CN114426990B - Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof - Google Patents
Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof Download PDFInfo
- Publication number
- CN114426990B CN114426990B CN202210217419.7A CN202210217419A CN114426990B CN 114426990 B CN114426990 B CN 114426990B CN 202210217419 A CN202210217419 A CN 202210217419A CN 114426990 B CN114426990 B CN 114426990B
- Authority
- CN
- China
- Prior art keywords
- biological
- tellurium
- tellurite
- deionized water
- thalli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Mycology (AREA)
- Botany (AREA)
- Inorganic Chemistry (AREA)
- Epidemiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for synthesizing biological tellurium nanoparticles through high tellurite tolerant bacteria mediation, which is prepared through the steps comprising the following steps: 1) Obtaining the strain Mortierella AB 1%Mortierella sp.AB1, preserved in China Center for Type Culture Collection (CCTCC) M20211177); 2) Fermenting; 3) Adding tellurite solution into the modified PDA to continue growing; 4) Collecting thalli, carrying out suction filtration, washing, suction filtration, freezing, grinding and resuspension; 5) Washing with Tris-HCl, n-octanol, washing with deionized water, and resuspension. The invention also provides application of the biological tellurium nanoparticles in preparation of antibacterial drugs. The strain has stable biological function and strong tellurite reducing capability and biological tellurium nanoparticle synthesizing capability; the product has low price of raw materials, simple synthesis process conditions, safety and controllability, simple preservation mode, high stability and strong antibacterial capability.
Description
Technical Field
The invention relates to the technical field of biological nano materials, in particular to biological tellurium nano particles synthesized by high tellurite tolerance bacteria mediation and application thereof in preparation of antibacterial drugs.
Background
In the past researches, tellurium and compounds thereof are widely applied to various industries such as metallurgy, electronics, application chemical industry and the like, and the existence of tellurium oxide in the environment causes attention to water and soil pollution. Research shows that even at low concentration, tellurium oxide has toxicity to most microorganisms, and simple substance tellurium has lower toxicity, small solubility and wider application than tellurium oxide. The microbial detoxification mechanism is utilized to reduce the Te (IV) with high toxicity into simple substance tellurium with lower toxicity, which is an important mode beneficial to bioremediation of Te (IV) pollution and reasonable utilization of tellurium resources. Bacterial infections are one of the most important causes of death worldwide, and overuse of antibiotics leads to an increasing bacterial resistance to antibiotics, which constitutes a serious threat to human health. The recent progress of nanotechnology is to "replace" antibiotics to kill bacteria, and the challenge of solving bacterial infection provides new opportunities, and in the research of developing novel functional organic nano antibacterial materials, the biological method is utilized to synthesize the required organic nano antibacterial materials, which has important significance for relieving bacterial infection in the environment.
Many microorganisms report that Te (IV) can be reduced into tellurium nanostructures in an extracellular or intracellular mode through enzymatic or non-enzymatic reactions, however, the research of synthesizing tellurium nanometers by fungi is less, and in addition, the research also utilizes biological synthesized tellurium nanomaterials as antibacterial materials, on one hand, to relieve the high toxicity of Te (IV) in the environment, and on the other hand, the produced biological tellurium nanoparticles have unique antibacterial functions and have double significance for relieving environmental problems, and the invention fills the technical blank in the direction.
According to the invention, a strain with high tellurite tolerance is screened, the reduction capability of the strain to tellurite is detected, biological tellurium nanoparticles generated by tellurite reduction are subjected to characterization analysis by using methods such as a scanning electron microscope, a transmission electron microscope, element Mapping, infrared spectrum and the like, and antibacterial activity and object surface sterilization effect of the biological tellurium nanoparticles are respectively evaluated by using a bacteriostasis circle experiment and a dilution coating flat plate method; in addition, the strain can be used for synthesizing biological tellurium nanoparticles with antibacterial effect while reducing Te (IV) with high toxicity into simple substance tellurium with low toxicity.
Disclosure of Invention
The invention aims to solve the technical defects that Te (IV) has high toxicity in the environment while biological tellurium nano particles with unique antipathogenic bacteria functions are not synthesized in the prior art, and provides the biological tellurium nano particles which are prepared by the method and are low in raw material cost, low in production cost, simple in synthesis process, remarkable in antibacterial effect, strong in practicability, rich in biological functions, green and environment-friendly, and capable of providing economic and efficient high tellurite resistant bacteria mediated synthesis for the environment-friendly industry.
In order to achieve the technical aim, the invention provides biological tellurium nanoparticles synthesized by high tellurite tolerant bacteria mediation, which is characterized by comprising the following steps:
1) The strain Mortierella AB1 (Mortierella sp.AB1, deposited in China center for type culture collection, with a deposit number of CCTCC M20211177) is obtained;
2) Inoculating Mortierella jenkinii AB1 obtained in the step 1) into a corn meal culture medium, and growing for 2-3 days in a shaking table at 26-28 ℃ and 180-200 r/min to obtain fermentation liquor;
3) Inoculating the fermentation broth obtained in the step 2) into an improved PDA, and simultaneously adding a tellurite solution to ensure that the final concentration of tellurite ions in a culture medium is 0.3-0.5 mM, and continuously growing for 6-7 days in a shaking table at 26-28 ℃ and 180-200 r/min;
4) Collecting the thalli grown in the step 3), carrying out suction filtration, washing and secondary suction filtration on the thalli, then freezing the thalli at the temperature of minus 78 ℃ to minus 80 ℃ for 5 to 6 hours, adding liquid nitrogen, grinding into powder, adding deionized water, and resuspension to obtain heavy suspension;
5) Washing the heavy suspension obtained in the step 4) with Tris-HCl for 2-3 times, n-octanol for 2-3 times and deionized water for 2-3 times under the conditions of 10000-12000 rpm and 5-10 min, and finally, re-suspending the collected precipitate in deionized water to obtain the Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano particles.
Preferably, the biological tellurium nanoparticles are characterized by being prepared by steps comprising the following method:
1) The method comprises the steps of obtaining the strain mortierella AB1, wherein the obtaining process is as follows:
a, selecting waste soil, adding normal saline, and uniformly mixing to obtain a soil sample;
b heating and dissolving the solid LB culture medium, adding K 2 TeO 3 C, pouring a flat plate, taking the soil sample obtained in the step a, uniformly coating the soil sample on the surface of the flat plate, and culturing to obtain black hyphae;
c, selecting black hypha obtained in the step b, and inoculating the black hypha to a solid PDA (personal digital assistant) flat plate for culture;
d, cutting a small solid PDA containing hypha after culturing in the step c, adding the solid PDA into the PDA, and culturing to obtain the strain Mortierella AB1;
2) Inoculating Mortierella dichotoma AB1 obtained in step 1) into corn meal culture medium, and growing in a shaking table at 28 ℃ and 200r/min for 3 days to obtain fermentation liquor;
3) Inoculating the fermentation broth obtained in the step 2) into an improved PDA, and simultaneously adding a potassium tellurite solution to ensure that the final concentration of the potassium tellurite in a culture medium is 0.5mM, and continuously growing for 7 days in a shaking table at 28 ℃ and 200 r/min;
4) Collecting the thalli grown in the step 3), carrying out suction filtration, washing and suction filtration again on the thalli, then freezing the thalli at the temperature of minus 78 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, adding deionized water, and resuspending to obtain heavy suspension;
5) Washing the heavy suspension obtained in the step 4) with Tris-HCl for 2 times, n-octanol for 2 times and deionized water for 2 times under the conditions of 12000rpm and 5min, and finally, re-suspending the collected precipitate in deionized water to obtain the Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano particles.
The invention also provides application of the biological tellurium nanoparticles in preparation of antibacterial drugs.
Preferably, the bacteria are one or more of shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium.
Further preferably, the bacterium is E.coli.
The beneficial effects of the invention are as follows: the strain has stable biological function, strong tellurite reduction capability and biological tellurium nanoparticle synthesis capability, low sources of production raw materials, simple synthesis process conditions, and safe and controllable acquisition mode, mild reaction conditions, simple storage mode, higher stability and higher antibacterial activity, and the metabolites with strong antibacterial capability are synthesized by the unique biological functions of the microorganisms.
[ description of the drawings ]
FIG. 1 is a Mortierella sp.AB1 morphology view;
FIG. 2 is a Mortierella sp.AB1 phylogenetic tree analysis;
FIG. 3 is a graph of Mortierella sp.AB1 tellurite tolerance test results;
FIG. 4 is a graph of Mortierella sp.AB1 tellurite reducibility test results;
FIG. 5 is a diagram of a biological tellurium nanoparticle transmission electron microscope and an element Mapping detection;
FIG. 6A is a Fourier infrared spectrum of biological tellurium nanoparticles;
FIG. 6B is a spectrum of the element Te (0) for X-ray photoelectrons of the biological tellurium nanoparticles;
FIG. 7 is a graph showing the detection of the antibacterial effect of biological tellurium nanoparticles;
FIG. 8 is a graph showing the results of example 9.
[ detailed description ] of the invention
For a better understanding of the present invention, embodiments are described in detail below with reference to the drawings. It is to be understood that this example is for illustration of the invention only and is not intended to limit the scope of the invention.
The technical means adopted in this embodiment are conventional technical means in the art unless specifically described otherwise.
EXAMPLE 1 isolation, screening and identification of tellurite resistant strains
(1) Selecting 1g of waste garbage soil sample, adding 10mL of sterilized physiological saline with the mass-volume ratio of 0.85%, and uniformly mixing in a shaking table at 37 ℃ and 200rpm for 30min;
(2) 100mL solid LB culture is heated and dissolvedBase (tryptone 10g, yeast extract 5g, sodium chloride 10g, agar 20g, add dd H) 2 O is used after sterilization for 20min at 121 ℃ with a constant volume of 1000mL, and potassium tellurite (K) with a final concentration of 0.1mmol/L is added 2 TeO 3 ) Pouring a flat plate, taking 200 mu L of the dissolved soil sample, uniformly coating the soil sample on the surface of the flat plate, and culturing for 16 hours at 37 ℃;
(3) Selecting black mycelium, inoculating to solid PDA plate (potato 200g, glucose 20g, agar 20g, adding dd H) 2 O is used after sterilization for 20min at the temperature of 121 ℃ with the constant volume of 1000mL, and is cultivated for 6 to 7 days at the temperature of 28 ℃;
(4) Cutting small solid PDA (containing hypha), adding into 100mL liquid PDA, and culturing at 28deg.C and 200r/min for 3-5 days to obtain liquid strain;
(5) Cutting small solid PDA (containing hypha), adding into 10mL test tube inclined plane PDA, culturing at 28deg.C for 3-5 days to obtain inclined plane strain;
(6) Morphology observation: inoculating an original test tube inclined plane PDA to a flat plate, observing the strain morphology in the flat plate, picking hyphae on the flat plate, and observing and detecting under a light mirror;
(7) Molecular biology identification: the genomic DNA of Mortierella AB1 strain is used as a template, the region amplification specific fragment (SEQ ID NO. 1) of ITS rRNA is selected, the universal primers ITS1 (SEQ ID NO.2: 5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3') are selected, and the PCR reaction system is as follows: 2min at 98 ℃, 10s at 58 ℃, 10s at 72 ℃,35 cycles, 5min at 72 ℃, sequencing by using a TSINGKE DNA gel recovery kit (Code No. GE0101) for cutting gel to recover target fragments, selecting a representative strain sequence for further analysis in NCBI functional nets, performing phylogenetic analysis by adopting MEGA 11 software, constructing an adjacent tree by a Neighbor-Joining method, performing total cycle for 1000 times, classifying strains according to a group relation in the phylogenetic tree, and identifying strain species;
(8) Strain preservation: and (3) selecting a test tube inclined plane PDA (containing hyphae) which grows for 3-5 days, and preserving the test tube inclined plane PDA in China center for type culture collection of university of Wuhan, wherein the preservation number is CCTCC M20211177, and the preservation certificate is shown in annex 1.
The results illustrate:
screening tellurite tolerant strains through a culture medium containing tellurite, and measuring 610bp (accession number: OL 825013.1) of ITS sequences of the strains according to morphological observation of the strains such as 40 times optical microscope observation (FIG. 1A), scanning electron microscope observation (FIG. 1B), flat hypha (FIG. 1C), liquid culture medium mycelium (FIG. 1D) and the like, wherein the strains are shown to be mould strains, and the sequence is compared in molecular biology, and the specific sequence is shown as SEQ ID NO.1; the strain was identified as Mortierella AB1 (Mortierella sp.AB1) by Blast alignment, construction of a evolutionary tree (FIG. 2), and combination of morphological features.
EXAMPLE 2 tellurite resistance test
(1) Optimizing the culture medium: the first-stage shake flask uses corn meal culture medium (corn meal 40g/L, KNO) 3 2g/L，NaHPO 4 1g/L，MgSO 4 ·7H 2 O0.3 g/L), sealing after culture medium preparation, and sterilizing at 121deg.C for 20 min. Two-stage shake flasks used modified PDA medium (potato 200g/L, KNO) 3 2g/L，NaHPO 4 1g/L，MgSO 4 ·7H 2 O0.3 g/L), sealing after preparing culture medium, sterilizing at 121deg.C for 20 min;
(2) Using the inclined plane strain in the example 1, cutting small solid PDA (containing hypha), adding into a primary shaking bottle of 100mL, and culturing for 3-5 days at 28 ℃ under the condition of 200r/min to obtain a proper amount of liquid strain;
(3) Adding 5mL of liquid strain in the primary shaking flask into 100mL of secondary shaking flask, and culturing for 3-5 days at 28 ℃ and 200r/min to obtain a large amount of liquid strain;
(4) Preparing an improved PDA solid culture medium by using a culture medium formula of a secondary shake flask, adding 2% of agar, sub-packaging in conical flasks, and sterilizing at 121 ℃ for 20 min;
(5) Heating to dissolve 20mL of modified PDA solid culture medium, adding potassium tellurite (K) with final concentration of 0-28 mM 2 TeO 3 ) Pouring a flat plate;
(6) The slant strain in example 1 was used, small solid PDA (containing hyphae) was cut, placed in a modified PDA solid medium, grown for 6 to 7 days at 28℃and the strain growth was observed.
The results illustrate:
as a result, as shown in FIG. 3, the strain in the inclined plane PDA of example 2 was used to inoculate a plate medium containing tellurite at different concentration gradients, and the result shows that after 6 days of growth of the strain, 0mM (FIG. 3A), 5mM (FIG. 3B), 15mM (FIG. 3C) and 25mM (FIG. 3D) showed a decrease in growth activity of the strain with an increase in potassium tellurite concentration, and at a final potassium tellurite concentration exceeding 25mM, the strain had no obvious signs of growth, indicating that the strain had a maximum resistance to potassium tellurite of about 25mM.
EXAMPLE 3 tellurite reducibility test
(1) And (3) making a standard curve: a. 5mg/mL sodium borohydride was formulated. b. Preparation of 10mM K 2 TeO 3 And 8-fold dilution was performed, leaving a 0 value. c. 300mM PBS (pH 7) was formulated. d. 50. Mu.L of sodium borohydride, 50. Mu.L of potassium tellurite and 200. Mu.L of PBS are added into a 500. Mu.L centrifuge tube, uniformly mixed, and reacted for 10min at 60 ℃. e. 200. Mu.L of the reaction solution was taken into a 96-well plate at OD 500 Measuring absorbance and preparing a standard curve;
(2) Using the secondary shake flask liquid strain of example 2, 5mL of the bacterial liquid was added to 100mL of modified PDA liquid medium (containing potassium tellurite at a final concentration of 0.5 mM);
(3) Taking 500 μL of culture medium liquid every 24h, centrifuging at 12000rpm for 10min, taking 50 μL of sample, uniformly mixing with 50 μL of sodium borohydride and 200 μL of PBS, reacting at 60deg.C for 10min, taking 200 μL of reaction solution into 96-well plate, and concentrating at OD 500 Measuring absorbance;
(4) The conditions were unchanged, sampling was continued, at OD 500 The absorbance was measured and the residual Te (IV) content was measured.
The results illustrate:
as shown in FIG. 4, the second-stage shake flask of example 2 was used as a strain medium, the reduction ability of the strain to tellurite was measured, a standard curve was prepared by using sodium borohydride as a strong reducing agent, and the strain was introducedOverdetermined OD 500 The absorbance of the strain was monitored, and the result showed that the strain was completely reduced to a final concentration of 0.5mM tellurite within 6 days by using a secondary shaking flask as a medium and an inoculum size of 5%.
EXAMPLE 4 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn meal culture medium, and growing for 3 days in a shaking table at 26 ℃ and 180 r/min;
(2) Inoculating 5mL of fermentation broth into 100mL of modified PDA, adding 300 mu L of potassium tellurite solution (100 mM) at the same time, and continuing to grow for 7 days in a shaking table at 26 ℃ and 180 r/min;
(3) Collecting thalli, carrying out suction filtration on thalli containing biological tellurium nano particles, washing thalli with deionized water, carrying out suction filtration again, freezing thalli at the temperature of minus 78 ℃ for 6 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for resuspension;
(4) Washing with Tris-HCl, n-octanol and deionized water for 3 times at 10000rpm for 10min, respectively, and finally re-suspending the collected precipitate in deionized water to obtain biological tellurium nanoparticles (Biological Tellurium Nanoparticles, bio-TeNPs).
EXAMPLE 5 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn meal culture medium, and growing for 2 days in a shaking table at 27 ℃ and 190 r/min;
(2) Inoculating 5mL of fermentation broth into 100mL of modified PDA, adding 400 mu L of potassium tellurite solution (100 mM) at the same time, and continuing to grow for 6 days in a shaking table at 27 ℃ and 190 r/min;
(3) Collecting thalli, carrying out suction filtration on thalli containing biological tellurium nano particles, washing thalli with deionized water, carrying out suction filtration again, freezing thalli at-80 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for resuspension;
(4) Washing with Tris-HCl, n-octanol and deionized water for 2 times at 12000rpm for 8min, and finally re-suspending the collected precipitate in deionized water to obtain biological tellurium nanoparticles (Biological Tellurium Nanoparticles, bio-TeNPs).
EXAMPLE 6 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn meal culture medium, and growing for 3 days in a shaking table at 28 ℃ and 200 r/min;
(2) Inoculating 5mL of fermentation broth into 100mL of modified PDA, adding 500 mu L of potassium tellurite solution (100 mM) at the same time, and continuing to grow for 7 days in a shaking table at 28 ℃ and 200 r/min;
(3) Collecting thalli, carrying out suction filtration on thalli containing biological tellurium nano particles, washing thalli with deionized water, carrying out suction filtration again, freezing thalli at the temperature of minus 78 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for resuspension;
(4) Washing with Tris-HCl, n-octanol and deionized water for 2 times under the conditions of 12000rpm and 5min respectively, and finally re-suspending the collected precipitate in deionized water to obtain biological tellurium nano particles (Biological Tellurium Nanoparticles, bio-TeNPs);
(5) 1mL of biological tellurium nanoparticle extract is taken and dried for 3 days in a baking oven at 60 ℃ to determine the dry weight.
The results illustrate:
the bacterial strain is inoculated in a secondary shake flask, meanwhile, potassium tellurite solution is added in the growth process of the bacterial strain, te (IV) is transferred into cells in the growth process of the bacterial strain and reduced into biological tellurium nanoparticles, white color of the bacterial strain can be obviously observed to be changed into black color, cells are broken through liquid nitrogen grinding, the intracellular biological tellurium nanoparticles are released, and the biological tellurium nanoparticles are finally obtained through a series of washing and purifying processes.
Example 7 characterization analysis of biological tellurium nanoparticles
(1) Using biological tellurium nano particles extracted in the example 6, placing the biological tellurium nano particles in an ultralow temperature refrigerator at the temperature of minus 80 ℃ for 1-2 hours, using a vacuum freeze dryer, continuously freeze-drying for 16-24 hours, and collecting the biological tellurium nano particles;
(2) Using a powdery sample to perform infrared spectrum and X-ray photoelectron spectroscopy scanning, and using a liquid sample to perform transmission electron microscope and element Mapping analysis;
the results illustrate:
as shown in fig. 5, 6A and 6B, the biological tellurium nanoparticles in different fields of view are observed through a transmission electron microscope, and the shape of the biological tellurium nanoparticles is determined to be rod-shaped, and the size of the biological tellurium nanoparticles is about 100nm to 500nm (fig. 5 ABC); through element Mapping analysis, elements of tellurium (figure 5D), carbon (figure 5E), nitrogen (figure 5F), oxygen (figure 5G), phosphorus (figure 5H) and sulfur (figure 5I) are uniformly distributed on the surface of the alloy, and tellurium elements and various organic matters are uniformly distributed on the surface of the alloy; biological tellurium nanoparticles were analyzed by infrared spectroscopic scanning (FIG. 6A) and found at 3415.74 (hydroxy), 3012.09 (alkenyl), 2925.54 (methylene), 2855.58 (methylene), 1744.93 (ester), 1628.41 (alkenyl), 1459.01 (aromatic ring group), 1240.62 (aromatic phosphate), 1152.55 (tertiary amine, CN vibration), 1080.53 (sulfate ion), 707.35 (aryl sulfide), 576.19 (disulfide) and 432.19 (aryl disulfide) cm -1 Vibration is generated, which indicates that the biological tellurium nano-particles contain organic matters such as proteins, lipids and the like, inorganic salt ions and the like; analyzing the valence state of the biological tellurium nano-particle element by an X-ray diffraction technology, determining that the biological tellurium nano-particle element has the highest peaks at 573.29 and 584.0 (as shown in figure 6B), and marking the valence state of the tellurium element as 0; the biological tellurium nano particles are comprehensively obtained, the shape of the biological tellurium nano particles is of an irregular rod-shaped structure, the size of the biological tellurium nano particles is 100-500 nm, the valence state of tellurium elements is 0, and tellurium elements, organic matters such as proteins and lipids and inorganic salt ions are uniformly distributed on the surfaces of the biological tellurium nano particles.
Example 8 antibacterial application of biological tellurium nanoparticles
(1) The concentration of the biological tellurium nanoparticles extracted in example 6 was formulated to be 10mg/mL, 1mg/mL, 0.1mg/mL;
(2) Selecting 100 mu L of shigella dysenteriae (Shigella dysenteriae CMCC 51252), enterobacter sakazakii (Enterobacter sakazakii ATCC 51329), escherichia coli (Escherichia coli ATCC 25922) and salmonella typhimurium (Salmonella typhimurium ATCC 14028) mother strains, respectively inoculating the mother strains into MHA culture medium (Mueller Hinton Agar) (formula: beef powder: 6.0g/L, soluble starch: 1.5g/L, acid hydrolyzed casein: 17.5g/L, agar: 17.0 g/L), and culturing overnight at 25 ℃;
(3) Washing, re-suspending and collecting bacteria in an MHA culture dish by using physiological saline with the mass percentage of 0.85%, and adjusting the turbidity of the bacteria to 0.5M by using a turbidimeter;
(4) Taking 50 mu L of bacterial suspension, and respectively coating shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium into an MHA culture dish;
(5) Placing a sterilized oxford cup with an inner diameter of 6mm (an outer diameter of 8 mm) in the center of each culture dish;
(6) Respectively taking 10mg/mL, 1mg/mL and 0.1mg/mL biological tellurium nanoparticles (100 mu L) and adding the biological tellurium nanoparticles into a sterilized oxford cup;
(7) Culturing at 25deg.C for 15 hr, and recording diameter of the inhibition zone in the culture dish.
The results illustrate:
as shown in fig. 7, the antibacterial effect of the biological tellurium nanoparticles was measured by agarose gel diffusion, and the antibacterial potency was determined according to the size of the antibacterial zone, which showed that the biological tellurium nanoparticles could well inhibit the growth of shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium by 0.5M, and the antibacterial ability was evaluated according to the size of the antibacterial zone within 15 hours, the specific antibacterial zone size results are shown in table 1, and the results showed that the biological tellurium nanoparticles could well inhibit the growth of shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium under conditions of 10mg/mL and 1mg/mL, whereas the saline of the control group did not form the antibacterial zone, only the outer diameter ring of oxford cup was 8mm.
TABLE 1 antibacterial Effect of biological tellurium nanoparticles at different concentrations (Unit: mm)
Remarks: ND represents a non-antibacterial effect.
Example 9 biological tellurium nanoparticles antibacterial application example
(1) About 8 x 10 9 cfu/mL of E.coli ATCC25922 50. Mu.L of the bacterial suspension, 2 times of coating, 25. Mu.L/time, and uniformly coating on a glass slide of 2cm by 2 cm;
(2) About 15 minutes, after the bacterial liquid was dried on a glass slide, 100. Mu.L of the biological tellurium nanoparticles extracted in example 6 at a concentration of 10mg/mL was added to cover the area coated with the bacterial liquid, while 100. Mu.L of physiological saline was used as a control;
(3) After 30 minutes of material treatment at room temperature, microorganisms in a 2cm x 2cm area are collected by using a sterile cotton swab, and then the cotton swab head is soaked in 1mL of 0.85% physiological saline;
(4) Then 50 mu L of the physiological saline and biological tellurium nano particles are taken and diluted to 10 in a gradient way -3 After coating MHA plates, the number of colonies was counted.
The results illustrate:
as shown in FIG. 8, colony counting is carried out by a dilution plate method, the actual sterilization effect of the object surface is evaluated, the data show that the survival rate of the escherichia coli after being treated by 10mg/mL and normal saline (control group) is 15.13 percent and 100 percent respectively, and the result shows that the biological tellurium nano-particles can inactivate the escherichia coli contacted with the overload glass within 30 minutes, and the maximum inactivation rate can reach 84.87 percent.
The method comprises the following steps: SEQ ID NO.1 (ITS sequence of Mortierella sp.AB1)
GCGGAAGGATCATTCATAATCAAGTGTTTTTATGGCACTTTCAAAAATCCAT
ATCCACCTTGTGTGCAATGTCATCTCTCTGGGGGCTGCCGGCTGTCAAAAG
CCGTGTGGTCACCTTTGGGATTTATATCTACTCAGAACTTTAGTGATTTTGTC
TGAAACATATTATGAATACTTAATTCAAAATACAACTTTCAACAACGGATCT
CTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGA
ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTG
GTATTCCGGAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAACTTCCAT
ATCTTTTTTGAAATGGGAGTTGGACTTGAGTGATCCCAACGCTTTTCCTTAC
CGAAAAGTGGCGGGTTACTTGAAATGCAGGTGCAGCTGGACTTTTCTCTGA
GCTATAAGCATATCTATTTAGTCTGCCTAAAAAACAGATTATTACCTTTGCTG
CAGCTAACATAAAGGAGATTAGTTCTTGTGCTGACTGATGCAGGATTCACA
AAGACAGGCTTCGGCCGACTTTGTAAACTCGATCTCAAAT
Sequence listing
<110> university of Hubei
<120> high tellurite tolerant bacteria mediated synthesis biological tellurium nano particle and antibacterial application thereof
<141> 2022-03-07
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 610
<212> DNA
<213> Artificial Sequence
<400> 1
gcggaaggat cattcataat caagtgtttt tatggcactt tcaaaaatcc atatccacct 60
tgtgtgcaat gtcatctctc tgggggctgc cggctgtcaa aagccgtgtg gtcacctttg 120
ggatttatat ctactcagaa ctttagtgat tttgtctgaa acatattatg aatacttaat 180
tcaaaataca actttcaaca acggatctct tggctctcgc atcgatgaag aacgcagcga 240
aatgcgatac gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcatat 300
tgcgctctct ggtattccgg agagcatgct tgtttgagta tcagtaaaca cctcaacttc 360
catatctttt ttgaaatggg agttggactt gagtgatccc aacgcttttc cttaccgaaa 420
agtggcgggt tacttgaaat gcaggtgcag ctggactttt ctctgagcta taagcatatc 480
tatttagtct gcctaaaaaa cagattatta cctttgctgc agctaacata aaggagatta 540
gttcttgtgc tgactgatgc aggattcaca aagacaggct tcggccgact ttgtaaactc 600
gatctcaaat 610
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 2
tccgtaggtg aacctgcgg 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
tcctccgctt attgatatgc 20
Claims (4)
1. A method for Gao Yadi acid salt tolerant bacteria mediated synthesis of biological tellurium nanoparticles, characterized by comprising the steps of:
1) Mortierella globalpina AB1Mortierella sp and AB 1) inoculating to a corn meal culture medium, and growing for 2-3 days in a shaking table at 26-28 ℃ and 180-200 r/min to obtain fermentation liquor; the Mortierella zychae AB1 is preserved in China Center for Type Culture Collection (CCTCC) M20211177;
2) Inoculating the fermentation liquor obtained in the step 1) into an improved PDA, and simultaneously adding a tellurite solution to ensure that the final concentration of tellurite ions in a culture medium is 0.3-0.5 mM, and continuously growing for 6-7 days in a shaking table at 26-28 ℃ and 180-200 r/min;
3) Collecting the thalli grown in the step 2), carrying out suction filtration, washing and secondary suction filtration on the thalli, then freezing the thalli at the temperature of minus 78 ℃ to minus 80 ℃ for 5-6 hours, adding liquid nitrogen, grinding into powder, adding deionized water, and resuspension to obtain heavy suspension;
4) Washing the heavy suspension obtained in the step 3) with Tris-HCl for 2-3 times, n-octanol for 2-3 times and deionized water for 2-3 times under the conditions of 10000-12000 rpm and 5-10 min, and finally, re-suspending the collected precipitate in deionized water to obtain the Gao Yadi acid salt tolerant bacteria mediated synthesized biological tellurium nanoparticle.
2. The method of claim 1, comprising the steps of:
1) Inoculating Mortierella dichotoma AB1 into corn meal culture medium, and growing in a shaking table at 28deg.C and 200r/min for 3 days to obtain fermentation liquor;
2) Inoculating the fermentation broth obtained in the step 1) into an improved PDA, and simultaneously adding a potassium tellurite solution to ensure that the final concentration of the potassium tellurite in a culture medium is 0.5 and mM, and continuously growing for 7 days in a shaking table at 28 ℃ and 200 r/min;
3) Collecting the thalli grown in the step 2), carrying out suction filtration, washing and suction filtration again on the thalli, then freezing the thalli at the temperature of minus 78 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, adding deionized water, and resuspending to obtain heavy suspension;
4) Washing the heavy suspension obtained in the step 3) with Tris-HCl for 2 times, n-octanol for 2 times and deionized water for 2 times under the conditions of 12000rpm and 5min, and finally, re-suspending the collected precipitate in deionized water to obtain the Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano particles.
3. Use of biological tellurium nanoparticles as described in claim 2 for the preparation of antibacterial drugs.
4. A use according to claim 3, wherein: the bacteria are one or more of shigella dysenteriae, enterobacter sakazakii and escherichia coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210217419.7A CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210217419.7A CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114426990A CN114426990A (en) | 2022-05-03 |
| CN114426990B true CN114426990B (en) | 2023-08-11 |
Family
ID=81314149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210217419.7A Active CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114426990B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101878535A (en) * | 2007-11-30 | 2010-11-03 | 纳米技术有限公司 | Preparation of nanoparticle material |
| CA2723655A1 (en) * | 2010-12-03 | 2012-06-03 | Queen's University At Kingston | Biosynthesis of nanoparticles |
| WO2013040472A2 (en) * | 2011-09-16 | 2013-03-21 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to dna damage repair |
| CN105502312A (en) * | 2016-01-11 | 2016-04-20 | 合肥师范学院 | Hollow spindle-shaped nanometer telluride platinum and preparation method thereof |
| CN107058284A (en) * | 2016-12-30 | 2017-08-18 | 武汉中科光谷绿色生物技术有限公司 | A kind of method that utilization flow cytometry quickly sorts Mortierella alpina Protoplast Fusant |
| CN108676817A (en) * | 2018-07-16 | 2018-10-19 | 王昊 | Utilize the method and its application of bacillus licheniformis biosynthesis nano tellurium |
| CN114569558A (en) * | 2022-03-07 | 2022-06-03 | 湖北师范大学 | Moringa oleifera straw-mediated synthesized biological tellurium nanoparticles and antibacterial and antiviral application thereof |
| CN115697892A (en) * | 2020-03-20 | 2023-02-03 | 轨迹Ip有限责任公司 | Materials and methods for efficient dispersion of nanoparticles |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2661697A1 (en) * | 2006-08-29 | 2008-03-06 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of fatty acids |
-
2022
- 2022-03-07 CN CN202210217419.7A patent/CN114426990B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101878535A (en) * | 2007-11-30 | 2010-11-03 | 纳米技术有限公司 | Preparation of nanoparticle material |
| CA2723655A1 (en) * | 2010-12-03 | 2012-06-03 | Queen's University At Kingston | Biosynthesis of nanoparticles |
| WO2013040472A2 (en) * | 2011-09-16 | 2013-03-21 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to dna damage repair |
| CN105502312A (en) * | 2016-01-11 | 2016-04-20 | 合肥师范学院 | Hollow spindle-shaped nanometer telluride platinum and preparation method thereof |
| CN107058284A (en) * | 2016-12-30 | 2017-08-18 | 武汉中科光谷绿色生物技术有限公司 | A kind of method that utilization flow cytometry quickly sorts Mortierella alpina Protoplast Fusant |
| CN108676817A (en) * | 2018-07-16 | 2018-10-19 | 王昊 | Utilize the method and its application of bacillus licheniformis biosynthesis nano tellurium |
| CN115697892A (en) * | 2020-03-20 | 2023-02-03 | 轨迹Ip有限责任公司 | Materials and methods for efficient dispersion of nanoparticles |
| CN114569558A (en) * | 2022-03-07 | 2022-06-03 | 湖北师范大学 | Moringa oleifera straw-mediated synthesized biological tellurium nanoparticles and antibacterial and antiviral application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Ao, B等.Green synthesis of biogenetic Te(0) nanoparticles by high tellurite tolerance fungus Mortierella sp. AB1 with antibacterial activity.《Frontiers in Microbiology》.2022,第13卷1-13. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114426990A (en) | 2022-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111254093B (en) | Bacillus belgii 229-15 and application thereof | |
| CN110923144B (en) | High selenate tolerant bacteria and screening method and application thereof | |
| CN108611299B (en) | Lactobacillus plantarum for producing antibacterial peptide and application thereof | |
| CN110317744B (en) | Marseillea fungus for producing blue-violet pigment and method for producing blue-violet pigment by using Marseillea fungus | |
| CN112625952B (en) | Bacillus subtilis subspecies schoenoprasu and application thereof in inhibiting cyanobacterial bloom | |
| CN113564081A (en) | Devorax SCS-3 for producing vomitoxin degrading enzyme and application thereof | |
| CN113637608A (en) | Microbacterium indieum and application thereof in synthesis of nano-selenium | |
| CN114657097B (en) | Bacillus belgii LGT-1 capable of efficiently antagonizing ralstonia solanacearum and application thereof | |
| CN113755367A (en) | Biocontrol bacterium for botrytis cinerea and application of biocontrol bacterium | |
| CN118389361A (en) | Passivation heavy metal arsenic strain As01 and application thereof | |
| CN111778178B (en) | Application of marine streptomyces griseoflavus HN60 in antibacterial aspect | |
| CN114426990B (en) | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof | |
| CN110343645B (en) | Strain bacillus pumilus SEM-7 and application thereof | |
| CN115011509B (en) | Bacterial strain for degrading kitchen waste cellulose at high temperature and screening and application thereof | |
| CN114703088B (en) | Bacillus licheniformis and application thereof | |
| CN114214235B (en) | Efficient flocculating bacterium and application thereof in sewage treatment | |
| CN113151104B (en) | Streptomyces subruaeae A148 with bacteriostatic action and application thereof | |
| CN115305222A (en) | Bacillus strain and application thereof | |
| CN112322539B (en) | Enterococcus faecium R-NTR-1 from ocean and screening method and application thereof | |
| CN114015606A (en) | Bacillus licheniformis extracellular polymeric organic selenium product and preparation method and application thereof | |
| CN113337403A (en) | Chaetomium globosum HJF 13 strain and application thereof | |
| CN109182216B (en) | Marine streptomyces SCFJ-05 with inhibition effect on succulent plant stem rot | |
| CN113564079A (en) | Paenibacillus polymyxa for producing sucrose phosphorylase and application thereof | |
| CN110835618A (en) | Rhodococcus ruber and application thereof in degrading nicotine pesticide | |
| CN114181863B (en) | Violet bacillus strain E1, preparation method thereof and application thereof in degradation of phthalate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |