liquor prepared in the step (2) as a reaction substrate, adding 2mmol/L silver nitrate solution, reacting for 12h under the condition of pH8, centrifuging for 20min under the condition of 10000rpm, taking the precipitate, adding equivalent distilled water for ultrasound, repeating the centrifugation for two times, drying the obtained precipitate at 50 ℃ overnight, and obtaining powder which is the nano-silver.

Example 5

(1) activating strains: inoculating beauveria bassiana Bb1003 stored at 4 ℃ into an activation culture medium, and performing activation culture at 28 ℃ for 4 days for later use;

(2) preparing a fermentation liquid: inoculating the activated strain prepared in the step (1) into a fermentation culture medium, fermenting and culturing for 6 days at 30 ℃ and 1700rpm, centrifuging the fermentation liquor for 30min at the rotation speed of 4000rpm, and filtering by using filter paper to collect supernatant for later use;

(3) and (3) synthesizing nano silver: taking the supernatant of the fermentation liquor prepared in the step (2) as a reaction substrate, adding 3 mmol/L silver nitrate solution, reacting for 8h under the condition of pH9, centrifuging for 20min under the condition of 10000rpm, taking the precipitate, adding equivalent distilled water for ultrasound, repeatedly centrifuging twice, drying the obtained precipitate at 50 ℃ overnight, and obtaining powder, namely the nano-silver.

Sequence listing

<110> Shanxi university of agriculture

ATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTCACA

<120> beauveria bassiana Bb1003 and method for synthesizing nano-silver by mediating the beauveria bassiana Bb1003

<141> 2022-06-07

<160> 0

<170> SIPOSequenceListing 1.0

Claims

1. Beauveria bassiana (balsamo) Vuillemin ((B))Beauveria bassiana) Bb1003, which is preserved in China general microbiological culture Collection center (CGMCC) at 30 months 9 and 2021, with the preservation number as follows: CGMCC No.23269, preservation address: the institute of microbiology, national academy of sciences No.3, Xilu No. 1, Beijing, Chaoyang, Beijing.

2. Using beauveria bassiana Bb1003 (Beauveria bassiana) The method for synthesizing the nano silver comprises the following steps: