CN114426990A - High tellurite tolerant bacteria-mediated synthesis of biological tellurium nanoparticles and antibacterial application thereof - Google Patents
High tellurite tolerant bacteria-mediated synthesis of biological tellurium nanoparticles and antibacterial application thereof Download PDFInfo
- Publication number
- CN114426990A CN114426990A CN202210217419.7A CN202210217419A CN114426990A CN 114426990 A CN114426990 A CN 114426990A CN 202210217419 A CN202210217419 A CN 202210217419A CN 114426990 A CN114426990 A CN 114426990A
- Authority
- CN
- China
- Prior art keywords
- biological
- tellurite
- tellurium
- mortierella
- deionized water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K33/00—Medicinal preparations containing inorganic active ingredients
- A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Botany (AREA)
- Inorganic Chemistry (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Mycology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a high tellurite tolerant bacteria-mediated synthesis biological tellurium nanoparticle, which is prepared by the following steps: 1) obtaining a strain Mortierella AB1(Mortierella sp. AB1, deposited in China center for type culture Collection with the preservation number of CCTCC M20211177); 2) fermenting; 3) adding tellurite solution into improved PDA to continue growing; 4) collecting thalli, performing suction filtration, washing, suction filtration, freezing, grinding and resuspending; 5) washing with Tris-HCl and n-octanol, washing with deionized water successively, and resuspending. The invention also provides an antibacterial application of the biological tellurium nanoparticles. The strain has stable biological function, and strong tellurite reduction capability and biological tellurium nanoparticle synthesis capability; the product has the advantages of low price of production raw materials, simple synthesis process conditions, safety, controllability, simple preservation mode, high stability and strong antibacterial ability.
Description
Technical Field
The invention relates to the technical field of biological nano materials, in particular to a biological tellurium nano particle synthesized by high tellurite-tolerant bacteria mediation and an antibacterial application thereof.
Background
In the past research, tellurium and compounds thereof are widely applied in various industries such as metallurgy, electronics, applied chemical industry and the like, and the existence of tellurium oxides in the environment draws attention to water body and soil pollution. Research shows that even under low concentration, tellurium oxide has toxicity to most microbes, and compared with tellurium oxide, simple substance tellurium has lower toxicity, low solubility and wider application. The method reduces high-toxicity Te (IV) into low-toxicity simple substance tellurium by utilizing a microbial detoxification mechanism, and is an important mode which is beneficial to bioremediation of Te (IV) pollution and reasonable utilization of tellurium resources. Bacterial infections are one of the most important causes of death worldwide, and the increased use of antibiotics causes the bacteria to have an increasing resistance to antibiotics, which poses a serious threat to human health. The latest progress of the nanotechnology is to replace antibiotics to kill bacteria, provide a new opportunity for solving the challenge of bacterial infection, and in the research of developing novel functional organic nano antibacterial materials, the required organic nano antibacterial materials are synthesized by a biological method, so that the method has important significance for relieving bacterial infection in the environment.
The literature reports that many microorganisms can reduce Te (IV) into a tellurium nano structure in an extracellular or intracellular manner through an enzymatic or non-enzymatic reaction, but the research on the synthesis of tellurium nano by using fungi is less, and in addition, the research also uses a biosynthetic tellurium nano material as an antibacterial material, so that on one hand, the high toxicity of Te (IV) in the environment is relieved, and on the other hand, the produced biological tellurium nano particles have a unique antibacterial function and have double significance on relieving the environmental problem, and the invention fills the technical blank in the direction.
According to the invention, a tellurite high-tolerance strain is screened, the reducibility of the strain to tellurite is detected, biological tellurium nanoparticles generated by the reduction of the tellurite are characterized and analyzed by methods such as a scanning electron microscope, a transmission electron microscope, an element Mapping, an infrared spectrum and the like, and the antibacterial activity and the object surface sterilization effect of the strain are respectively evaluated by a bacteriostatic zone experiment and a dilution coating plate method; in addition, the bacterial strain can be used for synthesizing biological tellurium nanoparticles with antibacterial effect while reducing high-toxicity Te (IV) into simple substance tellurium with lower toxicity.
Disclosure of Invention
The invention aims to solve the technical defects that the synthesis of biological tellurium nanoparticles with unique anti-pathogenic bacteria function is not realized in the prior art, and the high toxicity of Te (IV) in the environment can be relieved, and provides the biological tellurium nanoparticles mediated synthesis of high tellurite tolerance bacteria, which has the advantages of low raw material price, low production cost, simple synthesis process, remarkable antibacterial effect, strong practicability, rich biological functions, greenness and environmental protection, and can provide economy and high efficiency for the environmental protection industry.
In order to achieve the technical purpose, the invention provides a high tellurite-tolerant bacteria-mediated synthesis biological tellurium nanoparticle, which is characterized by being prepared by the following steps:
1) strain Mortierella AB1(Mortierella sp. AB1, deposited in China center for type culture Collection, Wuhan university No. 299 in Wuchang district, Wuhan city, Hubei province, with a preservation date of 2021, 9 and 15 days, and a preservation number of CCTCC M20211177);
2) inoculating the Mortierella AB1 obtained in the step 1) into a corn flour culture medium, and growing in a shaking table at the temperature of 26-28 ℃ and at the speed of 180-200 r/min for 2-3 days to obtain fermentation liquor;
3) inoculating the fermentation liquor obtained in the step 2) into the improved PDA, adding tellurite solution at the same time to ensure that the final concentration of tellurite radical ions in the culture medium is 0.3-0.5 mM, and continuously growing for 6-7 days in a shaking table at 26-28 ℃ and 180-200 r/min;
4) collecting the thalli grown in the step 3), carrying out suction filtration, washing and suction filtration again on the thalli, freezing the thalli for 5-6 hours at-78-80 ℃, adding liquid nitrogen, grinding into powder, adding deionized water, and carrying out heavy suspension to obtain a heavy suspension;
5) washing the heavy suspension obtained in the step 4) with Tris-HCl for 2-3 times, n-octanol for 2-3 times and deionized water for 2-3 times under the conditions of 10000-12000 rpm and 5-10 min, and finally suspending the collected precipitate in deionized water to obtain the high tellurite tolerant bacteria-mediated synthetic biological tellurium nanoparticles.
Preferably, the biological tellurium nanoparticles are characterized by being prepared by the steps comprising:
1) obtaining a strain Mortierella AB1 by the following steps:
a, selecting waste soil, adding normal saline, and uniformly mixing to obtain a soil sample;
b heating to dissolve the solid LB medium, adding K2TeO3B, pouring the flat plate, taking the soil sample obtained in the step a, uniformly coating the soil sample on the surface of the flat plate, and culturing to obtain black hyphae;
c, selecting the black hyphae obtained in the step b, and inoculating the black hyphae to a solid PDA flat plate for culture;
d, cutting small solid PDA containing hyphae after the culture in the step c, and adding the small solid PDA into the PDA for culture to obtain the strain Mortierella AB 1;
2) inoculating the Mortierella gamsii AB1 obtained in step 1) into a corn flour culture medium, and growing in a shaking table at 28 deg.C and 200r/min for 3 days to obtain a fermentation broth;
3) inoculating the fermentation liquor obtained in the step 2) into the improved PDA, simultaneously adding a potassium tellurite solution to ensure that the final concentration of the potassium tellurite in a culture medium is 0.5mM, and continuously growing for 7 days in a shaking table at 28 ℃ and 200 r/min;
4) collecting the thalli grown in the step 3), carrying out suction filtration, washing and suction filtration again on the thalli, freezing the thalli for 5 hours at-78 ℃, adding liquid nitrogen, grinding into powder, adding deionized water, and carrying out heavy suspension to obtain a heavy suspension;
5) washing the heavy suspension obtained in the step 4) with Tris-HCl for 2 times, n-octanol for 2 times and deionized water for 2 times under the conditions of 12000rpm and 5min, and finally suspending the collected precipitate in deionized water to obtain the high tellurite tolerant bacterium mediated synthetic biological tellurium nanoparticles.
The invention also provides an antibacterial application of the biological tellurium nanoparticles.
Preferably, the bacteria are one or more of shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium.
Further preferably, the bacterium is escherichia coli.
The invention has the beneficial effects that: the strain has stable biological function, stronger tellurite reducing capability and biological tellurium nanoparticle synthesis capability, low production raw material source and simple synthesis process condition, synthesizes metabolites with strong antibacterial capability by the unique biological function of the microorganism, has safe and controllable acquisition mode, mild reaction condition, simple storage mode, higher stability and higher antibacterial activity.
[ description of the drawings ]
Fig. 1 is a morphological observation diagram of Mortierella sp.ab1;
fig. 2 is a Mortierella sp.ab1 evolutionary tree analysis diagram;
fig. 3 is a graph showing results of Mortierella sp. ab1 tellurite resistance tests;
fig. 4 is a graph showing results of a Mortierella sp.ab1 tellurite reducibility test;
FIG. 5 is a transmission electron microscope and element Mapping detection diagram of biological tellurium nanoparticles;
FIG. 6A is a Fourier infrared spectrum of biological tellurium nanoparticles;
FIG. 6B is the elemental spectrum of biological tellurium nanoparticle X-ray photoelectron Te (0);
FIG. 7 is a biological tellurium nanoparticle antibacterial effect detection diagram;
FIG. 8 is a graph showing the results of example 9.
[ detailed description ] embodiments
For a better understanding of the present invention, embodiments are described in detail below with reference to the accompanying drawings. It should be understood that the examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.
The technical means adopted in the embodiment are conventional in the art, except for specific description.
Example 1 isolation, screening and identification of tellurite-tolerant strains
(1) Selecting 1g of waste garbage heap soil sample, adding 10mL of sterilized normal saline with the mass-volume ratio of 0.85%, and uniformly mixing in a shaking table at 37 ℃ and 200rpm for 30 min;
(2) heating to dissolve 100mL of solid LB medium (tryptone 10g, yeast extract 5g, sodium chloride 10g, agar 20g, adding dd H2O constant volume to 1000mL, sterilizing at 121 deg.C for 20min, adding potassium tellurite (K) with final concentration of 0.1mmol/L2TeO3) Pouring the plate, taking 200 mu L of the dissolved soil sample, uniformly coating the soil sample on the surface of the plate, and culturing for 16h at 37 ℃;
(3) selecting black mycelium, inoculating to solid PDA plate (potato 200g, glucose 20g, agar 20g, adding ddH2O is subjected to constant volume to 1000mL, is used after being sterilized at 121 ℃ for 20 min), and is cultured for 6-7 days at the temperature of 28 ℃;
(4) cutting small blocks of solid PDA (containing hyphae), adding into 100mL of liquid PDA, and culturing at 28 ℃ at 200r/min for 3-5 days to obtain liquid strains;
(5) cutting small blocks of solid PDA (containing hyphae), adding into 10mL test tube slant PDA, and culturing at 28 deg.C for 3-5 days to obtain slant strain;
(6) and (3) morphology observation: inoculating PDA (personal digital assistant) on the inclined plane of the original test tube to a flat plate, observing the strain form in the flat plate, picking hyphae on the flat plate, and observing and detecting under a light microscope;
(7) molecular biological identification: taking genome DNA of a Mortierella AB1 strain as a template, selecting an ITS rRNA region to amplify a specific fragment (SEQ ID NO.1), selecting universal primers ITS1(SEQ ID NO. 2: 5'-TCCGTAGGTGAACCTGCGG-3') and ITS4(SEQ ID NO. 3: 5'-TCCTCCGCTTATTGATATGC-3'), and carrying out PCR reaction in the following system: 2min at 98 ℃, 10s at 58 ℃, 10s at 72 ℃, 35 cycles and 5min at 72 ℃, using TSINGKE DNA gel recovery kit (Code No. GE0101) to cut gel and recover target fragments and sequencing the fragments by corresponding primers, selecting a representative strain sequence for further analysis in NCBI official networks, performing phylogenetic analysis by adopting MEGA 11 software, selecting a Neighbor-Joining method to construct an adjacent tree, circulating 1000 times, classifying the strains according to the group relationship in the phylogenetic tree, and identifying the strain species;
(8) strain preservation: selecting test tube inclined plane PDA (containing hyphae) which grows for 3-5 days, storing in China center for type culture Collection of Wuhan university with the preservation number of CCTCC M20211177, and the preservation certificate is shown in the attached list 1.
The results show that:
as shown in figures 1 and 2, tellurite-tolerant strains are screened by a culture medium containing tellurite, and the length of ITS sequences of the strains is 610bp (accession number: OL 825013.1) according to morphological observation of strains such as 40-fold optical microscope observation (figure 1A), scanning electron microscope observation (figure 1B), flat plate hyphae (figure 1C), liquid culture medium hyphae (figure 1D) and the like, the strains are shown to be mould strains, the sequences are aligned in molecular biology, and the specific sequences are shown in SEQ ID NO. 1; the strain belongs to the genus Mortierella by Blast comparison and construction of an evolutionary tree (FIG. 2), and is named Mortierella AB1(Mortierella sp. AB1) by combining morphological characteristics.
EXAMPLE 2 tellurite resistance test
(1) Optimizing a culture medium: corn meal medium (corn meal 40g/L, KNO) is used in the first-stage shake flask32 g/L， NaHPO41 g/L，MgSO4·7H2O0.3 g/L), sealing after the culture medium is prepared, and sterilizing at the temperature of 121 ℃ for 20 min. Modified PDA medium (potato 200g/L, KNO) was used in secondary shake flasks32g/L，NaHPO4 1g/L，MgSO4·7H2O0.3 g/L), sealing after the culture medium is prepared, and sterilizing at the temperature of 121 ℃ for 20 min;
(2) using the slant strain of example 1, cutting small blocks of solid PDA (containing hyphae), adding into 100mL of first-stage shake flask, and culturing at 28 deg.C and 200r/min for 3-5 days to obtain appropriate amount of liquid strain;
(3) taking 5mL of liquid strains in the first-stage shake flask, adding the liquid strains into a 100mL second-stage shake flask, and culturing for 3-5 days at 28 ℃ at 200r/min to obtain a large amount of liquid strains;
(4) adding 2% agar into a two-stage shake flask culture medium formula to prepare an improved PDA solid culture medium, subpackaging in conical flasks, and sterilizing at 121 deg.C for 20 min;
(5) heating to dissolve 20mL of improved PDA solid medium, and adding potassium tellurite (K) with a final concentration of 0-28 mM2TeO3) Pouring the plate;
(6) the slant strains in example 1 were used, small pieces of solid PDA (containing hyphae) were cut out, placed in an improved PDA solid medium, grown at 28 ℃ for 6-7 days, and the growth of the strains was observed.
The results show that:
as shown in FIG. 3, the strain obtained from the slant PDA of example 2 was inoculated into a plate medium containing various concentrations of tellurite, and the maximum tolerance of the strain to tellurite was measured, and the results showed that 0mM (FIG. 3A), 5mM (FIG. 3B), 15mM (FIG. 3C), and 25mM (FIG. 3D) showed a decrease in the growth activity of the strain with an increase in the concentration of potassium tellurite after 6 days of growth of the strain, and that the strain showed no sign of growth when the final concentration of potassium tellurite exceeded 25mM, indicating that the maximum tolerance of the strain to potassium tellurite was about 25 mM.
Example 3 tellurite reducibility test
(1) Making a standard curve: a. 5mg/mL sodium borohydride was prepared. b. 10mM K are prepared2TeO3And 8 dilutions were made, leaving a value of 0. c. 300mM PBS (pH 7) was prepared. d. Adding 50 mu L of sodium borohydride, 50 mu L of potassium tellurite and 200 mu L of PBS into a 500 mu L centrifuge tube, mixing uniformly, and reacting for 10min at the temperature of 60 ℃. e. Reaction solution 200. mu.L was put into a 96-well plate at OD500Measuring absorbance, and making a standard curve;
(2) using the second-stage shake flask liquid strain of example 2, 5mL of the strain liquid was added to 100mL of improved PDA liquid medium (containing potassium tellurite at a final concentration of 0.5 mM);
(3) collecting 500 μ L of culture medium liquid every 24 hr, centrifuging at 12000rpm for 10min, mixing 50 μ L of sample with 50 μ L of sodium borohydride and 200 μ L of PBS, reacting at 60 deg.C for 10min, collecting 200 μ L of reaction solution, loading into 96-well plate, and standing at OD500Measuring the absorbance;
(4) conditions were unchanged, samples were taken continuously, at OD500Then, the absorbance was measured, and the content of the remaining Te (IV) was measured.
The results show that:
as shown in FIG. 4, the two-stage shake flask of example 2 was used as the culture medium of the strain to determine the ability of the strain to reduce tellurite, sodium borohydride was used as a strong reducing agent to prepare a standard curve, and OD was determined by measuring500And (3) monitoring the reduction process of the strain on tellurite, wherein the result shows that the strain inoculation amount is 5% by taking the second-stage shake flask as a culture medium, and under the condition, the strain can completely reduce the tellurite with the final concentration of 0.5mM within 6 days.
Example 4 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn flour culture medium, and growing for 3 days at 26 deg.C in a shaking table at 180 r/min;
(2) inoculating 5mL of fermentation broth into 100mL of improved PDA, adding 300 μ L of potassium tellurite solution (100mM), and continuously growing in a shaking table at 26 deg.C and 180r/min for 7 days;
(3) collecting thallus, performing suction filtration on the thallus containing biological tellurium nanoparticles, washing the thallus with deionized water, performing suction filtration again, freezing the thallus at-78 ℃ for 6 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for re-suspension;
(4) washing with Tris-HCl, n-octanol and deionized water at 10000rpm for 10min for 3 times, and finally suspending the collected precipitate in deionized water to obtain Biological tellurium nanoparticles (Bio-TenPs).
Example 5 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn flour culture medium, and growing for 2 days at 27 deg.C in 190r/min shaking table;
(2) inoculating 5mL of fermentation broth into 100mL of improved PDA, adding 400 μ L of potassium tellurite solution (100mM) at the same time, and continuously growing in a shaking table at 27 deg.C and 190r/min for 6 days;
(3) collecting thallus, performing suction filtration on the thallus containing biological tellurium nanoparticles, washing the thallus with deionized water, performing suction filtration again, freezing the thallus at-80 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for re-suspension;
(4) washing with Tris-HCl, n-octanol and deionized water at 12000rpm for 8min for 2 times, and finally suspending the collected precipitate in deionized water to obtain Biological Tellurium Nanoparticles (Biological Tellurium Nanoparticles).
Example 6 Synthesis and extraction of biological tellurium nanoparticles
(1) Inoculating the slant strain in example 1 into corn flour culture medium, and growing for 3 days at 28 deg.C in a shaking table at 200 r/min;
(2) inoculating 5mL of fermentation broth into 100mL of improved PDA, adding 500 μ L of potassium tellurite solution (100mM), and continuously growing in a shaking table at 28 deg.C and 200r/min for 7 days;
(3) collecting thallus, performing suction filtration on the thallus containing biological tellurium nanoparticles, washing the thallus with deionized water, performing suction filtration again, freezing the thallus at-78 ℃ for 5 hours, adding liquid nitrogen, grinding into powder, and adding deionized water for re-suspension;
(4) washing with Tris-HCl, n-octanol and deionized water at 12000rpm for 5min for 2 times, and suspending the collected precipitate in deionized water to obtain Biological Tellurium Nanoparticles (Bio-Ternps);
(5) 1mL of the biological tellurium nanoparticle extracting solution is dried in an oven at 60 ℃ for 3 days, and the dry weight is measured.
The results show that:
inoculating the strain into a secondary shake flask, simultaneously adding a potassium tellurite solution in the growth process of the strain, transferring Te (IV) into cells in the growth process of the strain, reducing the Te (IV) into biological tellurium nanoparticles, obviously observing that the strain turns into black from white, breaking the cells by liquid nitrogen grinding, releasing the biological tellurium nanoparticles in the cells, and finally obtaining the biological tellurium nanoparticles through a series of washing and purifying processes.
Example 7 characterization of biological tellurium nanoparticles
(1) Placing the biological tellurium nanoparticles extracted in the embodiment 6 in an ultralow-temperature refrigerator at-80 ℃ for 1-2 hours, continuously freeze-drying for 16-24 hours by using a vacuum freeze dryer, and collecting;
(2) performing infrared spectrum and X-ray photoelectron spectrum scanning by using a powdery sample, and performing transmission electron microscope and element Mapping analysis by using a liquid sample;
the results show that:
as shown in fig. 5, fig. 6A and fig. 6B, the biological tellurium nanoparticles in different visual fields are observed by a transmission electron microscope, and are determined to be rod-shaped and have the size of about 100nm to 500nm (fig. 5 ABC); determining the uniform distribution of tellurium (figure 5D), carbon (figure 5E), nitrogen (figure 5F), oxygen (figure 5G), phosphorus (figure 5H) and sulfur (figure 5I) on the surface of the material through element Mapping analysis, and determining the uniform distribution of tellurium and various organic matters on the surface of the material; biological tellurium nanoparticles were analyzed by infrared scanning (fig. 6A) and found to be at 3415.74 (hydroxy), 3012.09 (alkenyl), 2925.54 (methylene), 2855.58 (methylene), 1744.93 (ester), 1628.41 (alkenyl), 1459.01 (aromatic ring), 1240.62 (aromatic phosphate), 1152.55 (tertiary amine, CN vibration), 1080.53 (sulfate ion), 707.35 (aryl sulfide), 576.19 (disulfide) and 432.19 (aryl disulfide) cm-1Vibration is generated, which indicates that the biological tellurium nanoparticles contain organic matters such as protein and lipid and substances such as inorganic salt ions; analyzing the valence state of the biological tellurium nanoparticles by an X-ray diffraction technology, determining that the biological tellurium nanoparticles have the highest peaks (as shown in FIG. 6B) at 573.29 and 584.0, and marking the valence state of tellurium element to be 0; comprehensively obtained, the biological tellurium nanoparticles are in irregular rod-shaped structures, the size is 100-500 nm, the valence state of tellurium is 0, and organic matters such as tellurium, protein, lipid and the like are uniformly distributed on the surfaces of the biological tellurium nanoparticlesAnd inorganic salt ions.
Example 8 antimicrobial application of biological tellurium nanoparticles
(1) The biological tellurium nanoparticles extracted in example 6 were used, and the concentrations thereof were prepared to 10mg/mL, 1mg/mL, and 0.1 mg/mL;
(2) selecting 100 mu L of Shigella dysenteriae (Shigella dysenteriae CMCC 51252), Enterobacter sakazakii (Enterobacter sakazakii ATCC 51329), Escherichia coli (Escherichia coli ATCC 25922) and Salmonella typhimurium (Salmonella typhimurium ATCC 14028) mother strains, respectively inoculating the mother strains into MHA culture medium (Mueller Hinton Agar) (formula: beef powder: 6.0g/L, soluble starch: 1.5g/L, acid hydrolyzed casein: 17.5g/L and Agar: 17.0g/L), and carrying out overnight culture at 25 ℃;
(3) washing, resuspending and collecting bacteria in the MHA culture dish by using 0.85% of physiological saline by mass, and adjusting the turbidity to 0.5M by using a turbidimeter;
(4) taking 50 mu L of bacterial suspension, respectively spreading Shigella dysenteriae, Enterobacter sakazakii, Escherichia coli and Salmonella typhimurium in an MHA culture dish;
(5) a sterilized oxford cup with an inner diameter of 6mm (outer diameter of 8 mm) was placed in the center of each dish;
(6) respectively adding 10mg/mL, 1mg/mL and 0.1mg/mL biological tellurium nanoparticles (100 mu L) into a sterilized Oxford cup;
(7) the culture was carried out at 25 ℃ for 15h and the diameter of the zone of inhibition in the dish was recorded.
The results show that:
as shown in fig. 7, the antibacterial effect of the biological tellurium nanoparticles is determined by using an agarose gel diffusion method, the antibacterial potency of the biological tellurium nanoparticles is determined according to the size of an antibacterial zone, the result shows that the biological tellurium nanoparticles can well inhibit the growth of 0.5M shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium, the antibacterial ability of the biological tellurium nanoparticles is evaluated according to the size of the antibacterial zone within 15 hours, the specific result of the size of the antibacterial zone is shown in table 1, the result shows that the biological tellurium nanoparticles can well inhibit the growth of the shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium under the conditions of 10mg/mL and 1mg/mL, the physiological saline of the control group does not form the antibacterial zone, and only has the outer diameter of an oxford cup of 8 mm.
TABLE 1 antibacterial Effect (unit: mm) of biological tellurium nanoparticles in different concentrations
Remarking: ND means no antibacterial effect.
Example 9 biological tellurium nanoparticles example of antimicrobial application
(1) Take about 8 x 109cfu/mL of Escherichia coli ATCC 2592250 u L bacterial suspension, 2 times of coating, 25 u L/time, evenly coated on 2cm x 2cm slide;
(2) about 15 minutes, after the bacterial fluid is dried on the glass slide, 100 μ L of the biological tellurium nanoparticles extracted in example 6 with a concentration of 10mg/mL is added to cover the zone coated with the bacterial fluid, and 100 μ L of physiological saline is coated as a control;
(3) after the material was treated for 30 minutes at room temperature, the microorganisms in the 2cm by 2cm area were collected with a sterile cotton swab, and then the swab head was soaked in 1mL of 0.85% saline;
(4) then 50 mu L of the treated physiological saline and the biological tellurium nano-particles are taken and diluted to 10 degrees in a gradient way-3MHA plates were post-plated and the number of colonies was counted.
The results show that:
as shown in fig. 8, the actual bactericidal effect of the substance table was evaluated by performing colony counting by the dilution plate method, and the data shows that the survival rates of escherichia coli treated by 10mg/mL and physiological saline (control group) were 15.13% and 100%, respectively, and the results show that the biological tellurium nanoparticles can inactivate escherichia coli contacting the overload slide within 30min, and the maximum inactivation rate can reach 84.87%.
Attached: SEQ ID NO.1 (ITS sequence of Mortierella sp. AB1)
GCGGAAGGATCATTCATAATCAAGTGTTTTTATGGCACTTTCAAAAATCCA TATCCACCTTGTGTGCAATGTCATCTCTCTGGGGGCTGCCGGCTGTCAAAA GCCGTGTGGTCACCTTTGGGATTTATATCTACTCAGAACTTTAGTGATTTT GTCTGAAACATATTATGAATACTTAATTCAAAATACAACTTTCAACAACG GATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTA ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCG CTCTCTGGTATTCCGGAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCA ACTTCCATATCTTTTTTGAAATGGGAGTTGGACTTGAGTGATCCCAACGCT TTTCCTTACCGAAAAGTGGCGGGTTACTTGAAATGCAGGTGCAGCTGGAC TTTTCTCTGAGCTATAAGCATATCTATTTAGTCTGCCTAAAAAACAGATTA TTACCTTTGCTGCAGCTAACATAAAGGAGATTAGTTCTTGTGCTGACTGAT GCAGGATTCACAAAGACAGGCTTCGGCCGACTTTGTAAACTCGATCTCAA AT
Sequence listing
<110> university of northHubei province
<120> high tellurite tolerant bacteria-mediated synthesis of biological tellurium nanoparticles and antibacterial application thereof
<141> 2022-03-07
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 610
<212> DNA
<213> Artificial Sequence
<400> 1
gcggaaggat cattcataat caagtgtttt tatggcactt tcaaaaatcc atatccacct 60
tgtgtgcaat gtcatctctc tgggggctgc cggctgtcaa aagccgtgtg gtcacctttg 120
ggatttatat ctactcagaa ctttagtgat tttgtctgaa acatattatg aatacttaat 180
tcaaaataca actttcaaca acggatctct tggctctcgc atcgatgaag aacgcagcga 240
aatgcgatac gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcatat 300
tgcgctctct ggtattccgg agagcatgct tgtttgagta tcagtaaaca cctcaacttc 360
catatctttt ttgaaatggg agttggactt gagtgatccc aacgcttttc cttaccgaaa 420
agtggcgggt tacttgaaat gcaggtgcag ctggactttt ctctgagcta taagcatatc 480
tatttagtct gcctaaaaaa cagattatta cctttgctgc agctaacata aaggagatta 540
gttcttgtgc tgactgatgc aggattcaca aagacaggct tcggccgact ttgtaaactc 600
gatctcaaat 610
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 2
tccgtaggtg aacctgcgg 19
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
Claims (5)
1. A high tellurite-tolerant bacteria-mediated synthesis of biological tellurium nanoparticles, characterized in that it is prepared by the steps comprising:
1) obtaining a strain Mortierella AB1(Mortierella sp. AB1, deposited in China center for type culture Collection with the preservation number of CCTCC M20211177);
2) inoculating the Mortierella AB1 obtained in the step 1) into a corn flour culture medium, and growing in a shaking table at the temperature of 26-28 ℃ and at the speed of 180-200 r/min for 2-3 days to obtain fermentation liquor;
3) inoculating the fermentation liquor obtained in the step 2) into the improved PDA, adding tellurite solution at the same time to ensure that the final concentration of tellurite radical ions in the culture medium is 0.3-0.5 mM, and continuously growing for 6-7 days in a shaking table at 26-28 ℃ and 180-200 r/min;
4) collecting the thalli grown in the step 3), carrying out suction filtration, washing and suction filtration again on the thalli, freezing the thalli for 5-6 hours at-78-80 ℃, adding liquid nitrogen, grinding into powder, and adding deionized water for heavy suspension to obtain a heavy suspension;
5) washing the heavy suspension obtained in the step 4) with Tris-HCl for 2-3 times, n-octanol for 2-3 times and deionized water for 2-3 times under the conditions of 10000-12000 rpm and 5-10 min, and finally suspending the collected precipitate in deionized water to obtain the high tellurite tolerant bacteria-mediated synthetic biological tellurium nanoparticles.
2. The biological tellurium nanoparticle as claimed in claim 1, being prepared by the steps comprising:
1) obtaining a strain Mortierella AB1 by the following steps:
a, selecting waste soil, adding normal saline, and uniformly mixing to obtain a soil sample;
b heating to dissolve the solid LB medium, adding K2TeO3B, pouring the flat plate, taking the soil sample obtained in the step a, uniformly coating the soil sample on the surface of the flat plate, and culturing to obtain black hyphae;
c, selecting the black hyphae obtained in the step b, and inoculating the black hyphae to a solid PDA flat plate for culture;
d, cutting small solid PDA containing hyphae after the culture in the step c, and adding the small solid PDA into the PDA to culture to obtain the strain Mortierella AB 1;
2) inoculating the Mortierella gamsii AB1 obtained in step 1) into a corn flour culture medium, and growing in a shaking table at 28 deg.C and 200r/min for 3 days to obtain a fermentation broth;
3) inoculating the fermentation liquor obtained in the step 2) into the improved PDA, simultaneously adding a potassium tellurite solution to ensure that the final concentration of the potassium tellurite in a culture medium is 0.5mM, and continuously growing for 7 days in a shaking table at 28 ℃ and 200 r/min;
4) collecting the thalli grown in the step 3), carrying out suction filtration, washing and suction filtration again on the thalli, freezing the thalli for 5 hours at-78 ℃, adding liquid nitrogen, grinding into powder, adding deionized water, and carrying out heavy suspension to obtain a heavy suspension;
5) washing the heavy suspension obtained in the step 4) with Tris-HCl for 2 times, n-octanol for 2 times and deionized water for 2 times under the conditions of 12000rpm and 5min, and finally suspending the collected precipitate in deionized water to obtain the high tellurite tolerant bacterium mediated synthetic biological tellurium nanoparticles.
3. The antibacterial use of biological tellurium nanoparticles as claimed in claim 2.
4. The antimicrobial use of claim 3, wherein: the bacteria are one or more of shigella dysenteriae, enterobacter sakazakii, escherichia coli and salmonella typhimurium.
5. The antimicrobial use of claim 4, wherein: the bacterium is escherichia coli.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210217419.7A CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210217419.7A CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114426990A true CN114426990A (en) | 2022-05-03 |
| CN114426990B CN114426990B (en) | 2023-08-11 |
Family
ID=81314149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210217419.7A Active CN114426990B (en) | 2022-03-07 | 2022-03-07 | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114426990B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101878535A (en) * | 2007-11-30 | 2010-11-03 | 纳米技术有限公司 | Preparation of nanoparticle material |
| CA2723655A1 (en) * | 2010-12-03 | 2012-06-03 | Queen's University At Kingston | Biosynthesis of nanoparticles |
| WO2013040472A2 (en) * | 2011-09-16 | 2013-03-21 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to dna damage repair |
| US20150045567A1 (en) * | 2006-08-29 | 2015-02-12 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of fatty acids |
| CN105502312A (en) * | 2016-01-11 | 2016-04-20 | 合肥师范学院 | Hollow spindle-shaped nanometer telluride platinum and preparation method thereof |
| CN107058284A (en) * | 2016-12-30 | 2017-08-18 | 武汉中科光谷绿色生物技术有限公司 | A kind of method that utilization flow cytometry quickly sorts Mortierella alpina Protoplast Fusant |
| CN108676817A (en) * | 2018-07-16 | 2018-10-19 | 王昊 | Utilize the method and its application of bacillus licheniformis biosynthesis nano tellurium |
| CN114569558A (en) * | 2022-03-07 | 2022-06-03 | 湖北师范大学 | Moringa oleifera straw-mediated synthesized biological tellurium nanoparticles and antibacterial and antiviral application thereof |
| CN115697892A (en) * | 2020-03-20 | 2023-02-03 | 轨迹Ip有限责任公司 | Materials and methods for efficient dispersion of nanoparticles |
-
2022
- 2022-03-07 CN CN202210217419.7A patent/CN114426990B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150045567A1 (en) * | 2006-08-29 | 2015-02-12 | Commonwealth Scientific And Industrial Research Organisation | Synthesis of fatty acids |
| CN101878535A (en) * | 2007-11-30 | 2010-11-03 | 纳米技术有限公司 | Preparation of nanoparticle material |
| CA2723655A1 (en) * | 2010-12-03 | 2012-06-03 | Queen's University At Kingston | Biosynthesis of nanoparticles |
| WO2013040472A2 (en) * | 2011-09-16 | 2013-03-21 | The Board Of Regents Of The University Of Texas System | Compositions and methods related to dna damage repair |
| CN105502312A (en) * | 2016-01-11 | 2016-04-20 | 合肥师范学院 | Hollow spindle-shaped nanometer telluride platinum and preparation method thereof |
| CN107058284A (en) * | 2016-12-30 | 2017-08-18 | 武汉中科光谷绿色生物技术有限公司 | A kind of method that utilization flow cytometry quickly sorts Mortierella alpina Protoplast Fusant |
| CN108676817A (en) * | 2018-07-16 | 2018-10-19 | 王昊 | Utilize the method and its application of bacillus licheniformis biosynthesis nano tellurium |
| CN115697892A (en) * | 2020-03-20 | 2023-02-03 | 轨迹Ip有限责任公司 | Materials and methods for efficient dispersion of nanoparticles |
| CN114569558A (en) * | 2022-03-07 | 2022-06-03 | 湖北师范大学 | Moringa oleifera straw-mediated synthesized biological tellurium nanoparticles and antibacterial and antiviral application thereof |
Non-Patent Citations (3)
| Title |
|---|
| AO, B等: "Green synthesis of biogenetic Te(0) nanoparticles by high tellurite tolerance fungus Mortierella sp. AB1 with antibacterial activity", vol. 13, pages 1 - 13 * |
| LIANG, XINJIN等: "Fungal formation of selenium and tellurium nanoparticles", vol. 103, no. 17, pages 7241, XP036859207, DOI: 10.1007/s00253-019-09995-6 * |
| SHAKIBAIE, M等: "Antimicrobial and Antioxidant Activity of the Biologically Synthesized Tellurium Nanorods; A Preliminary In vitro Study", vol. 15, no. 4, pages 1580 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114426990B (en) | 2023-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111254093B (en) | Bacillus belgii 229-15 and application thereof | |
| CN108611299B (en) | Lactobacillus plantarum for producing antibacterial peptide and application thereof | |
| CN107629978B (en) | Pseudomonas nitroreducens and application thereof in degrading quorum sensing signal molecules DSF | |
| CN110923144B (en) | High selenate tolerant bacteria and screening method and application thereof | |
| CN112625952B (en) | Bacillus subtilis subspecies schoenoprasu and application thereof in inhibiting cyanobacterial bloom | |
| CN113999838A (en) | Biochar-loaded microbial material soil remediation agent and preparation method thereof | |
| CN110791450B (en) | Strain Am101 capable of degrading multiple beta-lactam antibiotics and application thereof | |
| CN113755389B (en) | Bacillus bailii and application thereof | |
| CN114107092A (en) | Plant endophyte Gordonia L191 for degrading phthalate and application thereof | |
| CN111778178B (en) | Application of marine streptomyces griseoflavus HN60 in antibacterial aspect | |
| CN110343645B (en) | Strain bacillus pumilus SEM-7 and application thereof | |
| CN110106123B (en) | Klebsiella strain Z3 and application thereof in reduction of hexavalent chromium ions | |
| CN114426990B (en) | Gao Yadi acid salt tolerant bacteria mediated synthesis biological tellurium nano-particle and antibacterial application thereof | |
| CN114214235B (en) | Efficient flocculating bacterium and application thereof in sewage treatment | |
| CN109112085B (en) | Pseudomonas citrobacter and application thereof | |
| CN107858312B (en) | Beta-lactam antibiotic degradation strain PGB1 and application thereof | |
| CN113151104B (en) | Streptomyces subruaeae A148 with bacteriostatic action and application thereof | |
| CN112322539B (en) | Enterococcus faecium R-NTR-1 from ocean and screening method and application thereof | |
| CN113337403A (en) | Chaetomium globosum HJF 13 strain and application thereof | |
| CN108373982B (en) | Acinetobacter indicus and phosphate solubilizing method thereof | |
| CN114181863B (en) | Violet bacillus strain E1, preparation method thereof and application thereof in degradation of phthalate | |
| CN115011509B (en) | Bacterial strain for degrading kitchen waste cellulose at high temperature and screening and application thereof | |
| CN115895975B (en) | Acinetobacter luffae and application thereof in degradation of coal gangue | |
| CN117106676B (en) | Bacillus subtilis and application thereof in feed production | |
| CN112175868B (en) | Bacillus amyloliquefaciens strain with antibacterial activity and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |