CN115074444A

CN115074444A - Application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma

Info

Publication number: CN115074444A
Application number: CN202210772486.5A
Authority: CN
Inventors: 单春光; 贾巧静; 王建星; 娄丹
Original assignee: Second Hospital of Hebei Medical University
Current assignee: Second Hospital of Hebei Medical University
Priority date: 2022-06-30
Filing date: 2022-06-30
Publication date: 2022-09-20
Anticipated expiration: 2042-06-30
Also published as: CN115074444B

Abstract

The invention discloses application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma. Experiments show that compared with normal people, the expression level of miR-5189-3p in head and neck squamous cell carcinoma patients is obviously reduced; cell proliferation, migration and invasion experiments show that miR-5189-3p overexpression can inhibit proliferation, migration and invasion of head and neck squamous cell carcinoma cells, and the miR-5189-3p can be applied to diagnosis and treatment of head and neck squamous cell carcinoma and has good clinical application value.

Description

Application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma.

Background

miRNA is a non-coding single-stranded RNA with a length of 19-22 nucleotides. They act by silencing mRNA, thereby regulating gene expression at the post-transcriptional level. The synthesis of miRNA starts with transcription of pri-miRNA from the miRNA coding gene, followed by cleavage of pri-miRNA by RNase iii family member Drosha into pre-miRNA, also miRNA precursors, with hairpin structures of approximately 80bp in length. Finally, pre-miRNA is processed in the cytoplasm to double stranded RNA by RNase iii family member Dicer. One of them is combined with an RNA-silencing complex (RISC) to form a RISC-miRNA complex, and then is combined again to the 3' UTR of mRNA of a target gene to regulate a target. With the recent gradual popularization and deepening of bioinformatics in the field of miRNA, scientists apply bioinformatics software to analyze the mechanism of miRNA, and show that a plurality of miRNA regulation targets are located on tumor regulation factors or pathways closely related to cell canceration, which has important significance for the research of tumor etiology. At present, there are few reports on miRNA biomarkers for diagnosing head and neck squamous cell carcinoma, and a miRNA molecular marker beneficial to diagnosing head and neck squamous cell carcinoma is needed in clinical treatment.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide the application of the biomarker miR-5189-3p in the diagnosis and treatment of head and neck squamous cell carcinoma, so as to realize the diagnosis and treatment of the head and neck squamous cell carcinoma and further improve the life quality and the survival rate of patients.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the invention provides a biomarker for diagnosing head and neck squamous cell carcinoma, wherein the biomarker comprises pri-miR-5189, pre-miR-5189 and miR-5189-3 p.

Further, the biomarker is miR-5189-3 p.

In the present invention, the term "miRNA" has its ordinary meaning in the art, meaning an RNA molecule from a genetic locus that is processed from a transcript that can form a local RNA precursor miRNA structure. Mature mirnas are typically 20, 21, 22, 23, 24, or 25 nucleotides in length, although other numbers of nucleotides may be present, for example 18, 19, 26, or 27 nucleotides.

The miRNA coding sequence has the potential to pair with flanking genomic sequences, placing the mature miRNA within a non-fully paired RNA duplex (also referred to herein as a stem-loop or hairpin structure or pre-miRNA) that serves as an intermediate for miRNA processing from longer precursor transcripts. This processing typically occurs through the sequential action of two specific endonucleases, called Drosha and Dicer, respectively. Drosha produces miRNA precursors (also referred to herein as "pre-mirnas") from primary transcripts (also referred to herein as "pri-mirnas"), which typically fold into hairpin or stem-loop structures. Cleavage of this miRNA precursor using Dicer method can result in a miRNA duplex with one arm of the hairpin or stem-loop structure containing the mature miRNA and the other arm containing a segment of similar size (commonly referred to as miRNA).

In another aspect, the present invention provides the use of a reagent for detecting the expression level of the biomarker in the preparation of a product for diagnosing head and neck squamous cell carcinoma, wherein the reagent comprises an oligonucleotide probe specifically recognizing the biomarker, and a primer specifically amplifying the biomarker.

In the present invention, the term "probe" refers to a nucleic acid fragment corresponding to several bases to several hundreds of bases capable of specifically binding to mRNA, for example, RNA or DNA, etc. Because of the labeling, the presence or absence of a specific mRNA can be confirmed. The probe can be produced in the form of an oligonucleotide (oligonucleotide) probe, a single-stranded dna (single stranded dna) probe, a double-stranded dna (double stranded dna) probe, an RNA probe, or the like. In the present invention, hybridization is performed using a probe complementary to the marker gene, and the expression level of the gene can be diagnosed by whether hybridization is performed or not. The selection of an appropriate probe and hybridization conditions may be changed based on techniques known in the art, and there is no particular limitation in the present invention.

The term "primer" refers to a synthetic oligonucleotide that, upon forming a duplex with a polynucleotide template, is capable of acting as a point of initiation of nucleic acid synthesis and extends from its 3' end along the template to form an extended duplex. The sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide. Typically, the primer is extended by a DNA polymerase. The length of the primer is generally compatible with its use in the synthesis of primer extension products, and is generally between 8 to 100 nucleotides in length, e.g., 10 to 75, 15 to 60, 15 to 40, 18 to 30, 20 to 40, 21 to 50, 22 to 45, 25 to 40, etc. Typical primers may be between 10-50 nucleotides in length, e.g., 15-45, 18-40, 20-30, 21-25, etc., and any length between the stated ranges. In some embodiments, the primer is generally no more than about 10, 12, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, or 70 nucleotides in length.

The primer or probe of the present invention can be chemically synthesized by using a phosphoramidite solid phase support method or other known methods. Such nucleic acid sequences may be modified by a variety of means well known in the art. Non-limiting examples of such variations include methylation, encapsulation, substitution of more than one homolog of the natural nucleotide, and variations between nucleotides, for example, variations to uncharged linkers (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) or charged linkers (e.g., phosphorothioates, phosphorodithioates, etc.).

The present invention includes any art-available method for detecting the expression of the biomarkers. By "detecting expression" is meant determining the miRNA transcript or presence of an intrinsic gene. Methods of detecting miRNA transcripts of the intrinsic genes of the present disclosure include sequencing techniques, nucleic acid hybridization techniques, nucleic acid amplification techniques selected from the group consisting of polymerase chain reaction, reverse transcription polymerase chain reaction, transcription mediated amplification, ligase chain reaction, strand displacement amplification and nucleic acid sequence based amplification, the polymerase chain reaction being real-time fluorescent quantitative PCR.

Many expression detection methods use isolated RNA. The starting material is typically total RNA isolated from a biological sample, e.g. from a tumor or tumor cell line, respectively, and a corresponding normal tissue or cell line. If the source of the RNA is a primary tumor, total RNA can be extracted from frozen or preserved paraffin-embedded and fixed (e.g., formalin-fixed) tissue samples (e.g., pathologist-directed tissue core samples).

General methods for RNA extraction are well known in the art. In particular, RNA isolation can be performed using purification kits, buffer sets and proteases from commercial manufacturers, e.g., TIANGEN, following the manufacturer's instructions. Other commercially available RNA isolation kits include the MASTERPURETM Complete DNA and RNA purification kit (Epicentre, Madison, Wis.) and the Paraffin Block RNA isolation kit (Ambion, Austin, TX.). For example, RNA Stat-60(Tel-Test, Friendshood, TX) can be used to isolate total RNA from tissue samples. For example, total RNA can be isolated from FFPE using a high purity FFPE RNA Microkit, cat # 04823125001(Roche Applied Science, Indianapolis, Ind.). For example, RNA prepared from tumors can be isolated by cesium chloride density gradient centrifugation. In addition, large numbers of tissue samples can be readily processed by using techniques well known to those skilled in the art.

Further, the sample comprises blood or tissue.

In another aspect of the invention, there is provided a product for diagnosing head and neck squamous carcinoma, said product comprising reagents for detecting the level of expression of said biomarkers.

Furthermore, the product comprises a chip, a kit, a nucleic acid membrane strip, RNA-Seq and a high-throughput sequencing platform.

