CN115088785B

CN115088785B - Preparation method and application of compound fermented traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila

Info

Publication number: CN115088785B
Application number: CN202210754136.6A
Authority: CN
Inventors: 陈华友; 卢晨曦; 陈曦华; 蔡康涛; 王振; 李守志; 高恶斌; 倪忠; 雍阳春; 王洪成
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2022-06-29
Filing date: 2022-06-29
Publication date: 2023-10-10
Anticipated expiration: 2042-06-29
Also published as: CN115088785A

Abstract

The invention belongs to the field of biological feed, and in particular relates to a preparation method and application of a compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila; the method comprises the following steps: activating the strain, and culturing to obtain bacillus, saccharomycetes and lactobacillus fermentation seed liquid; mixing the ground compound traditional Chinese medicinal materials with bean pulp and secondary powder, adding compound enzyme to obtain a fermentation medium, inoculating bacillus fermentation seed liquid, saccharomycete fermentation seed liquid and lactobacillus fermentation seed liquid, and performing anaerobic fermentation under a closed condition to obtain a final product; the compound Chinese medicinal materials are adopted to carry out the synergistic fermentation of the bacteria and the enzymes, the obtained product can effectively control aeromonas hydrophila, and the feed additive is rich in probiotics, so that the immunity of the cultured animals can be effectively improved, and the feed additive has sour and fragrant flavor and animal preference; and is beneficial to industrial production, convenient to use and store, and has good application prospect.

Description

Preparation method and application of compound fermented traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila

Technical Field

The invention belongs to the field of biological feeds, and in particular relates to a preparation method of a compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila and application of the compound fermentation traditional Chinese medicine feed additive in aquaculture.

Background

Aeromonas hydrophila (Aeromonas Hydrophila) is a gram-negative conditional pathogen that is generally nonpathogenic when the water is clean and pollution-free, but whose bacterial virulence is increased when the water quality is deteriorated, it produces many pathogenic substances such as chitinase, extracellular protease, lipase and other enzymes and haemolytoxin, enterotoxin, cytotoxin and other exotoxins. It is also one of the most common and most harmful pathogenic bacteria in the aquaculture process, and once the aquatic animals are infected, gastrointestinal bleeding, body surface ulceration bleeding and other symptoms can occur. And pathogenic bacteria can spread in the culture pond along with the bodies of infected animals, excreta and the like, and the infection is continuously caused, so that the cultured animals die in a piece. To prevent outbreaks of disease, farmers often add excess antibiotics, and with the disablement of antibiotics, there is a need to find an antibiotic substitute. The fermented Chinese herbal medicine is most likely to be an antibiotic substitute for aquaculture, has the characteristics of green and safe Chinese herbal medicine, has the same antibacterial effect on substances such as organic acid, antibacterial peptide and the like generated after fermentation, is rich in abundant live bacteria components, can be planted in intestinal tracts of cultured animals, and can enhance the immunity of the cultured animals.

At present, the fermentation traditional Chinese medicines are partially studied for animal breeding and disease prevention and treatment, but are mainly applied to disease prevention and treatment in the livestock breeding industry, such as patent CN113616715A, patent CN113813345A and the like. The existing literature lacks research on application of fermented traditional Chinese medicines in aquaculture industry, especially prevention and treatment of aeromonas hydrophila which is extremely harmful in aquaculture. In addition, most of the documents lack a process for screening Chinese medicaments when developing fermented Chinese medicament feeds, and the Chinese medicaments are various in variety and different in efficacy, so that different Chinese medicament raw materials are selected for different pathogenic bacteria aiming at different diseases. There are documents that fermented traditional Chinese medicines prepared by inoculating paecilomyces hepialid in a drug-property matrix for fermentation are used for treating diarrhea of weaned pigs, and the fermented traditional Chinese medicines belong to aerobic fermentation, and fermentation is performed in an open way, so that the risk of contamination of the fermentation matrix by mixed bacteria in the air is increased. For example, in the patent CN113648393a, the traditional Chinese medicine and the auxiliary materials are uniformly mixed with the fermentation strains, namely lactobacillus and bacillus subtilis, and are fermented at the same time, but the fermentation strains do not select saccharomycetes to be performed at the same time, and the effect is poor, especially in the aspect of improving the immunity of the cultured animals.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention provides a preparation method of a compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila and application thereof in aquaculture; firstly, a large number of antibacterial traditional Chinese medicines for pathogenic bacteria, aeromonas hydrophila, are screened, meanwhile, fermentation strains and enzymes are screened, and the addition proportion of the traditional Chinese medicines and auxiliary materials and the growth relation of the fermentation strains are researched, so that the optimal addition proportion of the traditional Chinese medicines is obtained.

The traditional Chinese medicine with good antibacterial effect on aeromonas hydrophila is obtained through antibacterial experiment screening, proper bacterial enzymes are obtained through screening for fermentation, proper traditional Chinese medicine addition amount is explored through changing the flora change of fermentation strains according to different traditional Chinese medicine addition ratios, the compound traditional Chinese medicine is subjected to fermentation treatment, the medicinal effect components of the compound traditional Chinese medicine are improved or converted into other medicinal effect components easy to absorb, and the feed additive is rich in probiotics and has excellent control effect on aeromonas hydrophila. Meanwhile, the immunity and the intestinal digestion level of the cultured animals can be effectively improved; in a short-term aeromonas hydrophila toxicity attack experiment, the survival rate of young Chinese soft-shelled turtles can be effectively improved.

In order to achieve the aim of the invention, the technical scheme adopted by the invention is as follows:

(1) Preparing a fermentation medium: mixing the compound Chinese medicinal materials, bean pulp and secondary powder, adding cellulase, hemicellulase and tannase, and mixing to obtain a solid fermentation culture medium;

the weight percentages of the components of the fermentation medium are respectively as follows: 10-90% of compound Chinese herbal medicine; 6-54% of bean pulp; 4-36% of secondary powder; the addition amount of the complex enzyme is 0.1-10%; the compound Chinese medicinal materials comprise the following materials in percentage by weight: 4 to 36 percent of baical skullcap root, 2.4 to 21.6 percent of Chinese gall, 2.8 to 25.2 percent of wild chrysanthemum flower and 0.8 to 7.2 percent of humifuse euphorbia herb; the complex enzyme consists of cellulase, hemicellulase and tannase;

(2) Respectively inoculating bacillus, saccharomycetes and lactobacillus into corresponding liquid culture mediums for activation culture to respectively obtain bacillus fermentation seed liquid, saccharomycetes fermentation seed liquid and lactobacillus fermentation seed liquid;

(3) Inoculating the bacillus seed liquid, the saccharomycete seed liquid and the lactobacillus seed liquid obtained in the step (2) into the fermentation culture medium obtained in the step (1), regulating the fermentation temperature and the water content of the culture medium, uniformly mixing to obtain a fermentation mixture, and carrying out anaerobic fermentation under a closed condition to obtain the compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila infection.

Preferably, the bean pulp in the step (1) needs to be dried and ground into powder for use; the powder is obtained by sieving with a 50-80 mesh sieve; the compound Chinese medicinal materials are ground into powder for use, and the powder is obtained by sieving with a 50-80-mesh sieve.

Preferably, the mass ratio of the cellulase, the hemicellulase and the tannase in the step (1) is 2:2:3; in the complex enzyme, the enzyme activity of the hemicellulase is 5 ten thousand u/g, and the enzyme activities of the cellulase and the tannase are 1 ten thousand u/g.

Preferably, the weight percentages of the components of the fermentation medium in the step (1) are respectively: 50% of compound Chinese herbal medicine; 30% of bean pulp; 20% of secondary powder; the addition amount of the complex enzyme is 1%; the compound Chinese medicinal materials comprise the following materials in percentage by weight: 20% of radix scutellariae, 12% of gallnut, 14% of wild chrysanthemum flower and 4% of humifuse euphorbia herb.

Preferably, the bacillus in the step (2) is bacillus subtilis; the saccharomycete is saccharomyces cerevisiae; the lactobacillus is Lactobacillus plantarum, lactobacillus fermentum, and Lactobacillus rhamnosus.

Preferably, the inoculum size of the bacillus fermentation seed liquid and the saccharomycete fermentation seed liquid in the step (3) is 0.1% -9% of the weight of the fermentation medium (V/W, mL/g; namely, the relation between the seed liquid and the medium is 0.1-9 mL:100 g); the total number of viable bacteria of the bacillus and the saccharomycetes is 1.0x10 ⁸ ～2.8×10 ⁹ cfu/mL; the saccharomycete fermentation seed liquid is saccharomyces cerevisiae fermentation seed liquid;

the lactobacillus fermentation seed liquid is Lactobacillus plantarum fermentation seed liquid, lactobacillus fermentum fermentation seed liquid and Lactobacillus rhamnosus fermentation seed liquid, and the total number of viable bacteria is 1.5X10 ⁸ ～3.5×10 ⁹ cfu/mL, wherein the inoculation amount of the lactobacillus fermentation seed liquid is 0.8% -5.7% (V/W, mL/g) of the weight of the fermentation medium, namely the relationship between the seed liquid and the medium is that0.8～5.7mL：100g)；

The volume ratio of the lactobacillus fermentation seed liquid to the bacillus fermentation seed liquid to the saccharomycetes fermentation seed liquid is 2:2:3.

more preferably, the inoculum size of the bacillus fermentation seed liquid and the saccharomycete fermentation seed liquid is 2% (V/W, mL/g) of the weight of the fermentation medium.

Preferably, the water content of the fermentation medium in the step (3) is 40% -60%; the fermentation time is 5-20 days, and the fermentation temperature is 24-38 ℃.

The compound fermented traditional Chinese medicine feed additive prepared by the invention is used for inhibiting aeromonas hydrophila when being added into aquaculture feed; the specific operation is as follows: adding the compound fermented traditional Chinese medicine feed additive into aquatic feed to obtain mixed feed for feeding; the addition amount of the compound fermented traditional Chinese medicine feed additive accounts for 5-25% of the weight of the mixed feed.

The specific screening process of the technical scheme is as follows:

(1) Screening of traditional Chinese medicine raw materials: from 45 antibacterial traditional Chinese medicines (dark plum, asparagus, dogwood, garlic, shizandra berry, coptis chinensis, houttuynia cordata, fructus forsythiae, polygonum cuspidatum, purslane, green tangerine peel, rhizoma anemarrhenae, ash bark, selfheal, sappan wood, humifuse euphorbia herb, chinese pulsatilla root, myrobalan, mugwort leaf, baikal skullcap root, astragalus root, amur corktree bark, chinese gall, wild chrysanthemum flower, glossy privet fruit, largehead atractylodes rhizome, isatis root, ginkgo leaf, dandelion, schizonepeta, chinese angelica, eucommia bark, rhubarb, red paeony root, eucommia leaf, hawthorn fruit, catechu, rehmannia root, liquorice, ligusticum wallichii, honeysuckle, dyers woad leaf, fructus xanthii, pomegranate rind and common andrographis herb), the traditional Chinese medicines with stronger antibacterial effect on aeromonas hydrophila before and after fermentation are obtained through antibacterial experiment screening. The bacteriostasis experiment adopts an agar diffusion method, and the size of a bacteriostasis zone is shown in table 1.

According to experimental results, the humifuse euphorbia herb, the gallnut, the wild chrysanthemum, the rheum officinale and the radix scutellariae have good antibacterial effect, and after fermentation, the antibacterial capability is obviously enhanced. When the fermented traditional Chinese medicine feed additive is prepared through a pre-experiment, the condition that the Chinese soft-shelled turtle does not ingest is found. The possible reasons for the method are bitter in flavor and poor in palatability of the rheum officinale, so that four traditional Chinese medicines of humifuse euphorbia herb, gallnut, wild chrysanthemum flower and baical skullcap root are comprehensively considered as the fermentation raw materials of the compound traditional Chinese medicine.

TABLE 1 size of antibacterial zone of Chinese medicinal materials on Aeromonas hydrophila before and after fermentation

Note that: in each column of the diameter of the inhibition zone before fermentation and after fermentation, the expression difference marked by the same letter is not obvious (P is more than 0.05), and the expression difference marked by different letters is obvious (P is less than 0.05). In each row of the diameters of the bacteriostasis circles before and after fermentation of different traditional Chinese medicines, the representation difference marked by the same letter is not obvious (P is more than 0.05), and the representation difference marked by different letters is obvious (P is less than 0.05). "/" indicates no bacteriostatic effect.

(2) Screening of fermentation strains: different fermentation strains act on the compound traditional Chinese medicine to produce different effects on the compound traditional Chinese medicine. Therefore, further screening of the fermentation strains is necessary to achieve effective improvement of the effective components of the traditional Chinese medicine. Taking compound traditional Chinese medicines, bean pulp and secondary powder as fermentation raw materials; the compound Chinese medicine is prepared with four kinds of Chinese medicinal materials, including humifuse euphorbia herb, chinese gall, wild chrysanthemum flower and skullcap root.

Taking culture bacteria liquid (cultured to logarithmic growth phase) of each single strain for fermentation, adding 10% (V/W, mL/g) of the culture bacteria liquid into a fermentation raw material, adding distilled water to control the water content of the fermentation raw material to be 50% (V/W, mL/g) for stirring uniformly, placing the fermentation raw material into a fermentation bag with one-way air holes, placing the fermentation bag into a 30 ℃ incubator for anaerobic fermentation, fermenting for 7 days to obtain the compound fermented traditional Chinese medicine feed additive, detecting the change of medicinal components of the compound fermented traditional Chinese medicine feed additive, and measuring the change of the medicinal components by adopting an HPLC method.

The method for measuring the effective components of the traditional Chinese medicine comprises the following steps:

a, establishment of chromatographic conditions

The invention establishes a chromatographic condition for simultaneously measuring chlorogenic acid, ferulic acid, baicalein, baicalin, quercetin and luteolin, which comprises the following specific steps: the XueXB-C18 (250 mm multiplied by 4.6mm,5 μm) chromatographic column is adopted, methanol (A) -0.1% phosphoric acid solution (B) is taken as a mobile phase, gradient elution is carried out (0-10 min,15% A-45% A,85% B-55% B; 10-20 min,45% A-57% A,55% B-43% B; 20-40 min,57% A-85% A,43% B-15% B), the detection wavelength is 335nm, the flow rate is 0.8mL/min, the sample injection amount is as follows: 10 mu L.

TABLE 2 gradient elution conditions of six drug effect ingredients

Gallic acid assay chromatographic conditions: the XueXB-C18 (250 mm. Times.4.6 mm,5 μm) column was used, methanol (A) -0.1% phosphoric acid solution (B) was used as mobile phase, and the mobile phase was eluted at the same ratio. Methanol (a) -0.1% phosphoric acid solution (B) =15: 85. the detection wavelength is 270nm, the flow rate is 0.8mL/min, and the sample injection amount is as follows: 10 mu L.

Preparation of standard substance solution

Each standard was precisely weighed to 20mg, and 60% methanol was dissolved to a constant volume of 10mL to be used as a standard mother liquor. And (3) respectively sucking and mixing 1mL of chlorogenic acid, ferulic acid, baicalein, baicalin, quercetin and luteolin standard substance mother liquor to obtain mixed standard substance mother liquor, and placing the mixed standard substance mother liquor in a refrigerator at 4 ℃ for standby after preparation.

Preparation of Chinese medicine extract

Weighing 1g of the compound fermented traditional Chinese medicine feed additive obtained in the step (2) into a 50mL conical flask, and adding 10mL of 60% methanol solution for leaching for 30min. Filtering to obtain supernatant, and storing in refrigerator at 4deg.C.

High performance liquid chromatography of chlorogenic acid, ferulic acid, baicalin, quercetin, luteolin, and mixed control of baicalein and gallic acid standard substance is shown in figure 1 and figure 2; it can be seen that under the condition of the intrinsic color spectrum, each medicinal component can be well separated, and the peak is complete and has good peak shape.

Regression analysis gave a linear relationship between the peak area (y) and the content (x) of each active ingredient, as shown in Table 3.

TABLE 3 Standard Curve of the efficacy Components

Note that: each of the effective components has a good linear relationship with the peak area thereof in the range of 0 to 500 ug.

Wherein the fermentation strain is Saccharomyces cerevisiae, candida utilis, candida tropicalis, bacillus subtilis, bacillus licheniformis, bacillus coagulans, bacillus amyloliquefaciens, bacillus natto, lactobacillus casei, lactobacillus paracasei, lactobacillus rhamnosus, lactobacillus fermentum, lactobacillus bifidus and lactobacillus plantarum respectively;

the fermentation raw materials are as follows (mass percent): 20% of radix scutellariae, 12% of gallnut, 14% of wild chrysanthemum, 4% of humifuse euphorbia herb, 30% of bean pulp and 20% of secondary powder.

The changes of several main medicinal components in the products of each group are measured after 7d fermentation of different single-fungus fermented compound traditional Chinese medicine feeds, and are shown in table 4 (the traditional Chinese medicine used in the experiment and the traditional Chinese medicine used in the enzyme screening experiment for fermentation are different in batches, so that the medicinal components are different, but the traditional Chinese medicine raw materials used in the same batch of experiment are the same, so that the comparison can be performed among experimental batches).

The experimental results can obviously observe that the single-strain fermentation of different strains has obvious difference on the medicinal components in the compound traditional Chinese medicine feed.

In saccharomycetes, it can be observed that several bacteria have different levels of medicinal components such as chlorogenic acid, quercetin, luteolin, baicalein and the like. The two medicinal components of ferulic acid and baicalin are reduced after fermentation. Wherein after fermentation of candida tropicalis single bacteria, the content of gallic acid is reduced, and saccharomyces cerevisiae and candida utilis promote the content of gallic acid in the compound traditional Chinese medicine. Saccharomyces cerevisiae has better fermentation effect as a whole, and can increase chlorogenic acid content to about 5.27 times before fermentation, quercetin about 1.88 times before fermentation, luteolin about 4.38 times before fermentation, baicalein about 2.91 times before fermentation, and gallic acid about 8.22 times before fermentation.

In bacillus, it can be observed that several kinds of bacillus can raise chlorogenic acid, quercetin, luteolin, baicalein and chlorogenic acid content in compound Chinese medicine, and ferulic acid and baicalin content are reduced. Wherein, the bacillus subtilis single-strain fermentation improves the efficacy components of the traditional Chinese medicine with better overall effect, the content of chlorogenic acid is 2.55 times of that before fermentation, and the content of quercetin is 1.71 times of that before fermentation. Luteolin is 4.83 times before fermentation, baicalein is 2.06 times before fermentation, and gallic acid is 4.10 times before fermentation.

Among lactic acid bacteria, the change of the effective components of each lactic acid bacteria is different. Wherein, the lactobacillus fermentum, the lactobacillus plantarum and the lactobacillus rhamnosus perform relatively better when the traditional Chinese medicine is fermented by single bacteria. The lactobacillus fermentum can raise quercetin 2.05 times before fermentation, luteolin 7.14 times before fermentation, baicalein 2.17 times before fermentation, and gallic acid 14.07 times before fermentation. The lactobacillus plantarum can promote quercetin to be 3.37 times before fermentation, promote luteolin to be 8.31 times before fermentation, promote baicalein to be 1.30 times before fermentation, and promote gallic acid to be 14.10 times before fermentation. The lactobacillus rhamnosus can promote chlorogenic acid 5.91 times before fermentation, promote quercetin 2.37 times before fermentation, promote luteolin 9.83 times before fermentation, promote baicalein 1.93 times before fermentation, and promote gallic acid 1.61 times before fermentation.

TABLE 4 content of Chinese medicinal active ingredients in Chinese medicinal additives after fermentation of different strains

Note 1: each column identifies that the same letter indicates that the difference is not significant (P > 0.05) and that the different letters indicate that the difference is significant (P < 0.05).

(3) Screening of enzymes for fermentation: the changes of several main medicinal components in each group were measured after 7d fermentation of different single enzyme fermented compound traditional Chinese medicine feed additives, and the specific results are shown in table 5.

From the measurement results, it can be observed that:

1. laccase addition is only beneficial to improving chlorogenic acid components in the compound traditional Chinese medicine, but reduces other medicinal components such as ferulic acid, baicalin, quercetin, baicalein and gallic acid, unlike enzyme-free addition groups. If the baicalein is 1.33mg/g after fermentation, the baicalein is only 37.89% of the enzyme-free fermentation group; the content of gallic acid after fermentation was 2.50mg/g, which was 83.06% of that of the enzyme-free fermentation group. The possible reason is that laccase, though being widely used as a commercial enzyme for degrading lignin, can degrade some phenolic substances in plants, and in the research formula, the substances with main pharmacodynamic effects are all polyphenol substances, so that the laccase is degraded to a certain extent in the fermentation and enzymolysis process, and the pharmacodynamic ingredients are reduced.

2. The hemicellulase added can raise baicalein content to 4.81mg/g, which is 16.62 times that before fermentation, 137.04% that before fermentation, and gallic acid to 4.12mg/g, which is 10.84 times that before fermentation, which is 136.88% that before fermentation.

3. The addition of cellulase improves chlorogenic acid to 0.37mg/g, which is 3.36 times before fermentation, 68.18% compared with the control group without enzyme, improves baicalein content to 3.69mg/g, which is 12.30 times before fermentation, and improves gallic acid content to 3.61mg/g, which is 9.5 times before fermentation, which is 119.93% compared with the control group without enzyme.

4. The tannic acid content can be greatly improved by adding tannase, and after fermentation, the gallic acid content is 5.72mg/g, which is 15.05 times of that before fermentation and is 190.03 percent of that of the non-enzyme control group. In addition, the method has a certain effect on increasing the content of baicalein, and can increase the content of baicalein to 3.97mg/g, which is 13.23 times that of the prior fermentation, and 113.11% of the enzyme-free control group. According to the experimental results, except that the lacquer enzyme has no great effect on the increase of main medicinal components in the traditional Chinese medicine, other enzymes such as hemicellulase, cellulase and tannase have gain effects on the increase of the main medicinal components in the traditional Chinese medicine feed, so that the hemicellulase, the cellulase and the tannase are selected as enzymes for fermentation.

TABLE 5 content of Chinese medicinal active ingredients in Chinese medicinal additives after fermentation with different enzymes

(4) Determination of the optimal drug addition ratio

The antibacterial experiment results show that the traditional Chinese medicines selected by the formula have broad-spectrum antibacterial effect and can have certain influence on fermentation strains, so that a proper traditional Chinese medicine adding proportion needs to be determined, so that the antibacterial effect of the antibacterial traditional Chinese medicines can be exerted, and the fermentation strains can grow.

According to the invention, by changing the adding proportion of different compound traditional Chinese medicinal materials in fermentation and adopting a PMA-qPCR detection method, the number of viable bacteria of fermentation strains in different groups of traditional Chinese medicinal material adding proportion in the fermentation process is measured, the relation between the compound traditional Chinese medicinal materials and the fermentation strains is explored, and a group of traditional Chinese medicinal material adding proportion which does not influence the growth of fermentation strains and can exert the antibacterial effect of the traditional Chinese medicines is searched.

The baikal skullcap root, humifuse euphorbia herb, wild chrysanthemum flower and Chinese gall are mixed according to a certain proportion (namely 40 percent of baikal skullcap root, 24 percent of Chinese gall, 28 percent of wild chrysanthemum flower and 8 percent of humifuse euphorbia herb) to form a compound traditional Chinese medicine premix. Mixing bean pulp and secondary powder (60% of bean pulp and 40% of secondary powder) according to a certain proportion to obtain auxiliary material premix; seven groups of experiments are designed, a mixture of compound traditional Chinese medicine and auxiliary material premix is used as a fermentation raw material, the mass sum of the compound traditional Chinese medicine and the auxiliary material premix is 100%, wherein the adding mass ratio of the compound traditional Chinese medicine premix is 0%, 10%, 30%, 50%, 70%, 90% and 100% respectively; the fermentation strain is added in the form of bacterial liquid (cultured to a stable period), the addition amount is 2 percent (V/W, mL/g) of the fermentation raw material, the water content is 50 percent, and the fermentation temperature is 30 ℃ to obtain the fermentation feed additive; the change in the flora during fermentation was determined by means of PMA-qPCR.

Measurement of the amount of fermentation strain

A. Genome extraction: taking 1mL of seed solution (cultured to logarithmic growth phase) of each fermentation strain (bacillus subtilis, saccharomyces cerevisiae, lactobacillus fermentum, lactobacillus rhamnosus and lactobacillus plantarum), centrifuging for 2 minutes at 12000rpm, discarding the supernatant, adding 60 mu L of TE Buffer, boiling for 2 minutes at 100 ℃, centrifuging for 1 minute at 8000rpm after cooling, and carefully sucking the supernatant to obtain genome DNA of the fermentation strain (bacillus subtilis, saccharomyces cerevisiae, lactobacillus fermentum, lactobacillus rhamnosus and lactobacillus plantarum).

B. Standard curve construction:

1. bacillus subtilis: PCR amplification of the Bacillus subtilis genomic DNA with specific primer pair (upstream primer F: CGTAGAGCCACTTGAGCG, downstream primer R: CTGCCGTTACAGTTCCTT), gel cutting, recovering, and diluting to 1×10 ² ～1×10 ⁹ Copy/. Mu.L was used as a standard for fluorescent quantitative PCR reactions. Converting the measured DNA concentration of the standard product into copy number, and generating a bacillus subtilis standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate;

the copy number calculation formula is as follows: copy number = DNA concentration (ng/. Mu.l). Times.10 ^-9 ×6.023×10 ²³ /(660×base number);

the standard curve fitting equation of the bacillus subtilis is Y= -3.4359X+34.363;

2. Saccharomyces cerevisiae: PCR amplification of Saccharomyces cerevisiae genome DNA with specific primer pair (upstream primer F: GCGATAACGAACGAGACCCTAA and downstream primer R: CCAGCACGACGGAGTTTCACAAGAT), cutting, recovering, and diluting to 1×10 ² ～1×10 ⁹ Copy/. Mu.L was used as a standard for fluorescent quantitative PCR reactions. Converting the measured DNA concentration of the standard product into copy number, and generating a saccharomyces cerevisiae standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate;

the standard curve fitting equation of the saccharomyces cerevisiae is Y= -3.4868X+39.322;

3. lactobacillus fermentum: PCR amplification of the genome DNA of Lactobacillus fermentum with specific primer pair (upstream primer F: CCTGATTGATTTTGGTCGCCAAC and downstream primer R: ACGTATGAACAGTTACTCTCATACGT), cutting, recovering, and diluting to 1×10 ² ～1×10 ⁹ Copy/. Mu.L, and performing fluorescent quantitative PCR reaction as a standard. Converting the measured DNA concentration of the standard product into copy number, and generating a lactobacillus fermentum standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate;

the standard curve fitting equation of the lactobacillus fermentum is Y= -3.8953X+38.279;

4. lactobacillus plantarum: performing PCR amplification on lactobacillus plantarum genome DNA with a specific primer pair (upstream primer F: GTGGTGCGGTCGATATTTTAGTT and downstream primer R: TCAGCCGCGCTTGTAACC), cutting gel, recovering, and diluting to 1×10 ² ～1×10 ⁹ Copy/. Mu.L was used as a standard for fluorescent quantitative PCR reactions. Converting the measured DNA concentration of the standard product into copy number, and generating a lactobacillus plantarum standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate;

the standard curve fitting equation of the lactobacillus plantarum is Y= -3.3338X+33.904;

5. lactobacillus rhamnosus: carrying out PCR amplification on lactobacillus rhamnosus genome DNA by using a specific primer pair (an upstream primer F: GACGCAGCCGGTTGACCCAA and a downstream primer R: GGCGGCAGTTGCCCCAGAAT), cutting gel, recovering the obtained PCR product, and diluting to 1X 10 ² ～1×10 ⁹ Copy/. Mu.L was used as a standard for fluorescent quantitative PCR reactions. Converting the measured DNA concentration of the standard product into copy number, and generating a lactobacillus rhamnosus standard curve by taking the logarithmic value of the copy number as an abscissa and the corresponding Ct value as an ordinate; y= -3.1942x+32.687

the standard curve fitting equation of the lactobacillus rhamnosus is Y= -3.1942X+32.687;

C. extracting DNA of a feed sample: accurately weighing 1g of the fermented feed additive obtained in the step (4), adding 10mL of PBS Buffer solution, oscillating for 20 minutes, filtering with 8 layers of gauze, taking 1mL of filtrate, centrifuging at 12000rpm for 2 minutes, discarding the supernatant, adding 60 mu L of TE Buffer, boiling at 100 ℃ for 2 minutes, centrifuging at 8000rpm for 1 minute after cooling, and carefully sucking the supernatant to obtain a feed sample DNA template;

D. fluorescent quantitative PCR detection: amplification and analysis were performed using Quantum studio 3Real-Time PCR System (Applied Biosystems). The fluorescent quantitative PCR reaction system is as follows: SYBR Green Premix Ex Taq 10. Mu.L, rox Reference Dye 0.4.4. Mu.L, 0.8. Mu.L each for the upstream and downstream primers, 2. Mu.L for the DNA template, and 6. Mu.L for ddH 2O. Fluorescent quantitative PCR reaction conditions: pre-denaturation at 95 ℃ for 30s, amplification at 95 ℃ for 5s and amplification at 60 ℃ for 30s for 40 cycles, then melting curve analysis is carried out, and the Ct value obtained calculates the number of fermentation strains according to a standard curve.

I, change of bacterial quantity of bacillus subtilis under different traditional Chinese medicine adding proportion

Under different traditional Chinese medicine adding ratios, the bacterial load change of the bacillus subtilis in the fermentation process is shown in figure 4. It is clearly observed. In the fermented traditional Chinese medicine feed with the addition amount of 0% and 10% of traditional Chinese medicines, when the addition mass ratio of the compound traditional Chinese medicine premix is 0% and 10%, the bacterial amount of bacillus subtilis is in a descending trend, but the bacterial amount of 10% is higher than 0%; in other groups of Chinese medicinal additive groups, the bacterial load is rapidly increased at the beginning, and the bacterial load reaches the maximum at the time of fermentation for 1d, and then starts to decrease and tends to be at the temperature. Wherein 50%, 70%, 90% of the groups are eventually maintained at a higher bacterial load. At 7d, the amount of the group bacteria added in the feed is still maintained at a higher level of 1.44×10 ⁶ copies/g, 0% group bacteria-2.37 x 10 ⁴ 60.76 times the copies/g.

Experimental results show that the addition of the compound traditional Chinese medicine in the formula is beneficial to the growth of bacillus subtilis, but is not as much as possible. When the addition amount of the traditional Chinese medicine is below 70%, the larger the addition amount of the traditional Chinese medicine is, the more obvious the gain effect is; however, if the gain exceeds 70%, the gain effect is reduced.

Saccharomyces cerevisiae with variation of bacterial amount under different traditional Chinese medicine adding proportion

Different traditional Chinese medicinesThe bacterial amount of Saccharomyces cerevisiae in the fermentation process is shown in FIG. 5 at the addition ratio. The bacterial variation trend of each traditional Chinese medicine adding group is approximately the same. As the fermentation proceeds, the amount of Saccharomyces cerevisiae increases, reaches a maximum at 1d of fermentation, and then decreases continuously. However, it is obviously observed that the addition of the traditional Chinese medicine is beneficial to the growth of saccharomycetes. During fermentation for 1d, it is obviously observed that the maximum bacterial load of 50% of the traditional Chinese medicine adding groups is 1.57 x 10 ⁹ The copies/g is 4.63 x 10 than 0% of the traditional Chinese medicine addition group ⁷ The quantity of the cobies/g bacteria is improved by about 33.91 times. On the 7 th day of fermentation, the maximum amount of Saccharomyces cerevisiae in 70% of the Chinese medicinal additive groups is 6.62×10 ⁷ The copies/g is about 1.54 x 10 of 0% of the traditional Chinese medicine addition group ⁶ 42.99 times the copies/g.

III, variation of bacterial amount of Lactobacillus fermentum in different Chinese medicine adding proportion

The bacterial amount change of lactobacillus fermentum in the fermentation process is shown in figure 6 under different traditional Chinese medicine adding proportion. The bacteria amount change trend of the lactobacillus fermentum added with the traditional Chinese medicines in different groups is approximately the same, and the bacteria amount reaches the maximum when the bacteria amount is 1d, and then gradually decreases. Wherein the bacterial content of the 10% traditional Chinese medicine adding group approaches to 0% in the first 5d fermentation, but the bacterial content of the 10% traditional Chinese medicine adding group is slightly less than 0% in the 7d fermentation. From the experimental results, it can be inferred that the addition of a small amount of the traditional Chinese medicine (10%) had no much effect on the growth of lactobacillus fermentum. The addition of a large amount of traditional Chinese medicines can inhibit the growth of lactobacillus fermentum. However, the inhibition effect is not very strong, and the composition still has higher viable count of 10% in the groups of 50% and 70% of Chinese medicine addition ⁷ Orders of magnitude, respectively, 3.20 x 10 ⁷ copies/g、1.04*10 ⁷ copies/g。

IV, change of the bacterial load of the lactobacillus plantarum under different traditional Chinese medicine adding ratios

The bacterial load change of lactobacillus plantarum in the fermentation process under different traditional Chinese medicine adding ratios is shown in figure 7. In samples with different traditional Chinese medicine addition ratios, the bacteria amount change trend of the lactobacillus plantarum is approximately the same, and the bacteria amount reaches the maximum at the 1 st day of fermentation, and then gradually decreases. The experiment result shows that the Chinese medicine with certain concentration is added to lactobacillus plantarum Is beneficial for growth. On the 7 th day of fermentation, in the range of 0% -50% of the traditional Chinese medicine addition amount, the bacterial amount of the lactobacillus plantarum is increased along with the increase of the traditional Chinese medicine addition amount, and the maximum bacterial amount of the lactobacillus plantarum in the group added by 50% of the traditional Chinese medicines is 3.59 x 10 ⁸ The copies/g is 0% of the Chinese medicine added group bacterial amount-7.47 x 10 ⁷ 4.80 times the copies/g. The addition of high concentration Chinese medicine is detrimental to the growth of lactobacillus plantarum, for example, the bacterial load of 100% Chinese medicine addition group is only 7.44×10 ⁶ The copies/g is only 2.07% of the Chinese medicine added group bacteria amount.

V. variation of the bacterial load of Lactobacillus rhamnosus in different Chinese medicine addition ratios

The bacterial amount change of lactobacillus rhamnosus in the fermentation process is shown in figure 8 under different traditional Chinese medicine adding ratios. The lactobacillus plantarum has similar tendency of changing the bacterial load in samples with different traditional Chinese medicine adding ratios, and reaches the maximum bacterial load at the 1 st day of fermentation, and then gradually decreases. According to the experimental results, it can be obviously observed that the bacterial load is increased along with the addition of the traditional Chinese medicine in 0% -10% group. When the addition amount of the traditional Chinese medicine is 30%, the maximum bacterial amount is 2.23 x 10 ⁶ The copies/g is 4.64 times 10 than 0% of the traditional Chinese medicine addition group ⁵ The bacterial count of the cobies/g is improved by 4.81 times. At the 7 th day of fermentation, the highest lactobacillus rhamnosus bacterial load of 50% of traditional Chinese medicine addition groups is 3.47×10 ⁵ The copies/g is 0% of the added group bacterial amount of the traditional Chinese medicine-7.27 x 10 ⁴ 4.77 times the copies/g. The result shows that the addition of low-content traditional Chinese medicine is beneficial to the growth of lactobacillus rhamnosus, but when the content of the traditional Chinese medicine is too high, the growth of lactobacillus rhamnosus is inhibited.

According to the microbial inoculum size results of each fungus in different traditional Chinese medicine adding ratios, the traditional Chinese medicine adding ratio of 50% is comprehensively considered and selected as the traditional Chinese medicine adding ratio for subsequent experiments. Under the traditional Chinese medicine adding proportion, each fermentation strain has better growth, and the adding amount of the traditional Chinese medicine is not too low to influence the action effect of the medicinal components.

The invention has the beneficial effects that:

(1) The invention creatively researches the antibacterial traditional Chinese medicine of pathogenic bacteria aeromonas hydrophila, fermentation strains, enzymes, the addition proportion of traditional Chinese medicines and auxiliary materials and the growth relation of fermentation strains, and obtains the optimal addition proportion of traditional Chinese medicines, fermentation conditions and fermentation process. Finally, the fermented traditional Chinese medicine additive developed by the invention is used for cultivating the Chinese soft-shelled turtles, can effectively improve the immune function, intestinal digestion level and the like of the Chinese soft-shelled turtles in long-term feeding, and can effectively improve the survival rate of young Chinese soft-shelled turtles in short-term aeromonas hydrophila toxicity attack experiments. The fermented traditional Chinese medicine can be used as a high-quality feed additive for aquaculture, and has remarkable control effect on aeromonas hydrophila.

(2) The invention researches proper traditional Chinese medicine addition amount by changing the flora change of the fermentation strain measured by different traditional Chinese medicine addition ratios, and carries out fermentation treatment on the compound traditional Chinese medicine, so that the medicinal effect components of the compound traditional Chinese medicine are improved or converted into other medicinal effect components which are easy to absorb, and the feed additive is rich in probiotics, can effectively improve the immunity of cultured animals, has acid fragrance and certain antibacterial effect, and is convenient to store.

Drawings

FIG. 1 is a high performance liquid chromatogram of six active ingredients; wherein 1, chlorogenic acid; 2. ferulic acid; 3. baicalin; 4. quercetin; 5. luteolin; 6. baicalein;

FIG. 2 is a high performance liquid chromatogram of gallic acid;

FIG. 3 is a primer specificity verification of fermentation broth; wherein (a) bacillus subtilis primer specificity verification; (b) Saccharomyces cerevisiae primer specificity verification; (c) lactobacillus fermentum primer specificity verification; (d) lactobacillus plantarum primer specificity verification; (e) lactobacillus rhamnosus primer specificity verification;

m: DNA Marker (50-500 bp); 1: bacillus subtilis; 2: saccharomyces cerevisiae; 3: fermenting lactobacillus; 4: lactobacillus plantarum; 5: lactobacillus rhamnosus;

FIG. 4 shows the change of the bacterial load of the bacillus subtilis in different traditional Chinese medicine adding ratios in the fermentation process;

FIG. 5 shows the change of the amount of Saccharomyces cerevisiae at different ratios of traditional Chinese medicine addition during fermentation;

FIG. 6 shows the variation of the bacterial load of Lactobacillus fermentum at different traditional Chinese medicine addition ratios in the fermentation process;

FIG. 7 shows the change of the bacterial load of Lactobacillus plantarum in different traditional Chinese medicine adding ratios in the fermentation process;

FIG. 8 shows the variation of the bacterial load of Lactobacillus rhamnosus with different Chinese medicinal addition ratios during fermentation;

FIG. 9 is a response surface and contour plot of interaction factors; (a) The response surface of the interaction factor (b) the contour of the interaction factor;

FIG. 10 shows the total phenol content after fermenting the Chinese medicine in different strain addition ratios;

FIG. 11 shows the total phenol content after fermenting the Chinese medicine with different enzyme addition ratios;

FIG. 12 is a graph showing the effect of inoculum size on total phenol content;

FIG. 13 is a graph showing the effect of enzyme addition on total phenol content;

FIG. 14 is a graph showing the effect of fermentation temperature on total phenol content;

FIG. 15 is a graph showing the effect of moisture content on total phenol content;

FIG. 16 is a graph of the effect of fermentation time on total phenol content;

FIG. 17 is a response surface 3D plot (a) and contour plot (b) of fermentation time and moisture content effect on total phenol content;

FIG. 18 is a response surface 3D plot (a) and contour plot (b) of the effect of enzyme addition and fermentation time on total phenol content;

FIG. 19 is a response surface 3D plot (a) and a contour plot (b) of the effect of enzyme addition and moisture content on total phenol content;

FIG. 20 is a paraffin section of the intestinal tract of a Chinese soft shell turtle; wherein (a) and (c) are experimental groups; (b) and (d) are control groups.

Detailed description of the preferred embodiments

The invention is further described below in connection with specific embodiments.

The laccase used in the invention is purchased from Shandong Su Kehan biotechnology Co., ltd, and the enzyme activity is 10000U/g. Acid cellulase, xylanase, mannase and tannase are all purchased from Yu Xiacheng (Beijing) biotechnology development Co., ltd, and the enzyme activities are 10000U/g. Beta-glucanase was purchased from Yu Xiacheng (Beijing) biotechnology development Co., ltd, and the enzyme activity was 50000U/g.

Strain sources: bacillus I: bacillus subtilis (Bacillus subtilis) CGMCC1.921; II Yeast: saccharomyces cerevisiae (Saccharomyces cerevisiae) CGMCC2.1527; III lactic acid bacteria: lactobacillus fermentum (Lactobacillus fermentum) CGMCC 1.15608, lactobacillus rhamnosus (Lactobacillus rhamnosus) CGMCC 1.577 and lactobacillus plantarum (Lactobacillus plantarum).

Example 1:

(1) Activation culture of bacillus, saccharomycetes and lactic acid bacteria:

A. firstly, preparing a culture medium of bacillus, saccharomycetes and lactobacillus;

bacillus liquid and solid media: 10g of tryptone, 10g of sodium chloride, 5g of yeast powder, 1L of distilled water, natural pH, sterilization at 121 ℃ for 20min, and the components of the bacillus solid culture medium are the same as those of the liquid culture medium; except that 15g of agar was added.

Yeast liquid and solid medium: filtering with 8 layers of gauze after 200g of potato is boiled and soft, filtering with 20g of glucose, 3g of potassium dihydrogen phosphate, 1.5g of magnesium sulfate, fixing the volume to 1L with distilled water, naturally sterilizing at 121 ℃ for 20min; the components of the saccharomycete solid culture medium are the same as those of the liquid culture medium, except that 15g of agar is added;

lactic acid bacteria liquid and solid medium: 10g of beef extract, 10g of tryptone, 20g of glucose, 5g of yeast powder, 2g of dipotassium hydrogen phosphate, 2g of diammonium hydrogen citrate, 5g of anhydrous sodium acetate, 1mL of Tween 80, 0.58g of magnesium sulfate, 0.25g of manganese sulfate, 1L of distilled water, pH7.2 and sterilizing at 121 ℃ for 20min; the components of the lactobacillus solid culture medium are the same as those of the liquid culture medium, except that 15g of agar is added;

B. the method for activating and culturing bacillus, saccharomycetes and lactobacillus comprises the following steps:

culturing bacillus liquid strain: inoculating glycerol bacteria preserved at-80deg.C to bacillus solid culture medium, culturing at 30deg.C for 18 hr for resuscitating strain, selecting single colony, inoculating into shake flask (250 mL) containing 100mL bacillus liquid culture medium, culturing at 180r/min at 30deg.C for 12 hr to obtain bacillus fermentation seed liquid; inoculating 2% (v/v, namely inoculating 2mL of fermentation seed liquid to each 100mL of liquid culture medium) according to actual needs to the liquid culture medium for expansion culture; the bacillus is bacillus subtilis CGMCC1.921.

Culturing yeast liquid strain: inoculating glycerol bacteria preserved at-80deg.C to yeast solid culture medium, culturing at 28deg.C for 20 hr to recover strain, then picking single colony, inoculating into shake flask (250 mL) containing 100mL yeast liquid culture medium, culturing at 180r/min at 28deg.C for 12 hr to obtain yeast fermentation seed liquid; inoculating 2% (v/v, namely inoculating 2mL of fermentation seed liquid to each 100mL of liquid culture medium) according to actual needs to the liquid culture medium for expansion culture; the microzyme is Saccharomyces cerevisiae CGMCC 2.1527.

Culturing lactobacillus liquid strain: inoculating glycerol bacteria preserved at-80 ℃ to a lactobacillus solid culture medium respectively under aseptic conditions, culturing for 24 hours at 37 ℃ to recover strains, picking single bacterial colonies, inoculating the single bacterial colonies into an anaerobic bottle (50 mL) filled with 50mL of lactobacillus liquid culture medium, standing for 18 hours at 37 ℃ to obtain lactobacillus fermentation seed liquid, and inoculating 2% (v/v) of the lactobacillus fermentation seed liquid into the liquid culture medium according to the actual requirement in an inoculum size of 2mL of fermentation seed liquid inoculated per 100mL of liquid culture medium for expanded culture; the lactobacillus is Lactobacillus plantarum CGMCC1.557, lactobacillus fermentum CGMCC1.15608, and Lactobacillus rhamnosus CGMCC1.577.

(2) Preparing an anaerobic fermentation culture medium, wherein the anaerobic fermentation culture medium comprises the following components in percentage by weight: the anaerobic fermentation medium is obtained by uniformly mixing the compound traditional Chinese medicines (20% of baical skullcap root, 12% of Chinese gall, 14% of wild chrysanthemum, 4% of humifuse euphorbia herb), 30% of bean pulp, 20% of secondary powder and 1% of compound enzyme.

(3) Inoculating the bacillus subtilis fermentation seed liquid, the saccharomyces cerevisiae fermentation seed liquid, the lactobacillus plantarum fermentation seed liquid, the lactobacillus fermentum fermentation seed liquid and the lactobacillus rhamnosus fermentation seed liquid which are subjected to the activation culture in the step (1) into the fermentation culture medium in the step (2), wherein the total inoculation amount is 2% (v/m, namely 2mL:100 g) of the weight of the fermentation culture medium, the adding ratio of each seed liquid is (the volume ratio of lactobacillus to bacillus to saccharomycetes=2:2:3), and the total number of viable bacteria of the lactobacillus fermentation seed liquid is 1.5x10 ⁸ ～3.5×10 ⁹ cfu/mL; the total number of viable bacteria of the bacillus and the saccharomycetes is 1.0×10 ⁸ ～2.8×10 ⁹ cfu/mL; the yeast fermentation seed liquid is Saccharomyces cerevisiae fermentation seed liquid, and the total number of viable bacteria in the lactobacillus fermentation seed liquid is 1.5X10 ⁸ ～3.5×10 ⁹ cfu/mL. Uniformly mixing, and adjusting the water content to 45% to obtain an anaerobic fermentation mixture; anaerobic fermentation is carried out in a fermentation bag under the sealing condition, the fermentation temperature is 30 ℃, and the finished product is obtained after 7 days of fermentation, namely the compound fermented traditional Chinese medicine feed additive.

Example 2: optimization of formula of fermented traditional Chinese medicine feed additive

The formula is optimized by using the D-optimal mixture Design in Design-Expert for radix scutellariae, chinese gall, wild chrysanthemum and humifuse euphorbia herb, and a group of compound traditional Chinese medicine formulas for effectively inhibiting aeromonas hydrophila are obtained by taking the minimum inhibitory concentration of different aeromonas hydrophila as the response.

The method for measuring the minimum inhibitory concentration comprises the following steps: in an ultra clean bench, 100 μl of liquid nutrient agar medium was added to one row in a 96-well plate. Adding 50 mu L of the traditional Chinese medicine extract into a first hole for uniform mixing, then adding 50 mu L of the solution in the first hole into a second hole for uniform mixing, then adding 50 mu L of the solution in the second hole into a third hole for uniform mixing, and so on. After mixing the last well, 50. Mu.L of the solution was aspirated and discarded. Finally, 50. Mu.L of the pathogenic bacteria liquid cultured to the logarithmic phase pair was added to each well. 60% methanol was used as a negative control, kanamycin at a concentration of 0.2mg/mL was used as an antibiotic positive control, and a nutrient agar well without bacteria solution was used as a blank control. And (3) placing the 96-well plate in a 37 ℃ incubator for culturing for 24 hours, then observing the growth condition of the 96-well plate, and visually observing to obtain the transparent sterile growth concentration, namely the minimum antibacterial concentration.

The formula design and the results are shown in table 6, table 7 lists the test results of the minimum inhibitory concentration of aeromonas hydrophila after the fermentation of the baikal skullcap root, the humifuse euphorbia herb, the gallnut and the wild chrysanthemum in different proportions, A, B, C, D in the table are the mass fractions of the baikal skullcap root, the humifuse euphorbia herb, the gallnut and the wild chrysanthemum respectively, and the test values of the response values are subjected to secondary multiple regression fitting by using software to establish a regression model as follows:

Y＝10.72A+20.73B+92.64C+21.63D-1.82AB-165.49AC+16.30AD-204.57BC+84.86BD-182.92CD-2305.77ABC+2892.73ABD-485.90ACD+262.30BCD R2＝0.9950 P＜0.0001

TABLE 6 experimental factors and levels

TABLE 7D-optimal design and test results

Table 8 analysis of variance of regression equation

The multivariate correlation coefficient R2=0.995 and the correction decision coefficient R2Adj= 0.9842 show that the model fits well to the actual situation, the fitting model and the mixed linear model P are less than 0.0001, the model selected by the test has high significance, the mismatching term is not significant at the level of P=0.05, so the fitting degree of the model is good, and the formula of the compound traditional Chinese medicine can be determined by using the model.

And (3) drawing contour lines and response surface analysis of interaction factors of the baikal skullcap root, the humifuse euphorbia herb and the gallnut according to the experimental result of the D-mixing design and a regression equation, and as shown in fig. 9, the response surface diagram is a curved surface, which shows that the three have certain interaction. The range of variation of each factor was set by the optimization function of the software, and the expected response values were set as shown in table 9.

The software data analysis gives several combinations that meet or approach the target response value and provides a predicted value. The method selects 40% of baical skullcap root, 8% of humifuse euphorbia herb, 22.94% of Chinese gall and 29.06% of wild chrysanthemum flower as a compound traditional Chinese medicine formula, and predicts the minimum inhibitory concentration response value of the wild chrysanthemum flower to aeromonas hydrophila to 4.5903mg/mL after fermentation. The optimized combined baikal skullcap root 40%, humifuse euphorbia herb 8%, chinese gall 24% and wild chrysanthemum flower 28% are adopted, the minimum antibacterial concentration actual value of the fermented formula for aeromonas hydrophila is 4.6517mg/mL, no obvious difference (P is more than 0.05) from the predicted value is the minimum value in all experiments, and therefore the formula is selected as a compound fermented traditional Chinese medicine formula.

Table 9 analysis of variance of regression equation

Example 3: determination of optimum strain addition ratio

According to the experimental result, selecting the strain which can effectively promote the medicinal components after single-strain fermentation as the fermentation strain. Fermenting with different strain adding ratios, controlling other fermentation conditions to be the same, and exploring the influence of the fermentation on total polyphenol before and after fermentation. Wherein 9 groups are set, and the volume ratio of the lactobacillus fermentation seed liquid, the bacillus fermentation seed liquid and the saccharomycete fermentation seed liquid is respectively 1:1: 1. 1:2: 2. 1:3: 3. 2:1: 2. 2:2: 3. 2:3: 1. 3:1: 3. 3:2:1 and 3:2:3. in a solid state fermentation system, lactic acid bacteria, bacillus and saccharomycetes are used for fermentation in a synergistic way. The aerobic growth of the bacillus subtilis consumes residual oxygen in the sealed bag, and the abundant enzyme system is produced to decompose and utilize macromolecular substances in the fermented traditional Chinese medicine feed additive. The saccharomyces cerevisiae consumes oxygen through aerobic respiration, and simultaneously, the saccharomyces cerevisiae grows to produce enzyme to promote the decomposition and utilization of macromolecular substances in a fermentation matrix. In addition, the saccharomyces cerevisiae can also produce amino acid, vitamin and other nutrient substances, and can promote the growth and proliferation of lactobacillus. The bacillus and the saccharomycete consume oxygen in the early fermentation period, and the anaerobic environment can promote the growth of lactic acid bacteria. Besides the capability of producing organic acid, lactic acid bacteria are rich in enzyme systems, and can degrade macromolecular substances to generate micromolecular substances such as monosaccharide, amino acid and the like. Yeast can also utilize monosaccharide to meet the requirement of self-growth and proliferation. Therefore, the interaction among the fermentation strains is very tight, and a proper strain proportion needs to be found, so that the release of the effective components of the traditional Chinese medicine can be effectively improved under the proportion. The experimental results are shown in fig. 10, when lactic acid bacteria: bacillus subtilis: saccharomyces cerevisiae is 2:2:3, the total phenol content is up to 37.69mg/g.

Example 4: determination of the optimal enzyme addition ratio

Wherein 9 groups of cellulase, hemicellulase and tannase are set, and the mass ratio of the cellulase to the hemicellulase to the tannase is respectively 1:1: 1. 1:2: 2. 1:3: 3. 2:1: 2. 2:2: 3. 2:3: 1. 3:1: 3. 3:2:1 and 3:2:3. the research shows that the cellulase, the hemicellulase and the tannase have synergistic effect, and the different structures of the cellulase and the hemicellulase acting on plants can degrade lignocellulose more efficiently, so that the effective components are easier to release, and the intracellular plant tannin is easier to combine with the tannase. Tannase hydrolyzes vegetable tannins to produce small molecular phenolic acids which are more readily available to the body. Therefore, a proper enzyme adding proportion needs to be found, the experimental result is shown in fig. 11, and cellulase is selected: hemicellulase: tannase is 2:2:3, at which the total phenol content was the highest, was 41.25mg/g.

Example 5: optimization of fermentation conditions

(1) Single factor optimization of fermentation conditions

1. Effect of inoculum size on fermented traditional Chinese medicine

Weighing 1000g of traditional Chinese medicine (400 g of baical skullcap root, 240g of Chinese gall, 280g of wild chrysanthemum flower and 80g of humifuse euphorbia herb), 600g of bean pulp and 400g of powder, uniformly mixing, and equally dividing the mixture into 20 parts, wherein 50g of each part is used as a fermentation substrate.

And 7 groups of fermentation matrixes are selected in each group, and fermentation bacterial liquids with different inoculation amount ratios are respectively added by taking the mass of the fermentation matrixes as a reference, wherein the fermentation bacterial liquids are respectively 0%, 0.5%, 1%, 2%, 4%, 8% and 16% (V/W). Distilled water is added to control the water content of each group to be 50%, and 1% (W/W) of a fermentation enzyme preparation is added; and (3) carrying out packed anaerobic fermentation at the fermentation temperature of 30 ℃ for 7 days. Experiments were performed in 3 replicates, averaged, and repeated 3 times, as follows.

In the process of the synergistic fermentation of the bacterial enzymes, the fermentation strain often plays an important role. The fermentation strain utilizes the nutrient substances in the traditional Chinese medicine feed, and the metabolism generates various secondary metabolites such as lignocellulose, tannase and the like, so that the release of the medicinal components is promoted, and the total phenol amount is increased. As shown in FIG. 12, the total phenol content in the fermented chinese herbal feed was the highest at an inoculum size of 2% (V/W), which was 42.27mg/g. At smaller inoculum sizes, the initial number of fermenting microorganisms is smaller, and enzymes etc. secreted by metabolism are smaller, so that the total phenol content is lower. When the inoculation amount is large, the microorganism amount in the matrix is large, so that a large amount of nutrient substances are consumed in early fermentation so as to meet the requirement of self-growth, and the growth is inhibited due to insufficient nutrient substances. In addition, the high inoculation amount can lead to rapid decrease of the pH value in the feed when rich organic acid is produced during fermentation, and the too low pH value can inhibit the growth of fermentation strains and enzyme production. Therefore, the amount of the selected inoculum was 2% (V/W).

2. Influence of the addition of the fermentation enzyme on the fermented Chinese medicine

According to the above experiment, the inoculation amount was selected to be 2% (V/W), and other fermentation conditions were unchanged, and the addition amounts of the different enzyme preparations were changed to be 0%, 0.05%, 0.1%, 0.5%, 1%, 2%, and 4% (W/W), respectively.

As shown in FIG. 13, the addition amount of the enzyme has an important effect on the total phenol content in the fermented traditional Chinese medicine, which increases with the increase of the enzyme, but the increase of the total phenol is slowed down after the addition amount of 1%. This may be due to the addition of enzymes which help hydrolyze plant cell wall components and allow intracellular polyphenols to be more readily released from the cell. When the enzyme addition amount was 4%, the amount was slightly lower than that of the first two groups. The reason for this may be that the amount of substrate is constant and the amount of enzyme has reached saturation, so there is not so significant gain in the increase of total phenol. And the addition amount of the enzyme is too high, so that the traditional Chinese medicine ratio in each gram of fermented traditional Chinese medicine additive is reduced, and the total phenol content in each gram of fermented traditional Chinese medicine additive is reduced.

Although the total phenol content was the highest at an enzyme addition of 2%, it was 43.21mg/g. However, considering the 1% enzyme added group, its total phenol content was not much different from that of the 2% group, 42.89mg/g. For economic reasons, an addition of 1% is chosen.

3. Influence of fermentation temperature on fermented Chinese medicine

According to the above experiment, the enzyme addition amount was 1% (W/W), other fermentation conditions were not changed, and the fermentation temperatures were changed to 20 ℃, 25 ℃, 30 ℃, 35 ℃ and 40 ℃, respectively.

The experimental results are shown in FIG. 14, and it is known that the fermentation temperature plays a very important role in the fermentation process. In the range of 20 ℃ to 30 ℃, the total phenol is increased with the increase of temperature. Highest at 30 ℃, 43.02mg/g. However, after 30 ℃, the polyphenol content thereof showed a tendency to decrease. The possible reasons for this are that the yeast plays a relatively important role in the fermentation process, the optimum growth temperature of Saccharomyces cerevisiae is between 25 ℃ and 30 ℃, and the strain gradually decays above 30 ℃. The optimal growth temperature of lactobacillus is between 30 ℃ and 40 ℃, and the optimal temperature of bacillus is between 30 ℃ and 37 ℃.

In the fermentation temperature environment of 30 ℃, each fermentation strain can grow well. This temperature can thus be chosen as the optimum fermentation temperature.

4. Influence of different water contents on fermented traditional Chinese medicine

According to the above experiment, the fermentation temperature was selected to be 30 ℃, and other fermentation conditions were unchanged, and the water contents were changed to be 30%, 40%, 50%, 60%, 70%, 80% (V/W), respectively.

The experimental results are shown in fig. 15, which shows that the total phenol content increases with increasing water content. Water is important in the fermentation process, and water is required for the growth, proliferation and enzyme production of fermentation strains. As the water content increases, its total phenol content increases. The reason for the speculation is: the water content in the feed is increased, the free water content in the feed is increased, and the active growth of the strain is more suitable, so that the fermentation flora of the strain is better grown. The reason is as follows: the water content in the feed is increased, and the water-soluble total phenols in the traditional Chinese medicinal materials are easier to dissolve and release. Thus the total phenol content is increased. However, when the water content is too high, other harmful bacteria proliferate in the fermentation strain, and the fermentation strain is deteriorated, so that the fermentation strain is not easy to preserve. At 60d of fermentation, some mould was observed in the feeds of the group with a water content of 70%, 80%. Therefore, the water content was selected to be 50%.

5. The influence of different fermentation time on the fermented traditional Chinese medicine is explored

According to the above experiment, the fermentation water content was selected to be 50% (V/W), other fermentation conditions were not changed, and different fermentation times were changed to be 0d, 1d, 3d, 5d, 7d, 9d, 14d, 28d, respectively.

The Chinese medicinal feed undergoes a series of material changes during fermentation, such as growth and proliferation of fermentation strain, and metabolic conversion of material. The process needs a certain time, but the fermentation time is prolonged, so that better fermentation effect can not be achieved, and the problems of utilization of medicinal components, pollution of harmful bacteria, increase of fermentation cost and the like can be caused.

As shown in FIG. 16, the total phenol content increased with the increase in fermentation time at 1 to 7 days of fermentation. However, after 7 days, the total phenol content in the fermented traditional Chinese medicine feed is reduced. The possible reasons for this are that in the initial fermentation stage, the fermentation strain first absorbs and utilizes nutrients such as easily-decomposed soybean meal and secondary powder for self-growth and proliferation. Along with the proliferation of the fermentation strain, the metabolism of the strain generates components which can be decomposed in Chinese herbal medicines and are difficult to decompose, such as lignocellulose, tannase and the like. And the lactic acid bacteria produce organic acids to provide a more acidic environment (pH about 4.0 to 5.0) for the feed, which is more suitable for the action of lignocellulose. Thus, the total phenol content gradually increases in the early stage. However, in the latter fermentation stage, since a large amount of fermentation strains exist, substances such as easily digestible soybean meal and secondary powder are utilized, and thus the fermentation flora starts to utilize the total polyphenol to satisfy the growth of the fermentation flora. In summary, a suitable fermentation time of 7 days was chosen.

(2) Response surface optimization fermentation conditions

According to the previous experimental results, the fermentation time, the water content and the enzyme addition amount are selected as influencing factors by taking the total phenol content as an index for research. The Design of experiments and optimization were performed using the Box-Behnken Design (BBD) of Design Expert 8.0.6 software. The experimental factors and levels are shown in Table 10.

Table 10 experimental factors and levels

According to the results of the experiment, the response surface optimization experiment is designed by using the total phenol content as a response value, the fermentation time, the water content and the enzyme addition amount as independent variables and adopting a Box-Behnken Design (BBD) of Design Expert 8.0.6. The experimental protocol and results are shown in table 11.

TABLE 11 response surface Experimental design and results

Performing multiple regression fitting on the data to obtain a quadratic polynomial model equation between A (fermentation time), B (water content), C (enzyme addition ratio) and the total phenol content (X) in the fermented traditional Chinese medicine feed:

X＝+38.89+1.26*A-1.35*B+1.70*C+1.28*A*B-0.31*A*C-0.72*B*C-0.084*A2+2.71*B2+0.060*C2

analysis of variance is shown in Table 12. The response surface regression model is remarkable (P is less than 0.05), which shows that the total phenol content is remarkably different under different conditions. The mismatching term is not obvious (0.0521 is more than 0.05), which shows that the model can better describe the relationship between different fermentation conditions and the total phenol content in the compound traditional Chinese medicine feed additive. A coefficient of variation of 2.52 less than 5% indicates that the model is repeatable. The R2 and Adj R2 of the model are 0.9266 and 0.8232 respectively, which show that the fitting degree is good, the error is small, and the regression equation can simulate the influence of the actual experimental point on the increase of the total phenol content. Adeq precision is greater than 4.0, and the model meets the prediction requirements.

In the model established in the experiment, A, B, C, B2 has very remarkable influence on the total phenol content of the fermented traditional Chinese medicine (P is less than 0.01), and AB has remarkable influence on the total phenol content of the fermented traditional Chinese medicine (P is less than 0.05).

Table 12 analysis of variance of regression model

C.V.％2.52；R ² ＝0.9266；Adj R ² ＝0.8323；Pred R ² ＝0.8589；Adeq precision＝12.673

The steeper the response surface 3D plot shown in figures 17, 18, 19, the greater the effect of this factor on the response value, the denser the contour lines, the stronger the interaction, as shown in figures 17, 19, the more elliptical, indicating that the interaction of fermentation time and moisture content, enzyme addition and moisture content have a significant effect on total phenol content, as well as the response surface 3D plot.

Predicting the optimal fermentation process of the response surface model: the fermentation time is 7 days, the water content of the compound traditional Chinese medicine feed is 45%, the enzyme addition amount is 1%, and at the moment, the theoretical total phenol content is 45.40mg/g. The fermentation is carried out under the experimental conditions (the fermentation time is 7 days, the water content of the compound traditional Chinese medicine feed is 45%, the enzyme addition amount is 1%), the total phenol content is measured, the experiment is repeated 3 times, and the average value of the total phenol content in the fermented feed is 45.38mg/g and is close to the theoretical value (P is more than 0.05).

Example 6: feeding effect experiment of the product; the compound traditional Chinese medicine fermented feed additive prepared in the embodiment 1 of the invention is added into common aquatic feed to obtain mixed feed for feeding special aquatic animals, and the addition amount is 5% -25% (by weight) of the obtained mixed feed.

A turtle greenhouse culture pond applied to a microbiological institute at Jiangsu university is selected for experiments, the length of the culture pond is 1.57m, the width is 1.22m, the height is 0.72m, and the water depth is adjusted to be 0.5m. Three parallel groups are arranged in each group, 20 Chinese soft-shelled turtles with similar sizes and weights are cultured in each parallel group, the time is 2021, 10 months, 2022, 1 month, 15 days of preliminary experiments and 60 days of formal experiments. The average body mass (the male and female parts are half, the average body mass (200+/-15) g and the healthy Chinese soft-shelled turtle are randomly divided into two groups, namely an experimental group and a control group;

feeding 10% of fermented compound traditional Chinese medicine feed additive and 90% of full-value powder in an experimental group;

the control group was fed 100% full value powder. The feed formula of the Chinese soft-shelled turtle is shown in table 13, and the composition of the full-value powder is shown in table 14.

The experimental group and the control group are respectively fed with soft-dough feeds prepared according to the table 13 before the beginning of the experiment for domestication for 2 weeks, and the daily feeding amount is 2% of the weight of the Chinese soft-shelled turtle. Each group was at 11 daily after the start of the trial: 00-14: 00. 19:00-22:00 is respectively fed with soft-dough feed prepared according to table 13, the daily feed amount is 2% of the weight of the Chinese soft-shelled turtle, and a siphon is adopted to clean the residual feed after 1h of feeding. During cultivation, the pH of the water body is between 7 and 8.5, the dissolved oxygen amount is 3 to 5mg/L, the ammonia nitrogen is less than 2mg/L, and the water temperature of the water body is 30 ℃.

Table 13 Chinese soft-shelled turtle feed formula

TABLE 14 full value powder composition

The feed coefficient of the Chinese soft-shelled turtles is shown in Table 15. In the long-term feeding test, the known compound fermented traditional Chinese medicine feed additive has the main component of plant tissues, is not easier to be absorbed by animals than full-value powder (mainly animal protein), but has small difference between the feed coefficient of the experimental group and the control group. The possible reasons for this are that after the compound traditional Chinese medicine feed additive is fermented, secondary metabolites such as lignocellulose are produced by the fermentation strain, and lignocellulose components in the degradable feed are converted into easily absorbed saccharide substances; if the protease can degrade macromolecular proteins into small molecular peptides, the fermented traditional Chinese medicine feed additive is easier to be absorbed by organisms. In addition, the possible reasons are that the compound fermented traditional Chinese medicine feed additive contains rich viable bacteria, and the digestion and absorption functions of the compound fermented traditional Chinese medicine feed additive are improved along with the field planting of the trionyx sinensis in the intestinal tracts of the trionyx sinensis after the trionyx sinensis is ingested.

TABLE 15 feed coefficient of Chinese softshell turtles

Note 1: feed coefficient = feed consumption/weight gain x 100%

And (2) injection: the same letter for the same row of data indicates that the difference is not significant (P > 0.05), and the no-label indicates that the difference is significant (P < 0.05).

The intestinal canal slice of the Chinese soft-shelled turtle is shown in fig. 20. The pile height, crypt depth, pile height/crypt depth are shown in Table 16.

The small intestine is an important part for absorbing nutrients, and the villus height, the crypt depth and the villus height/crypt depth ratio of the small intestine are all important indexes for measuring the digestion and absorption functions of the organism. The longer the small intestinal villus, the larger the ratio of small intestinal villus height to crypt depth, which indicates the stronger the intestinal digestion and absorption function. The ratio of the small intestinal villus length, small intestinal villus height and crypt depth of the experimental group is larger than that of the control group, which proves that the compound traditional Chinese medicine fermented feed additive is beneficial to the absorption of Hua Bie intestinal tracts.

Table 16 influence of Compound fermented traditional Chinese medicine feed additive on the intestinal tract of Hua Bie

Note that: the same letter for the same row of data indicates that the difference is not significant (P > 0.05), and the no-label indicates that the difference is significant (P < 0.05).

The results of the blood cell measurement of the experimental group and the control group are shown in Table 17, and the number of white blood cells in the blood of the Chinese soft-shelled turtle in the experimental group is far smaller than that in the control group. White blood cells are an important ring in the immune function of Chinese soft-shelled turtles, and the white blood cells participate in the immune process, and the content of the white blood cells is increased, so that certain bacterial infection conditions can exist. Experimental results show that the compound fermented traditional Chinese medicine feed additive has the advantages of improving the immune function of Hua Bie and reducing bacterial infection to a certain extent. As can be seen from the number of erythrocytes, the number of erythrocytes in the experimental group was greater than that in the control group. Some researchers believe that erythrocytes, in addition to being involved in oxygen transport, may also be involved in immune function in the body. The experimental results of the embodiment show that the feeding of the compound fermentation traditional Chinese medicine feed additive has a certain gain effect on the hematopoietic function and the immune function of the Chinese soft-shelled turtle participated by the red blood cells.

Influence of Table 17 compound fermented traditional Chinese medicine feed additive on conventional indexes of Chinese softshell turtle blood

Note that: the same row of data marked letters indicates that the difference is not significant (P > 0.05), and the no mark indicates that the difference is significant (P < 0.05).

The biochemical indexes of blood of the Chinese soft-shelled turtles in the experimental group and the control group are shown in a table 18. Glutamic-pyruvic transaminase (ALT) and glutamic-oxaloacetic transaminase (AST) are mainly present in the cytoplasm and mitochondria of liver cells respectively, and are two important indexes for evaluating whether liver functions are normal or not [120]. When the liver is damaged, the permeability of the cell membrane increases and the transaminase activity increases [121]. ALT and AST in the experimental group were smaller than those in the control group. Experiments show that the compound fermented traditional Chinese medicine feed additive has a certain protection effect on liver functions of Chinese soft-shelled turtles. UREA (UREA), creatinine (CREA), uric Acid (UA) levels are associated with protein metabolism by renal function of trionyx sinensis [126]. Once renal function is reduced or lost, substances such as UREA, CREA, UA, which are different endogenous chemical components, are caused to accumulate in the blood, thereby causing hyperuricemia. The experimental results of the research show that UREA, CREA, UA of the experimental groups are smaller than those of the full-value powder, which indicates that the compound fermented traditional Chinese medicine feed additive can be better than the full-value powder in the aspect of preventing kidney injury. The content of Triglyceride (TG), high Density Lipoprotein (HDL), low Density Lipoprotein (LDL) is related to lipid metabolism. The triglyceride has the main function of storing and supplying energy, and experimental results show that the content of the triglyceride in serum in the experiment is equivalent to that in the control group, but HDL in the experiment is higher than that in the control group, and LDL in the experiment is lower than that in the control group. The high HDL content of the experimental group shows that the compound fermented traditional Chinese medicine feed additive has better gain effect in participating in the cholesterol metabolism of the Chinese soft-shelled turtles. The main function of LDL is to transport cholesterol to the inside of tissues, but when it introduces too much cholesterol, it is easily adhered to the wall of blood vessels to cause arteriosclerosis, so that the LDL content is not too high, and the LDL of the experimental group is lower than that of the control group. According to the measurement results, the TG content between the two groups is similar, HDL in the experimental group is higher than that in the control group, and LDL in the experimental group is lower than that in the control group. According to the result, the compound fermented traditional Chinese medicine feed additive is beneficial to regulating and controlling the blood fat of the Chinese soft-shelled turtle.

Influence of Table 18 compound fermented traditional Chinese medicine feed additive on biochemical index of Chinese softshell turtles

The serum antioxidant immunity index of the experimental group and the control group of Chinese soft-shelled turtles is shown in table 19. Lysozyme (LSM) in serum is an enzyme produced by monocytes, neutrophils and macrophages that lyses the bacterial cell wall. It is an important non-specific defensive factor and is also one of the important markers of the non-specific immune defensive level of aquatic animals. Experimental results show that the lysozyme activity of the Chinese softshell turtle fed with the compound fermented traditional Chinese medicine feed additive is far higher than that of a control group. The result can show that the non-specific immunity of the Chinese soft-shelled turtle can be improved to a certain extent when the compound fermented traditional Chinese medicine feed additive is fed as a long-term ration.

The Chinese soft-shelled turtle body contains a large amount of polyunsaturated fatty acids, which are easily oxidized, so that diseases are generated. The research shows that the antioxidant capacity is related to nonspecific immunity, improves the antioxidant capacity of organisms, and can excite the immune function of the organisms, thereby improving the immunity and disease resistance of the organisms. Therefore, the immune function of the soft-shelled turtle serum can be observed by measuring the antioxidant capacity of the soft-shelled turtle serum. The result of measuring the total antioxidant capacity (T-AOC) of the two groups of Chinese softshell turtle serum can prove that the antioxidant capacity of the Chinese softshell turtle serum of the compound fermented traditional Chinese medicine feed additive group is about twice as much as that of the whole-price powder group. Can be used for improving the oxidation resistance of the Chinese soft-shelled turtles by adding the compound fermented traditional Chinese medicine feed additive, thereby achieving the effect of enhancing the immunity of organisms.

Acid phosphatase (ACP) is a marker enzyme for lysosomal enzymes in macrophages, and is involved in the transfer and metabolism of phosphate groups in vivo, with release of ACP accompanying phagocytosis and encapsulation reactions of blood cells. Wei et al have found in studies of the relationship of ACP to immune response in mussels. When the mussel is damaged by the outside, the ACP activity of the mussel body can be increased. And will return to normal condition after the injury is recovered. The study of which suggests that ACP viability is related to the mechanism of body injury. The test result shows that the ACP activity of the Chinese soft-shelled turtle in the compound fermented traditional Chinese medicine feed additive group is slightly lower than that of the Chinese soft-shelled turtle fed with the full-value powder. The result shows that the Chinese soft-shelled turtle with the complete powder group may have some damage to the body. Experimental results show that the daily ration added with the compound fermented traditional Chinese medicine feed additive can reduce the damage condition of the body of the Chinese soft-shelled turtle in daily cultivation to a certain extent.

Alkaline phosphatase (AKP) is a very important enzyme for trionyx sinensis. It is involved in bone and dorsal forma-tion and calcium and phosphorus metabolism. AKP activity is one of the important indexes of calcium and phosphorus metabolism reflecting the activity and the formation of osteoblast. The deficiency of calcium and phosphorus has a great influence on animal growth, and is mainly manifested by abnormal bone structure, reduced appetite, osteomalacia, reduced production performance, etc. AKP in the blood of young animals is mainly from skeletal tissue, and as it grows to maturity, AKP from bone is continuously reduced. In the experiment, certain differences exist among the individual Chinese soft-shelled turtles, and the differences are particularly shown in a plurality of groups, so that the sizes of the individual Chinese soft-shelled turtles are too large. The AKP determination result also shows that the AKP activity of the soft-shelled turtle with smaller body size is greater than that of the soft-shelled turtle with larger body size. Therefore, the direct addition calculation of the average value thereof as the measurement result is not very accurate. The AKP activity of the test is compared with the weight of the soft-shelled turtle. The results show that AKP activities/weights of two groups of Chinese soft-shelled turtles are basically similar, and the results can indicate that the addition of the compound fermentation traditional Chinese medicine feed additive has no great influence on the formation of bones and the formation of the back nails of the Chinese soft-shelled turtles and the metabolism of calcium and phosphorus.

Table 19 Effect of Compound fermented traditional Chinese medicine feed additive on antioxidant immune index of Hua Bie serum

Note that: the same row of data marked with the same letter indicates that the difference is not significant (P > 0.05), and the marked or marked with different letters indicates that the difference is significant (P < 0.05).

Experimental results show that the long-term feeding of the compound fermented traditional Chinese medicine feed additive has no obvious influence on the production performance of the Chinese soft-shelled turtle. The compound fermented traditional Chinese medicine feed additive can effectively improve the intestinal function of the Chinese soft-shelled turtles, improve the immunity of the Chinese soft-shelled turtles, and has obvious effects of reducing body damage and improving the liver and kidney functions and blood sugar regulating capability of the Chinese soft-shelled turtles.

Example 7: pathogenic bacteria toxicity attack experiment 1

The compound fermented traditional Chinese medicine feed additive prepared in the embodiment 1 of the invention is added into common aquatic feed to obtain mixed feed for feeding special aquatic animals, and the addition amount of the mixed feed is 5-25% (by weight). The formula of the compound fermented traditional Chinese medicine feed additive is as follows: 50% of compound traditional Chinese medicine (20% of baical skullcap root, 12% of Chinese gall, 14% of wild chrysanthemum flower, 4% of humifuse euphorbia herb), 30% of soybean meal, 20% of secondary powder and 1% of compound enzyme. The biological feed formula comprises: 60% of bean pulp, 40% of secondary powder and 1% of compound enzyme. The fermentation conditions of the compound fermented traditional Chinese medicine feed additive and the biological feed are the same, and the difference is only that the formulas are different.

The young Chinese soft-shelled turtle with the average weight of 10+/-5 g is selected from the male and female half and healthy and active Chinese soft-shelled turtles. The feed is randomly divided into three groups, the same amount of A, B, C three groups of feeds are respectively fed, wherein A is 10% of the compound fermented traditional Chinese medicine feed additive, 90% of the complete powder group, B is 10% of the biological feed, 90% of the complete powder group and C is 100% of the complete powder feed. Each group was repeated 3 times, 30 Chinese soft-shelled turtles each.

Aeromonas hydrophila is added into daily ration at the beginning of the toxicity attack experiment, and the average pathogenic bacteria intake of each young turtle is about 108CFU, and then different daily ration is fed normally.

The toxicity attack experiment results are shown in Table 20, and the survival results of the young turtles on the seventh day of the toxicity attack experiment show that in the toxicity attack experiment process, the complete powder group of young turtles die largely, the biological feed group dies slightly, and the survival rate of the compound fermented traditional Chinese medicine feed additive group is highest.

After pathogenic bacteria are added, some young turtles in the full-value powder group can slowly move, float, and the individual parts of the body can be subjected to bacterial infection such as ulceration. The biological feed group is characterized by the occurrence of the above situation of individual young turtles. However, in the group of the compound fermented traditional Chinese medicine feed additives, obvious abnormality is not seen, and active eating is normal.

Table 20 Aeromonas hydrophila toxicity attack experiment

Example 8: pathogenic bacteria toxicity attack experiment 2

The compound fermented traditional Chinese medicine feed additive is added into common aquatic feed to obtain mixed feed for feeding special aquatic animals, and the addition amount of the compound fermented traditional Chinese medicine feed additive is 5% -25% (by weight) of the mixed feed. The formula of the compound fermented traditional Chinese medicine feed additive is as follows: 50 percent of compound Chinese medicinal materials (20 percent of baical skullcap root, 12 percent of Chinese gall, 14 percent of wild chrysanthemum flower, 4 percent of humifuse euphorbia herb), 30 percent of soybean meal, 20 percent of secondary powder and 1 percent of compound enzyme)

Aeromonas hydrophila is added into daily ration at the beginning of the toxicity attack experiment, and the average pathogenic bacteria intake of each young turtle is about 1012CFU, and then different daily ration is fed normally.

The results of the toxicity attack experiments are shown in Table 21, the toxicity attack amount of pathogenic bacteria is increased in the toxicity attack experiment, the reduction of the survival rate of the young turtles in each group can be obviously observed, but the survival rate of the young turtles in the group of the compound fermented traditional Chinese medicine feed additive is still higher than that of the young turtles in other groups, and the compound fermented traditional Chinese medicine feed additive has better effect of resisting the infection of aeromonas hydrophila.

Table 21 Aeromonas hydrophila toxicity attack experiment

Example 9: pathogenic bacteria toxicity attack experiment 3

The compound fermented traditional Chinese medicine feed additive is added into common aquatic feed to obtain mixed feed for feeding special aquatic animals, and the addition amount of the compound fermented traditional Chinese medicine feed additive is 5% -25% (by weight) of the mixed feed. The formula of the compound fermented traditional Chinese medicine feed additive is as follows: 10 percent of compound Chinese herbal medicine (4 percent of baical skullcap root, 2.4 percent of Chinese gall, 2.8 percent of wild chrysanthemum, 0.8 percent of humifuse euphorbia herb), 54 percent of bean pulp, 36 percent of secondary powder and 0.1 percent of compound enzyme

Aeromonas hydrophila is added into daily ration at the beginning of the toxicity attack experiment, and the average pathogenic bacteria intake of each young turtle is about 108CFU, and then different daily ration is fed normally. The results of the toxicity attack experiments are shown in Table 22, and the traditional Chinese medicinal materials adopted by the compound fermentation traditional Chinese medicine feed additive selected in the toxicity attack experiments only contain 10 percent, but the experimental results show that the compound fermentation traditional Chinese medicine feed additive still has good antibacterial effect.

Table 22 Aeromonas hydrophila toxicity test

The same row of data marked letters indicates that the difference is not significant (P > 0.05), and the no mark indicates that the difference is significant (P < 0.05).

Example 10: pathogenic bacteria toxicity test 4

The compound fermented traditional Chinese medicine feed additive is added into common aquatic feed to obtain mixed feed for feeding special aquatic animals, and the addition amount of the compound fermented traditional Chinese medicine feed additive is 5% -25% (by weight) of the mixed feed. The formula of the compound fermented traditional Chinese medicine feed additive is as follows: 90% of compound traditional Chinese medicine materials (36% of baical skullcap root, 21.6% of Chinese gall, 25.2% of wild chrysanthemum flower, 7.2% of humifuse euphorbia herb, 6% of bean pulp, 4% of secondary powder and 10% of compound enzyme);

Aeromonas hydrophila is added into daily ration at the beginning of the toxicity attack experiment, and the average pathogenic bacteria intake of each young turtle is about 1012CFU, and then different daily ration is fed normally. The results of the toxicity attack experiments are shown in Table 23, and the content of the traditional Chinese medicinal materials adopted by the compound fermentation traditional Chinese medicine feed additive selected in the toxicity attack experiments is 90%, but compared with the traditional Chinese medicine additive group of 50%, the survival rate is improved by 6.67%, while the survival rate of young soft-shelled turtles is effectively improved, the additive cost is increased to a certain extent by the addition proportion, and economic factors need to be considered when the traditional Chinese medicine additive amount is adopted.

Table 23 Aeromonas hydrophila toxicity attack experiment

Description: the above embodiments are only for illustrating the present invention and not for limiting the technical solution described in the present invention; thus, while the invention has been described in detail with reference to the various embodiments described above, it will be understood by those skilled in the art that the invention may be modified or equivalents; all technical solutions and modifications thereof that do not depart from the spirit and scope of the present invention are intended to be included in the scope of the appended claims.

Claims

1. A preparation method of a compound fermented traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila is characterized by comprising the following preparation steps:

the weight percentages of the components of the fermentation medium are respectively as follows:

10-90% of compound traditional Chinese medicine;

6-54% of bean pulp;

4-36% of secondary powder;

the addition amount of the complex enzyme is 0.1-10%;

the compound Chinese herbal medicine consists of the following materials in percentage by weight: 4-36% of radix scutellariae, 2.4-21.6% of gallnut, 2.8-25.2% of wild chrysanthemum and 0.8-7.2% of humifuse euphorbia herb;

the complex enzyme consists of cellulase, hemicellulase and tannase;

(2) Respectively inoculating bacillus, saccharomycetes and lactobacillus into corresponding liquid culture mediums for activation culture to respectively obtain bacillus fermentation seed liquid, saccharomycetes fermentation seed liquid and lactobacillus fermentation seed liquid; the bacillus is bacillus subtilis; the saccharomycete is saccharomyces cerevisiae; the lactobacillus is Lactobacillus plantarum, lactobacillus fermentum and Lactobacillus rhamnosus;

(3) Inoculating the bacillus fermentation seed liquid, the saccharomycete fermentation seed liquid and the lactobacillus fermentation seed liquid obtained in the step (2) into the fermentation culture medium obtained in the step (1), regulating the fermentation temperature and the water content of the culture medium, uniformly mixing to obtain a fermentation mixture, and carrying out anaerobic fermentation under a closed condition to obtain the fermented traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila infection.

2. The method for preparing the compound fermented traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila, according to claim 1, wherein the bean pulp in the step (1) is required to be dried and ground into powder for use in use; the powder is obtained by sieving with 50-80 mesh sieve; the compound Chinese medicinal materials are ground into powder for use, and the powder is obtained by sieving with a 50-80 mesh sieve;

the mass ratio of the cellulase to the hemicellulase to the tannase is 2:2:3; in the complex enzyme, the enzyme activity of the hemicellulase is 5 ten thousand u/g, and the enzyme activities of the cellulase and the tannase are 1 ten thousand u/g.

3. The method for preparing the compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila according to claim 1, wherein the relation between the dosage of the bacillus fermentation seed liquid and the saccharomycete fermentation seed liquid in the step (3) and the fermentation culture medium is 0.1-9 ml:100g; the total number of viable bacteria of the bacillus and the saccharomycetes is 1.0x10 ⁸ ~2.8×10 ⁹ cfu/mL; the saccharomycete fermentation seed liquid is saccharomyces cerevisiae fermentation seed liquid;

the lactobacillus fermentation seed liquid is Lactobacillus plantarum fermentation seed liquid, lactobacillus fermentum fermentation seed liquid and Lactobacillus rhamnosus fermentation seed liquid, and the total number of viable bacteria is 1.5X10 ⁸ ~3.5×10 ⁹ cfu/mL, wherein the relation between the inoculation amount of the lactobacillus fermentation seed liquid and the fermentation medium is 0.8-5.7 mL:100g;

4. the method for preparing the compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila according to claim 3, wherein the relation between the dosage and the fermentation culture medium of the bacillus fermentation seed liquid and the saccharomycete fermentation seed liquid during inoculation is 2ml:100g.

5. The method for preparing the compound fermentation traditional Chinese medicine feed additive for preventing and treating aeromonas hydrophila according to claim 1, wherein the water content of the fermentation medium in the step (3) is 40% -60%; the fermentation time is 5-20 days, and the fermentation temperature is 24-38 ℃.

6. A compound fermented traditional Chinese medicine feed additive prepared by the method according to any one of claims 1-5.

7. The use of the compound fermented traditional Chinese medicine feed additive according to claim 6 in preparing aquaculture feed for inhibiting aeromonas hydrophila.

8. The use according to claim 7, characterized in that the specific operations are: adding the compound fermented traditional Chinese medicine feed additive into aquatic feed to obtain aquaculture feed; the addition amount of the compound fermented traditional Chinese medicine feed additive accounts for 5% -25% of the weight of the mixed feed.