Further, the chip comprises a gene chip comprising oligonucleotide probes for the aforementioned biomarkers for detecting the expression level of the aforementioned biomarkers.

Further, the kit comprises an RNA detection kit comprising reagents for detecting the expression level of the aforementioned biomarkers.

In the present invention, "chip", also referred to as "array", refers to a solid support comprising attached nucleic acid or peptide probes. Arrays typically comprise a plurality of different nucleic acid or peptide probes attached to the surface of a substrate at different known locations. These arrays, also known as "microarrays," can generally be produced using either mechanosynthesis methods or light-guided synthesis methods that incorporate a combination of photolithography and solid-phase synthesis methods. The array may comprise a flat surface, or may be nucleic acids or peptides on beads, gels, polymer surfaces, fibers such as optical fibers, glass, or any other suitable substrate. The array may be packaged in a manner that allows for diagnostic or other manipulation of the fully functional device.

A "microarray" is an ordered array of hybridization array elements, such as polynucleotide probes (e.g., oligonucleotides) or binding agents (e.g., antibodies), on a substrate. The matrix may be a solid matrix, for example, a glass or silica slide, beads, a fiber optic binder, or a semi-solid matrix, for example, a nitrocellulose membrane. The nucleotide sequence may be DNA, RNA or any permutation thereof.

In the present invention, the kit comprises a set of oligonucleotide primers sufficient to detect and/or quantify the intrinsic genes of the present invention. The oligonucleotide primers may be provided in lyophilized or reconstituted form, or may be provided as a set of nucleotide sequences. In one embodiment, the primers are provided in the form of a microplate (microplate), wherein each primer set occupies a well (or wells, as in the case of a replicate) in the microplate. The microplate may further comprise primers sufficient to detect one or more housekeeping genes as described below. The kit may further comprise reagents and instructions sufficient to amplify the expression product of the gene of the invention.

The high-throughput sequencing platform comprises first-generation sequencing, second-generation sequencing and third-generation sequencing, wherein the first-generation sequencing is also called Sanger sequencing and is a sequencing technology utilizing DNA polymerase synthesis reaction, and the first-generation sequencing is a sequencing technology based on a Sanger method; the second generation sequencing is based on massively parallel sequencing technology (MPS), and can simultaneously complete the synthesis of a complementary strand of a sequencing template and the acquisition of sequence data; the third generation sequencing is based on single molecule sequencing and massively parallel sequencing technology.

In another aspect, the invention provides the use of an agent that promotes the biomarkers described above in the preparation of a pharmaceutical composition for the treatment of head and neck squamous cell carcinoma.

In another aspect, the invention provides the use of an agent for promoting the biomarkers described above in the preparation of a medicament for inhibiting proliferation of head and neck squamous cell carcinoma cells.

Preferably, the head and neck squamous carcinoma comprises laryngeal carcinoma, hypopharyngeal carcinoma;

preferably, the head and neck squamous carcinoma cells are cells cultured in vitro;

preferably, the head and neck squamous carcinoma cells comprise laryngeal carcinoma cells cultured in vitro and hypopharyngeal carcinoma cells cultured in vitro.

In another aspect of the invention there is provided a pharmaceutical composition for the treatment of head and neck squamous carcinoma comprising an agent which promotes a biomarker as hereinbefore described.

Further, the pharmaceutical composition also comprises a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier of the present invention includes one or more pharmaceutically acceptable carriers, diluents, fillers, binders and other excipients, and is mainly dependent on the administration mode and the designed dosage form.

Therapeutically inert inorganic or organic carriers known to those skilled in the art include, but are not limited to: lactose, corn starch or derivatives thereof, talc, vegetable oils, waxes, fats, polyols, such as polyethylene glycol, water, sucrose, ethanol, glycerol, and the like, various preservatives, lubricants, dispersants, and flavoring agents. Moisturizers, antioxidants, sweeteners, colorants, stabilizers, salts, buffers and the like may also be added as needed to aid in the stability of the formulation or to aid in the enhancement of the activity or its bioavailability or to produce an acceptable mouthfeel or odor in the case of oral administration, and the formulations that may be used in such compositions may be in the form of their original compounds as such, or optionally in the form of their pharmaceutically acceptable salts. The compositions so formulated may be administered in any suitable manner known to those skilled in the art, as desired. When using pharmaceutical compositions, a safe and effective amount of the drug of the present invention is administered to a human, and the specific dosage will depend on factors such as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.

In another aspect, the present invention provides the use of the biomarker as described above in screening for a candidate drug for the treatment of head and neck squamous cell carcinoma.

Further, the method for screening the candidate drug for treating the head and neck squamous cell carcinoma comprises the following steps: treating the culture system expressing or containing the biomarkers described above with the substance to be screened; detecting the level of expression of the previously described biomarkers in the system; wherein, when the substance to be screened promotes the expression level of the biomarker, the substance to be screened is a candidate drug for treating head and neck squamous cell carcinoma.

Preferably, the head and neck squamous cell carcinoma comprises laryngeal carcinoma, hypopharyngeal carcinoma.

Preferably, the culture system is an in vitro culture system.

The invention also provides application of the biomarker in screening of candidate drugs for inhibiting proliferation of head and neck squamous cell carcinoma cells.

In another aspect, the present invention provides the use of the aforementioned biomarkers in screening for candidate drugs for inhibiting invasion of head and neck squamous cell carcinoma cells.

The invention also provides application of the biomarker in screening of candidate drugs for inhibiting migration of head and neck squamous cell carcinoma.

Preferably, the head and neck squamous carcinoma cells are cells cultured in vitro.

Preferably, the head and neck squamous carcinoma cells comprise laryngeal cancer cells cultured in vitro and hypopharynx cancer cells cultured in vitro.

In another aspect of the present invention, there is provided a method for screening a candidate drug for the treatment of head and neck squamous cell carcinoma, comprising treating a culture system expressing or containing the biomarker as defined above with a substance to be screened; detecting the level of expression of the previously described biomarkers in the system; wherein, when the substance to be screened promotes the expression level of the biomarker, the substance to be screened is a candidate drug for treating head and neck squamous cell carcinoma.

Preferably, the culture system is an in vitro culture system.

According to another aspect of the present invention, there is provided a risk prediction system for head and neck squamous cell carcinoma, comprising an evaluation unit for predicting the risk of the subject suffering from head and neck squamous cell carcinoma based on the expression level of the biomarker.

Further, the judgment method of the evaluation unit is as follows: when the expression level of the biomarker is significantly reduced in a head and neck squamous cell carcinoma tissue sample as compared with that in a normal tissue, it is judged that the subject is at high risk of having the head and neck squamous cell carcinoma.

Further, the judgment method of the evaluation unit is as follows: when the expression level of the biomarker is significantly reduced in the serum of a patient with head and neck squamous cell carcinoma, as compared with the normal human serum, the subject is judged to be at risk of head and neck squamous cell carcinoma.

Further, the risk prediction system further comprises a detection unit for detecting the expression level of the biomarker.

Further, the risk prediction system further comprises a display unit for displaying the conclusion drawn by the evaluation unit.

It should be understood that "system" and "unit" as used herein is a method for distinguishing different components, elements, parts, portions or assemblies at different levels. However, other words may be substituted by other expressions if they accomplish the same purpose.

As will be appreciated by one skilled in the art, the present invention may be embodied as an apparatus, method or computer program product. Accordingly, the present disclosure may be embodied in the form of: may be entirely hardware, entirely software (including firmware, resident software, micro-code, etc.) and in any combination of hardware and software, and may be referred to herein generally as a "unit" or "system".

In the present invention, when a marker is employed to indicate or be a marker of an abnormal process, disease or other condition in an individual, the marker is generally described as being over-expressed or under-expressed as compared to the expression level or value of the marker in the individual that indicates or is a normal process, no disease or other condition. The term can also refer to a value or level of a marker in a biological sample that is greater than the value or level (or range of values or levels) of the marker that is detectable at different stages of a particular disease.

Furthermore, an over-expressed or under-expressed marker may also be referred to as "differentially expressed" or as having a "differential level" or a "differential value" as compared to a "normal" expression level or value for a marker indicative of, or as a marker for, normal progression or absence of a disease or other condition in an individual. Thus, "differential expression" of a marker may also be referred to as a variation in the "normal" expression level of the marker.

The terms "differential marker expression" and "differential expression" are used interchangeably to refer to a marker whose expression is activated to a higher or lower level in a subject with a particular disease, relative to its expression in a normal subject, or relative to its expression in a patient who responds differently to a particular treatment or has a different prognosis. The term also includes markers whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that differentially expressed markers may be activated or inhibited at the nucleic acid level or at the protein level, or may be subject to alternative splicing to produce a different polypeptide product. This difference can be evidenced by a variety of changes including mRNA levels, microrna levels, antisense transcript levels, or other divisions of protein surface expression, secretion, or polypeptides. Differential marker expression may include a comparison of expression between two or more genes or gene products thereof; or a comparison of the ratio of expression between two or more genes or gene products thereof; or even a comparison of the products of two different processes of the same gene, which differ between normal and diseased subjects; or different at different stages of the same disease. Differential expression includes, for example, quantitative and qualitative differences in transient expression patterns or cellular expression patterns in markers between normal and diseased cells or between cells undergoing different disease events or disease stages.

By "differential expression increase" or "upregulation" is meant that gene expression (as measured by RNA expression or protein expression) exhibits an increase of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or more or 1.1-fold, 1.2-fold, 1.4-fold, 1.6-fold, 1.8-fold or more, of the gene relative to a control.

By "differential expression reduction" or "down-regulation" is meant a gene whose expression (as measured by RNA expression or protein expression) exhibits a reduction in gene expression relative to a control of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or less than 1.0-fold, 0.8-fold, 0.6-fold, 0.4-fold, 0.2-fold, 0.1-fold or less.

Drawings

FIG. 1 shows a QPCR graph showing the results of detecting miR-5189-3p expression levels, wherein A: a tissue sample; b: a cell line;

FIG. 2 is a graph showing the results of QPCR measurement of miR-5189-3p expression levels in cells after transfection; wherein A: hep-2; b: FaDu;

FIG. 3 is a graph showing the results of the CCK8 assay; wherein A: hep-2; b: FaDu;

FIG. 4 shows a graph of the results of using the Transwell method to detect the effect of miR-5189-3p expression on the migration/invasion capacity of Hep-2 cells; wherein A: a cell staining pattern; b: a statistical result graph of the invasion; c: a statistical result graph of migration;

FIG. 5 is a graph showing the results of using the Transwell method to detect the effect of miR-5189-3p expression on FaDu cell migration/invasion capacity; wherein A: a cell staining pattern; b: a statistical result graph of the invasion; c: a statistical result graph of migration;

FIG. 6 shows a graph of the results of the cell scratch assay for the effect of miR-5189-3p expression on the migratory capacity of head and neck squamous carcinoma cells, wherein A: hep-2 cell pictures; b: FaDu cell pictures; c: graph of Hep-2 cell statistics; d: graph of FaDu cell statistics.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1QPCR detection of biomarkers associated with head and neck cancer

30 cancer tissue samples and tissue samples beside cancer of throat cancer patients (the distance from the tumor edge is more than or equal to 1.5 centimeters) are collected, and QPCR verification is carried out on miR-5189-3p gene differential expression.

Human laryngeal carcinoma cell line Hep-2, hypopharyngeal carcinoma cell line FaDu and human normal lung bronchial epithelial cell line BEAS-2B in MEM medium containing 10% FBS, 1% P/S (streptomycin) at 37 deg.C and 5% CO ₂ Culturing in an incubator.

1. Tissue sample and cell line RNA extraction

The method adopts MiRcute miRNA Isolation Kit (TIANGEN, DP501, China) to extract RNA of laryngeal cancer tissues, paracarcinoma tissues and head and neck squamous cell carcinoma cell lines, and the extraction method refers to the specification of the MiRcute miRNA Isolation Kit.

2. First strand cDNA Synthesis

Synthesizing a First chain of miRNA cDNA by using MiRcut Plus miRNA First-strand cDNA kit (TIANGEN, KR211, China);

(1) the template RNA and 2 XmiRNA RT Reaction Buffer were thawed and mixed well, and then placed on ice together with miRNA RT Enzyme Mix for use. Each solution was vortexed and mixed well before use, and briefly centrifuged to collect the liquid remaining on the tube wall.

(2) Adding 2 μ g of Total RNA, 10 μ L of 2 × miRNA RT Reaction Buffer, 2 μ L of miRNA RT Enzyme Mix under ice bath condition, and adding RNase-free ddH ₂ O make up to 20. mu.L. The above mixed liquid was gently mixed and the procedure was as follows: 60min at 42 ℃; at 95 ℃ for 3min, the obtained cDNA was subpackaged and stored at-20 ℃ for subsequent experiments.

3. qPCR validation

qPCR validation was performed using miRcute Plus miRNA qPCR kit (SYBR Green) (TIANGEN, FP411, China).

(1) 2 × miRcute Plus miRNA Premix, 50 × ROX Reference Dye and Reverse Primer were thawed at room temperature.

(2) When in use, the 2 XmiRcute Plus miRNA Premix is gently and uniformly mixed by turning upside down to avoid foaming, and is used after being slightly centrifuged.

(3) The reagents were placed on ice and the reaction solution was prepared according to the reaction system of Table 1.

TABLE 1 reaction System

(4) Reaction procedure

95 ℃ for 15 min; 94 ℃, 20 s; 30s at 65 ℃; 72 ℃ for 34 s; 40cycles, 94 ℃, 20 s; 60 ℃ for 34 s. Melting Curve analysis (multimedia/discovery Current Stage)

The specific primers and the primer sequences of the internal reference U6 are synthesized by Tiangen biology, Inc., and the product numbers of the miR-5189-3p upstream and downstream primers are as follows: CD 201-T; u6 upstream and downstream primer cat numbers: CD 201-0145.

4. Results of the experiment

The QPCR result is shown in figure 1, compared with the tissue beside cancer, the expression level of miR-5189-3P in the laryngeal cancer tissue is obviously reduced, and the difference has statistical significance (P is less than 0.05) (figure 1A); compared with normal lung bronchial epithelial cells, the expression level of miR-5189-3P in laryngeal cancer cells and hypopharyngeal cancer cells is remarkably reduced, and the difference has statistical significance (P <0.05) (figure 1B).

Example 2 CCK-8 method for detecting influence of miR-5189-3p on proliferation of head and neck squamous cell carcinoma cells

1. Cell culture

Culturing Hep-2 and FaDu cell lines in 5% CO ₂ The cells were cultured in a 37 ℃ incubator with 10% fetal bovine serum and 1% P/S in all cell culture media. The solution was changed 1 time 2-3 days, and cells were passaged by conventional digestion with 0.25% EDTA-containing trypsin at a ratio of 1: 2.

2. RNA-mimic sequence

miR-5189-3p mim and mim-negative control (miR-NC) used in this example were purchased from Shanghai Ruibo Biotech Ltd. Wherein the miR-NC has no homology with the miR-5189-3p gene sequence. The miR-5189-3p imic sequence is as follows: UGCCAACCGUCAGAGCCCAGA (SEQ ID NO. 1); the mice-negative control has the product number: miR1N 0000001-1-5.

3. Transfection

Cell transfection was performed using the ABclonal hggene transfection reagent and the experiments were divided into 2 groups: a negative control group (Mimic-negative control, miR-NC) and an experimental group (miR-5189-3p mimic).

Before cell transfection, cells planted in a 6-well plate in advance in an incubator are prepared, the transfected cells are washed twice by using serum-free OPTI-MEM transfection solution, 2ml of OPTI-MEM transfection solution is added into each hole, the 6-well plate is placed back to the cell incubator for continuous culture, and the medium contains serum during transfection. Uniformly mixing RNA mimic diluted by using serum-free OPTI-MEM and a HighGene transfection reagent, adding the incubated transfection compound into cells, culturing in an incubator, removing a transfection solution after 4-6 h, replacing a fresh complete culture medium by half, putting the cells back into the incubator for continuous culture, transfecting the cells for 24-48 h, and verifying the expression condition of miR-5189-3p mimic in the cells by adopting qPCR.

4. CCK-8 detection

Hep-2 and FaDu cell lines transfected with miR-5189-3p imic and miR-NC are inoculated in a 96-well plate and are respectively used for detection at detection time points of 0 h, 24h, 48h and 72h, and each group is provided with 5 replicates. After 10. mu.l of CCK8 reagent was added, the 96-well plate was further placed in a cell incubator and incubated for about 2h, and the absorbance value of each well at a wavelength of 450nm was measured with a microplate reader and the data was recorded. And drawing a growth curve according to the average value of the detected OD values.

5. Results

1)QPCR

The QPCR result is shown in figure 2, miR-5189-3P mimic transfected in the head and neck squamous cancer cell line can obviously up-regulate miR-5189-3P expression, and the difference has statistical significance (P is less than 0.05).

2) CCK-8 results

The growth curve results show that the proliferation capacity of the cells of the experimental group after miR-5189-3p mimic transfection is obviously lower than that of the control group (figure 3), and the miR-5189-3p inhibits the proliferation of the head and neck squamous cell carcinoma cells.

Example 3 Transwell method for detecting influence of miR-5189-3p on invasion capacity and migration capacity of head and neck squamous cell carcinoma cells

At the top of the upper chamber of a transwell (Corning Incorporated, USA) with an 8 μm pore size, Matrigel (Solambio, China) was coated for intrusion experiments and not coated for migration experiments. Hep-2 and FaDu cell lines transfected with miR-5189-3p mimic and miR-NC transfect cells in serum-free medium (5X 10) ⁴ One/well) was inoculated in the upper chamber. The bottom chamber was filled with medium containing 10% FBS. After 24h, the upper chamber cells were cleared with a cotton swab. Cells infiltrated and migrated from the lower portion of the filter were fixed with 4% Paraformaldehyde (PFA) for 30 min and stained with 0.2% crystal violet for 15 min. And finally, carrying out image processing on the cells, and randomly selecting 5 fields for cell counting by each filter.

The results are shown in fig. 4 and fig. 5, and the results of Transwell experiments show that the number of migration and invasion cells of the miR-5189-3P imic group is remarkably reduced, which indicates that the migration and invasion capabilities of the cells are remarkably inhibited (P <0.05) compared with the control group, and the miR-5189-3P is related to the migration and invasion of the head and neck squamous cell carcinoma cells.

Example 4 cell scratching method for detecting influence of miR-5189-3p on migration capability of head and neck squamous cell carcinoma cells

Hep-2 and FaDu cell lines transfected with miR-5189-3p imic and miR-NC (5)×10 ⁵ One/well) were added to six-well plates and cultured in medium containing 10% fetal bovine serum to 100% confluence. Then, the cell monolayer was scratched with a 200. mu.L pipette tip and washed 2 times with 1 XPBS buffer. In FBS-free medium, cells were at 37 ℃ with 5% CO ₂ Was incubated in the incubator of (1) for 24 hours. Wound closure was detected under an inverted optical microscope (Axio) and photographed. Wound area was measured using ImageJ software (NIH, USA).

Cell scratching results show that the healing rate of the miR-5189-3P imic transfected group is slower, the migration capability of the cells is obviously inhibited compared with that of a control group (P <0.05), and miR-5189-3P is related to the migration of head and neck squamous cell carcinoma cells (figure 6).

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims, and such changes and modifications as fall within the scope of the invention as claimed.

Sequence listing

<110> second Hospital of Hebei medical university

Application of <120> miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma

<141> 2022-06-30

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ugccaaccgu cagagcccag a 21

Claims

1. A biomarker for diagnosing head and neck squamous carcinoma, wherein the biomarker comprises pri-miR-5189, pre-miR-5189, miR-5189-3 p;

preferably, the biomarker is miR-5189-3 p;

2. Use of a reagent for detecting the level of expression of the biomarker of claim 1 in a sample for the manufacture of a product for diagnosing head and neck squamous cell carcinoma;

preferably, the reagents include oligonucleotide probes that specifically recognize the biomarkers, primers that specifically amplify the biomarkers;

3. The use of claim 2, wherein the sample comprises blood or tissue.

4. A product for diagnosing squamous cell carcinoma of the head and neck comprising a reagent for detecting the expression level of the biomarker of claim 1.

5. The product of claim 4, wherein the product comprises a chip, a kit, a nucleic acid membrane strip, an RNA-Seq, a high throughput sequencing platform;

preferably, the chip comprises a gene chip, the gene chip comprises used for detecting the biomarker expression level of the oligonucleotide probes for the biomarkers;

preferably, the kit comprises an RNA detection kit comprising reagents for detecting the level of expression of the biomarker.

6. Use of an agent that promotes the level of expression of a biomarker according to claim 1, the use comprising any of:

1) the application in preparing the medicine for treating head and neck squamous cell carcinoma;

2) the application in preparing the medicine for inhibiting the proliferation of the head and neck squamous cell carcinoma cells;

3) the application in preparing the medicine for inhibiting the migration of the head and neck squamous cell carcinoma cells;

4) the application in preparing the medicine for inhibiting the invasion of head and neck squamous cell carcinoma cells;

7. A pharmaceutical composition for treating head and neck squamous cell carcinoma, wherein said pharmaceutical composition comprises an agent that promotes the expression level of a biomarker according to claim 1;

preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

8. Use of the biomarker of claim 1, in screening for drugs comprising any of:

1) a candidate drug for the treatment of head and neck squamous cell carcinoma;

2) a candidate drug for inhibiting proliferation of head and neck squamous cell carcinoma;

3) a candidate drug for inhibiting migration of head and neck squamous cell carcinoma cells;

4) a candidate drug for inhibiting invasion of head and neck squamous cell carcinoma cells;

preferably, the method for screening the candidate drug for treating head and neck squamous cell carcinoma comprises the following steps: treating the culture system expressing or containing the biomarker with a substance to be screened; detecting the expression level of said biomarker in said culture system; wherein, when the substance to be screened promotes the expression level of the biomarker, the substance to be screened is a candidate drug for treating head and neck squamous cell carcinoma;

preferably, the head and neck squamous cell carcinoma comprises laryngeal carcinoma, hypopharyngeal carcinoma;

preferably, the head and neck squamous carcinoma cells comprise laryngeal carcinoma cells cultured in vitro, hypopharyngeal carcinoma cells cultured in vitro;

preferably, the culture system is an in vitro culture system.

9. A method for screening candidate drugs for treating head and neck squamous cell carcinoma in vitro, which is characterized in that a substance to be screened is used for treating an in vitro culture system expressing or containing the biomarker; detecting the expression level of said biomarker in said in vitro culture system; wherein, when the substance to be screened promotes the expression level of the biomarker, the substance to be screened is a candidate drug for treating head and neck squamous cell carcinoma;

10. A risk prediction system for head and neck squamous cell carcinoma, characterized in that the risk prediction system comprises an evaluation unit for predicting the risk of the subject suffering from head and neck squamous cell carcinoma according to the expression level of the biomarker of claim 1;

preferably, the evaluation unit has the following judgment method: comparing with normal tissue, if the expression level of the biomarker is obviously reduced in the head and neck squamous cell carcinoma tissue sample, judging that the risk of the subject suffering from the head and neck squamous cell carcinoma is high;

preferably, the evaluation unit has the following judgment method: comparing with normal human serum, the expression level of the biomarker is obviously reduced in the serum of the patient suffering from the head and neck squamous cell carcinoma, and then the risk that the subject suffers from the head and neck squamous cell carcinoma is judged to be high;

preferably, the risk prediction system further comprises a detection unit for detecting the expression level of the biomarker of claim 1;

preferably, the risk prediction system further comprises a display unit for displaying the conclusion drawn by the evaluation unit;