CN115074444B - Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment - Google Patents

Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment Download PDF

Info

Publication number
CN115074444B
CN115074444B CN202210772486.5A CN202210772486A CN115074444B CN 115074444 B CN115074444 B CN 115074444B CN 202210772486 A CN202210772486 A CN 202210772486A CN 115074444 B CN115074444 B CN 115074444B
Authority
CN
China
Prior art keywords
head
mir
expression
neck squamous
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210772486.5A
Other languages
Chinese (zh)
Other versions
CN115074444A (en
Inventor
单春光
贾巧静
王建星
娄丹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Hospital of Hebei Medical University
Original Assignee
Second Hospital of Hebei Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Hospital of Hebei Medical University filed Critical Second Hospital of Hebei Medical University
Priority to CN202210772486.5A priority Critical patent/CN115074444B/en
Publication of CN115074444A publication Critical patent/CN115074444A/en
Application granted granted Critical
Publication of CN115074444B publication Critical patent/CN115074444B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
    • G16B40/10—Signal processing, e.g. from mass spectrometry [MS] or from PCR
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
    • G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
    • G16H50/30—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention discloses application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma. Compared with normal people, the experiment of the invention shows that the expression level of miR-5189-3p in head and neck squamous cell carcinoma patients is obviously reduced; cell proliferation, migration and invasion experiments show that miR-5189-3p overexpression can inhibit proliferation, migration and invasion of head and neck squamous cell carcinoma cells, and the miR-5189-3p can be applied to diagnosis and treatment of head and neck squamous cell carcinoma and has a good clinical application value.

Description

Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment
Technical Field
The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma.
Background
A miRNA is a non-coding single-stranded RNA 19-22 nucleotides in length. They act by silencing mRNA, thereby regulating gene expression at the post-transcriptional level. The synthesis of miRNA is firstly to transcribe pri-miRNA from miRNA coding genes, and then to cleave the pri-miRNA into pre-miRNA with a hairpin structure of which the length is about 80bp by RNase III family member Drosha, which is also miRNA precursor. Finally, pre-mirnas are processed in the cytoplasm by the RNase iii family member Dicer into double stranded RNAs. One of them binds to the RNA silencing complex (RNA-induced silencing complex, RISC) to form a RISC-miRNA complex, which then binds again to the 3' utr of the mRNA of the target gene to regulate the target. Along with the gradual popularization and penetration of recent bioinformatics application in the field of miRNA, scientists analyze the mechanism of miRNA by using bioinformatics software, and display that a plurality of miRNA regulation targets are positioned on tumor regulation factors or paths closely related to cell canceration, which has great significance for researching the etiology of tumors. At present, the report of miRNA biomarkers for head and neck squamous carcinoma diagnosis is rare, and the clinical treatment needs a marker of miRNA molecules which are beneficial to head and neck squamous carcinoma diagnosis.
Disclosure of Invention
Aiming at the defects existing in the prior art, the invention aims to provide application of a biomarker miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment, so as to realize head and neck squamous cell carcinoma diagnosis and treatment and further improve survival quality and survival rate of patients.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
in one aspect, the invention provides a biomarker for diagnosing squamous cell carcinoma of head and neck, wherein the biomarker comprises pri-miR-5189, pre-miR-5189 and miR-5189-3p.
Further, the biomarker is miR-5189-3p.
In the present invention, the term "miRNA" has its ordinary meaning in the art, meaning an RNA molecule from a genetic locus that is processed from a transcript that can form a localized RNA precursor miRNA structure. Mature mirnas are typically 20, 21, 22, 23, 24 or 25 nucleotides in length, although other numbers of nucleotides may also be present, for example 18, 19, 26 or 27 nucleotides.
miRNA coding sequences have the potential to pair with flanking genomic sequences, allowing mature mirnas to be placed within incompletely paired RNA duplex (also referred to herein as stem-loop or hairpin structures or pre-mirnas) that serve as intermediates for miRNA processing from longer precursor transcripts. This processing typically occurs by the sequential action of two specific endonucleases known as Drosha and Dicer, respectively. Drosha produces miRNA precursors (also referred to herein as "pre-mirnas") from primary transcripts (also referred to herein as "pri-mirnas") that typically fold into hairpin or stem-loop structures. Cleavage of this miRNA precursor using the Dicer method can result in a miRNA duplex, one arm of which hairpin or stem-loop structure comprises a mature miRNA and the other arm comprises a segment of similar size (commonly referred to as miRNA).
In another aspect, the invention provides the use of a reagent for detecting the expression level of a biomarker in the manufacture of a product for diagnosing squamous cell carcinoma of the head and neck, the reagent comprising an oligonucleotide probe for specifically recognizing the biomarker and a primer for specifically amplifying the biomarker.
In the present invention, the term "probe" refers to a nucleic acid fragment, such as RNA or DNA, corresponding to several bases to several hundred bases capable of specifically binding mRNA. Being labeled, it is possible to confirm whether or not a specific mRNA is present. The probe can be manufactured in the form of an oligonucleotide (oligonucleotide) probe, a single strand DNA (single stranded DNA) probe, a double strand DNA (double stranded DNA) probe, an RNA probe, or the like. In the present invention, hybridization is performed using a probe complementary to the above-mentioned marker gene, and the expression level of the above-mentioned gene can be diagnosed by whether hybridization is performed. The selection and hybridization conditions for the appropriate probes may be modified based on techniques well known in the art, and are not particularly limited in the present invention.
The term "primer" refers to a synthetic oligonucleotide that, upon formation of a duplex with a polynucleotide template, is capable of acting as a point of initiation of nucleic acid synthesis and extending from its 3' end along the template to form an extended duplex. The sequence of the nucleotides added during extension is determined by the sequence of the template polynucleotide. Typically, the primer is extended by a DNA polymerase. The length of the primer is generally compatible with its use in the synthesis of primer extension products, and is generally between 8 and 100 nucleotides in length, e.g., 10 to 75, 15 to 60, 15 to 40, 18 to 30, 20 to 40, 21 to 50, 22 to 45, 25 to 40, etc. Typical primers may be between 10-50 nucleotides in length, such as 15-45, 18-40, 20-30, 21-25, etc., and any length in between the ranges. In some embodiments, the primer is generally no more than about 10, 12, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, or 70 nucleotides in length.
The primers or probes of the invention may be chemically synthesized using a phosphoramidite solid support method or other well known methods. Such nucleic acid sequences may be deformed by a variety of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of the natural nucleotide, and modifications between nucleotides, for example, modifications to uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoramidate, carbamate, etc.) or charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.).
The invention includes any method useful in the art for detecting expression of the biomarker. "detecting expression" refers to determining the presence or transcript of a miRNA for an intrinsic gene. Methods of detecting miRNA transcripts of the intrinsic genes of the present disclosure include sequencing techniques, nucleic acid hybridization techniques, nucleic acid amplification techniques selected from the group consisting of polymerase chain reaction, reverse transcription polymerase chain reaction, transcription-mediated amplification, ligase chain reaction, strand displacement amplification, and nucleic acid sequence-based amplification, the polymerase chain reaction being real-time fluorescent quantitative PCR.
Many expression detection methods use isolated RNA. The starting material is typically total RNA isolated from a biological sample, e.g. from a tumor or a tumor cell line, respectively, and corresponding normal tissue or cell line. If the source of RNA is a primary tumor, total RNA may be extracted from frozen or preserved paraffin-embedded and fixed (e.g., formalin-fixed) tissue samples (e.g., pathologist-directed tissue core samples).
General methods of RNA extraction are well known in the art. In particular, RNA isolation can be performed using purification kits, buffer kits, and proteases from commercial manufacturers, such as TIANGEN, following the manufacturer's instructions. Other commercially available RNA isolation kits include MASTERPURETM Complete DNA and RNA purification kits (Epicentre, madison, wis.) and Paraffin Block RNA isolation kits (Ambion, austin, TX). For example, RNA Stat-60 (Tel-Test, friends wood, TX) may be used to isolate total RNA from tissue samples. For example, total RNA can be isolated from FFPE using high purity FFPE RNA Microkit, cat No. 04823125001 (Roche Applied Science, indianapolis, ind.). For example, RNA prepared from tumors can be isolated by cesium chloride density gradient centrifugation. In addition, a large number of tissue samples can be readily processed by using techniques well known to those skilled in the art.
Further, the sample includes blood or tissue.
In another aspect, the invention provides a product for diagnosing squamous cell carcinoma of the head and neck, said product comprising reagents for detecting the expression level of said biomarker.
Further, the products include chips, kits, nucleic acid membrane strips, RNA-Seq, high throughput sequencing platforms.
Further, the chip comprises a gene chip comprising oligonucleotide probes for the biomarkers described above for detecting the expression levels of the biomarkers described above.
Further, the kit includes an RNA detection kit including reagents for detecting the expression level of the aforementioned biomarker.
In the present invention, a "chip" is also referred to as an "array" and refers to a solid support comprising attached nucleic acid or peptide probes. The array typically comprises a plurality of different nucleic acid or peptide probes attached to the surface of a substrate at different known locations. These arrays, also known as "microarrays," can generally be produced using mechanical synthesis methods or light-guided synthesis methods that combine a combination of photolithographic methods and solid-phase synthesis methods. The array may comprise a planar surface or may be a bead, gel, polymer surface, fiber such as optical fiber, glass or any other suitable nucleic acid or peptide on a substrate. The array may be packaged in a manner that allows for diagnosis or other manipulation of the fully functional device.
A "microarray" is an ordered arrangement of hybridization array elements, such as polynucleotide probes (e.g., oligonucleotides) or binding agents (e.g., antibodies), on a substrate. The substrate may be a solid substrate, for example, a glass or silica slide, beads, a fiber optic binder, or a semi-solid substrate, for example, a nitrocellulose membrane. The nucleotide sequence may be DNA, RNA or any arrangement thereof.
In the present invention, the kit comprises a set of oligonucleotide primers sufficient to detect and/or quantify the intrinsic genes of the invention. The oligonucleotide primers may be provided in lyophilized or reconstituted form, or may be provided as a set of nucleotide sequences. In one embodiment, the primers are provided in the form of microwells (microplates), wherein each primer set occupies a well (or multiple wells, as in the case of repetition) in the microwell plate. The microplate may further comprise primers sufficient to detect one or more housekeeping genes as described below. The kit may further comprise reagents and instructions sufficient to amplify the expression product of the gene described in the present invention.
The high-throughput sequencing platform comprises first-generation sequencing, second-generation sequencing and third-generation sequencing, wherein the first-generation sequencing is also called Sanger sequencing, is a sequencing technology utilizing a DNA polymerase synthesis reaction, and is a sequencing technology based on a Sanger method; second generation sequencing is based on the large-scale parallel sequencing technique (Massive parallel analysis, MPS) which allows for simultaneous completion of the synthesis of the complementary strand of the sequencing template and the acquisition of sequence data; third generation sequencing is based on single molecule sequencing and large-scale parallel sequencing techniques.
In another aspect, the invention provides the use of an agent that promotes the biomarkers described above in the preparation of a pharmaceutical composition for the treatment of squamous cell carcinoma of the head and neck.
In another aspect, the invention provides the use of an agent that promotes the aforementioned biomarkers in the manufacture of a medicament for inhibiting proliferation of squamous cell carcinoma cells of the head and neck.
In another aspect, the invention provides the use of an agent that promotes the aforementioned biomarkers in the manufacture of a medicament for inhibiting proliferation of squamous cell carcinoma cells of the head and neck.
In another aspect, the invention provides the use of an agent that promotes the aforementioned biomarkers in the manufacture of a medicament for inhibiting proliferation of squamous cell carcinoma cells of the head and neck.
Preferably, the head and neck squamous carcinoma comprises laryngeal carcinoma, hypopharyngeal carcinoma;
preferably, the head and neck squamous carcinoma cells are cells cultured in vitro;
preferably, the head and neck squamous carcinoma cells include in vitro cultured laryngeal carcinoma cells, in vitro cultured hypopharyngeal carcinoma cells.
In another aspect, the invention provides a pharmaceutical composition for treating squamous cell carcinoma of the head and neck, comprising an agent that promotes the aforementioned biomarkers.
Further, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
Pharmaceutically acceptable carriers include one or more pharmaceutically acceptable carriers, diluents, fillers, binders and other excipients, depending primarily on the mode of administration and the designed dosage form.
Therapeutically inert inorganic or organic carriers known to those skilled in the art include (but are not limited to): lactose, corn starch or derivatives thereof, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, sucrose, ethanol, glycerol and the like, various preservatives, lubricants, dispersants, flavoring agents. Moisturizing means, antioxidants, sweeteners, colorants, stabilizers, salts, buffers and the like may also be added as needed to aid stability of the formulation or to aid in enhancing activity or its bioavailability or to impart acceptable mouthfeel or odor in the case of oral administration, and formulations may be used in such compositions in the form of the original compound itself or optionally in the form of a pharmaceutically acceptable salt thereof. The composition so formulated may be administered by any suitable means known to those skilled in the art, as desired. When using pharmaceutical compositions, safe and effective amounts of the agents of the present invention are administered to humans, and the particular dosage should also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner.
In another aspect, the invention provides the use of a biomarker as described above in the screening of candidate drugs for the treatment of squamous cell carcinoma of the head and neck.
Further, the method for screening candidate medicines for treating head and neck squamous cell carcinoma comprises the following steps: treating a culture system expressing or containing the aforementioned biomarker with a substance to be screened; detecting the expression level of the aforementioned biomarker in the system; wherein the substance to be screened is a candidate for treating squamous cell carcinoma of head and neck when the substance to be screened promotes the expression level of the biomarker.
Preferably, the head and neck squamous carcinoma includes laryngeal carcinoma and hypopharyngeal carcinoma.
Preferably, the culture system is an in vitro culture system.
In another aspect, the invention provides the use of the biomarkers described above for screening candidate agents for inhibiting proliferation of squamous cell carcinoma cells of the head and neck.
In another aspect, the invention provides the use of a biomarker as described above in the screening of candidate agents for inhibiting head and neck squamous cell carcinoma cell invasion.
In another aspect, the invention provides the use of the biomarkers described above for screening candidate agents for inhibiting head and neck squamous cell carcinoma cell migration.
Preferably, the head and neck squamous carcinoma cells are cells cultured in vitro.
Preferably, the head and neck squamous carcinoma cells include in vitro cultured laryngeal carcinoma cells, in vitro cultured hypopharyngeal carcinoma cells.
In another aspect, the invention provides a method for screening candidate drugs for treating head and neck squamous cell carcinoma, treating a culture system expressing or containing the biomarker with a substance to be screened; detecting the expression level of the aforementioned biomarker in the system; wherein the substance to be screened is a candidate for treating squamous cell carcinoma of head and neck when the substance to be screened promotes the expression level of the biomarker.
Preferably, the culture system is an in vitro culture system.
In another aspect, the invention provides a risk prediction system for head and neck squamous cell carcinoma, which comprises an evaluation unit, wherein the evaluation unit predicts the risk of the head and neck squamous cell carcinoma of a subject according to the expression level of the biomarker.
Further, the judging method of the evaluating unit is as follows: compared with normal tissues, the expression level of the biomarker is obviously reduced in the head and neck squamous carcinoma tissue sample, so that the risk of the subject for suffering from the head and neck squamous carcinoma is judged to be high.
Further, the judging method of the evaluating unit is as follows: the expression level of the biomarker is significantly reduced in serum of a patient suffering from head and neck squamous cell carcinoma compared with serum of a normal person, and the risk of the subject suffering from the head and neck squamous cell carcinoma is judged.
Further, the risk prediction system further comprises a detection unit for detecting the expression level of the biomarker.
Further, the risk prediction system further comprises a display unit for displaying the conclusion drawn by the evaluation unit.
It will be appreciated that "system," "unit," and "unit," as used herein, is one method for distinguishing between different components, elements, parts, portions, or assemblies of different levels. However, if other words can achieve the same purpose, the words can be replaced by other expressions.
Those skilled in the art will appreciate that the present invention may be implemented as an apparatus, method, or computer program product. Accordingly, the present disclosure may be embodied in the following forms, namely: either entirely hardware, entirely software (including firmware, resident software, micro-code, etc.), or a combination of hardware and software, generally referred to herein as a "unit" or "system.
In the present invention, a marker is generally described as over-expressed or under-expressed when it is employed in an individual to indicate or as a marker of an abnormal course, disease or other condition, as compared to the level or value of expression of the marker in the individual to indicate or as a marker of a normal course, no disease or other condition. The term may also refer to a value or level of a marker in a biological sample that is greater than the value or level (or range of values or levels) of the marker that is detectable at different stages of a particular disease.
In addition, an over-expressed or under-expressed marker may also be referred to as "differentially expressed" or as having a "differential level" or "differential value" as compared to a "normal" expression level or value of the marker that indicates normal progression or absence of a disease or other condition or is a marker of normal progression or absence of a disease or other condition in an individual. Thus, the "differential expression" of a marker may also be referred to as a variation of the "normal" expression level of the marker.
The terms "differential marker expression" and "differential expression" are used interchangeably to refer to expression of a marker that is activated to a higher or lower level in a subject with a particular disease relative to its expression in a normal subject, or relative to its expression in a patient that is differently responsive to a particular treatment or has a different prognosis. The term also includes markers whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that the differentially expressed markers may be activated or inhibited at the nucleic acid level or protein level, or may undergo alternative splicing to produce different polypeptide products. Such differences may be demonstrated by a variety of changes including mRNA levels, microrna levels, antisense transcript levels, or protein surface expression, secretion, or other partitioning of the polypeptide. Differential marker expression may include a comparison of expression between two or more genes or between gene products thereof; or a comparison of the ratio of expression between two or more genes or between their gene products; or even a comparison of two differently processed products of the same gene, which is different between normal and diseased subjects; or different at different stages of the same disease. Differential expression includes, for example, quantitative and qualitative differences in the transient expression pattern or in the cell expression pattern in a marker between normal cells and diseased cells or between cells undergoing different disease events or disease phases.
"differential increase in expression" or "up-regulation" means that the gene expression (as measured by RNA expression or protein expression) shows an increase of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or more or 1.1-fold, 1.2-fold, 1.4-fold, 1.6-fold, 1.8-fold or more relative to a control.
"reduced differential expression" or "down-regulated" means that the gene expression (as measured by RNA expression or protein expression) exhibits at least a 10% or more reduction, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or less than 1.0-fold, 0.8-fold, 0.6-fold, 0.4-fold, 0.2-fold, 0.1-fold or less, of the gene relative to a control.
Drawings
FIG. 1 shows a graph of the results of QPCR detection of miR-5189-3p expression levels, in which A: a tissue sample; b: a cell line;
FIG. 2 shows a graph of the results of QPCR detection of miR-5189-3p expression levels in transfected cells; wherein A: hep-2; b: faDu;
FIG. 3 shows a graph of the results of CCK8 detection; wherein A: hep-2; b: faDu;
FIG. 4 shows a graph of the results of a Transwell assay for the effect of miR-5189-3p expression on the migration/invasion capacity of Hep-2 cells; wherein A: cell staining patterns; b: statistical result graph of invasion; c: a statistical result graph of migration;
FIG. 5 shows a graph of the results of a Transwell assay for the effect of miR-5189-3p expression on FaDu cell migration/invasion capacity; wherein A: cell staining patterns; b: statistical result graph of invasion; c: a statistical result graph of migration;
FIG. 6 shows a graph of the results of testing the effect of miR-5189-3p expression on head and neck squamous cell carcinoma cell migration capacity using a cell scoring method, in which A: hep-2 cell picture; b: faDu cell picture; c: hep-2 cell statistics plot; d: faDu cell statistics plot.
Detailed Description
The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.
Example 1QPCR detection of biomarkers associated with head and neck cancer
Collecting 30 cases of cancer tissue samples and paracancer tissue samples (more than or equal to 1.5 cm away from the edge of the tumor) of laryngeal cancer patients, and carrying out QPCR verification on miR-5189-3p gene differential expression.
Human laryngeal carcinoma cell line Hep-2, hypopharyngeal carcinoma cell line FaDu and human normal lung bronchial epithelial cell line BEAS-2B in MEM medium containing 10% FBS,1% P/S (Green streptomycin) at 37deg.C, 5% CO 2 Culturing in an incubator.
1. Tissue sample and cell line RNA extraction
RNA extraction of laryngeal, paracancerous and head and neck squamous carcinoma cell lines was performed using MiRcute miRNA Isolation Kit (TIANGEN, DP501, china) and described in MiRcute miRNA Isolation Kit.
2. First Strand cDNA Synthesis
The synthesis of the first strand of the miRNA cDNA was performed using the miRcute Plus miRNA First-strand cDNA kit (TIANGEN, KR211, china);
(1) Template RNA, 2X miRNA RT Reaction Buffer were thawed and mixed well, and then placed on ice with miRNA RT Enzyme Mix for use. Before use, each solution was vortexed and mixed well and centrifuged briefly to collect the liquid remaining on the tube wall.
(2) Adding 2 μg Total RNA under ice bath condition, 10 μl 2× miRNA RT Reaction Buffer, 2 μ L miRNA RT Enzyme Mix, and finally adding RNase-free ddH 2 O makes up 20. Mu.L. The above mixed liquid was gently mixed, and the procedure was as follows: 42 ℃ for 60min; the cDNA obtained was sub-packaged at 95℃for 3min and stored at-20℃for subsequent experiments.
3. qPCR validation
qPCR was verified using miRcute Plus miRNA qPCR kit (SYBR Green) (TIANGEN, FP411, china).
(1) 2X miRcute Plus miRNA PreMix, 50X ROX Reference Dye and Reverse Primer were thawed at room temperature.
(2) When in use, the 2X miRcute Plus miRNA PreMix is gently and evenly mixed upside down to avoid foaming, and is used after being slightly centrifuged.
(3) The reagents were placed on ice, and a reaction solution was prepared according to the reaction system of Table 1.
TABLE 1 reaction system
Figure BDA0003724733560000101
(4) Reaction procedure
95 ℃ for 15min;94 ℃ for 20s;65 ℃ for 30s;72 ℃,34s;40cycles,94℃for 20s;60℃for 34s. Melting curve analysis (Melting/Dissociation Curve Stage)
The specific primer and the primer sequence of the internal reference U6 are synthesized by Tiangen biological limited company, and the upstream and downstream primer product numbers of miR-5189-3p are as follows: CD201-T; u6 upstream and downstream primer number: CD201-0145.
4. Experimental results
The QPCR result is shown in FIG. 1, compared with the paracancerous tissue, the miR-5189-3P expression level in the laryngeal cancerous tissue is obviously reduced, and the difference has statistical significance (P < 0.05) (FIG. 1A); the expression level of miR-5189-3P was significantly down-regulated in laryngeal and hypopharyngeal carcinoma cells compared to normal lung bronchial epithelial cells, with differences statistically significant (P < 0.05) (fig. 1B).
Example 2 CCK-8 method for detecting influence of miR-5189-3p on proliferation of head and neck squamous cell carcinoma
1. Cell culture
Hep-2 and FaDu cell lines were cultured in 5% CO 2 Culturing was performed in a constant temperature incubator at 37℃with 10% fetal bovine serum and 1% P/S added to all cell culture media. The cells were passaged 1-time 2-3 days with regular digestion with 0.25% EDTA-containing trypsin at a ratio of 1:2.
2. RNA-mic sequences
miR-5189-3p mic and mic-negative control (miR-NC) used in this example was purchased from Shanghai Ruibo biotechnology Co. Wherein miR-NC has no homology with the sequence of miR-5189-3p gene. The miR-5189-3p mic sequence is as follows: UGCCAACCGUCAGAGCCCAGA (SEQ ID NO. 1); the mic-negative control has the following product number: miR1N0000001-1-5.
3. Transfection
Cell transfection was performed using the HighGene transfection reagent from abclon corporation, dividing the experiment into 2 groups: negative control (miR-5189-3 p mic) and experimental (miR-NC).
Before cell transfection, cells planted in a 6-well plate in advance in an incubator are prepared, after the transfected cells are washed twice by using serum-free OPTI-MEM transfection solution, 2ml of OPTI-MEM transfection solution is added into each well, the 6-well plate is put back into the cell incubator for continuous culture, and serum is contained in the culture medium during transfection. Mixing RNA mimic diluted by serum-free OPTI-MEM and HighGene transfection reagent uniformly, adding the well-incubated transfection complex into cells, culturing in an incubator, discarding the transfection solution after 4-6 hours, replacing the fresh complete medium by half, placing the cells into the incubator for continuous culture, transfecting the cells for 24-48 hours, and adopting qPCR to verify the expression condition of miR-5189-3p mimic in the cells.
4. CCK-8 detection
Hep-2 and FaDu cell lines transfected with miR-5189-3p mimic and miR-NC were inoculated into 96-well plates for detection at detection time points of 0, 24h, 48h and 72h, respectively, and 5 replicates were set for each group. After adding 10. Mu.l of CCK8 reagent, the 96-well plate is placed in a cell culture box to be incubated for about 2 hours, and the absorbance value of each well at the wavelength of 450nm is detected by an enzyme-labeled instrument and the data are recorded. And drawing a growth curve according to the average value of the detected OD values.
5. Results
1)QPCR
The QPCR result is shown in figure 2, miR-5189-3P expression can be obviously up-regulated after miR-5189-3P MIMIC is transfected in the head and neck squamous cell carcinoma cell line, and the difference is statistically significant (P < 0.05).
2) CCK-8 results
The growth curve results show that after the experimental group is transfected with miR-5189-3p MIMIC, the proliferation capacity of cells is obviously lower than that of the control group (figure 3), which indicates that miR-5189-3p inhibits the proliferation of head and neck squamous carcinoma cells.
Example 3 Transwell method for detecting influence of miR-5189-3p on invasion ability and migration ability of head and neck squamous carcinoma cells
Upper roof of transwell (Corning Incorporated, USA) at 8 μm pore sizeIn the section, matrigel (Solarbio, china) was coated for intrusion experiments and Matrigel (Solarbio, china) was not coated for migration experiments. Hep-2 and FaDu cell lines transfected with miR-5189-3p mimic and miR-NC transfected cells in serum-free medium (5X 10) 4 The/hole) is inoculated into the upper chamber. The bottom chamber was filled with medium containing 10% fbs. After 24h, the cells of the upper chamber were cleared with a cotton swab. Cells infiltrated and migrated in the lower part of the filter were fixed with 4% Paraformaldehyde (PFA) for 30 min and stained with 0.2% crystal violet for 15 min. Finally, the cells were image processed, and 5 fields were randomly selected for cell counting per filter.
The results are shown in fig. 4 and 5, and the Transwell experimental results show that the migration and invasion cell number of the transfected miR-5189-3P mic group is obviously reduced, which indicates that the migration and invasion capacity of cells is obviously inhibited (P < 0.05) compared with that of a control group, and the miR-5189-3P is related to the migration and invasion of head and neck squamous carcinoma cells.
Example 4 cell scratch assay for the Effect of miR-5189-3p on head and neck squamous cell carcinoma cell migration
Hep-2 and FaDu cell lines transfected with miR-5189-3p mimic and miR-NC (5X 10) 5 Individual/well) was added to six well plates and incubated in medium containing 10% fetal bovine serum to 100% confluency. Then, the cell monolayer was scratched with a 200. Mu.L pipette tip and washed 2 times with 1 XPBS buffer. In FBS-free medium, cells were incubated at 37℃with 5% CO 2 Is incubated for 24 hours in an incubator. Wound closure was examined under an inverted light microscope (Axio) and photographed. Wound area was measured using ImageJ software (NIH, USA).
Cell scratch results show that the healing rate of the transfected miR-5189-3P mic group is slower, and the migration capacity of cells is obviously inhibited (P < 0.05) compared with that of a control group, and the miR-5189-3P is related to migration of head and neck squamous carcinoma cells (figure 6).
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.
Sequence listing
<110> Hebei university of medical science second hospital
Application of <120> miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment
<141> 2022-06-30
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ugccaaccgu cagagcccag a 21

Claims (8)

1. Application of a reagent for detecting miR-5189-3p expression level in a sample in preparation of a product for diagnosing head and neck cancer.
2. The use of claim 1, wherein the agent comprises a primer that specifically recognizes a miR-5189-3p oligonucleotide probe or specifically amplifies the miR-5189-3p.
3. The use of claim 1, wherein the head and neck cancer comprises laryngeal cancer, hypopharyngeal cancer.
4. The use of claim 1, wherein the sample comprises blood or tissue.
5. Use of an agent that promotes miR-5189-3p expression, the use comprising any one of:
1) Application in preparing medicines for treating head and neck cancer;
2) Application in preparing medicines for inhibiting proliferation of cancer cells of head and neck;
3) Application in preparing medicines for inhibiting head and neck cancer cell migration;
4) Application in preparing medicines for inhibiting invasion of head and neck cancer cells;
the reagent for promoting miR-5189-3p expression is miR-5189-3p mic.
6. The use of claim 5, wherein the head and neck cancer comprises laryngeal cancer, hypopharyngeal cancer.
7. The use of claim 5, wherein the head and neck cancer cells are cells cultured in vitro.
8. The use of claim 5, wherein the head and neck cancer cells comprise in vitro cultured laryngeal cancer cells or in vitro cultured hypopharyngeal cancer cells.
CN202210772486.5A 2022-06-30 2022-06-30 Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment Active CN115074444B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210772486.5A CN115074444B (en) 2022-06-30 2022-06-30 Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210772486.5A CN115074444B (en) 2022-06-30 2022-06-30 Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment

Publications (2)

Publication Number Publication Date
CN115074444A CN115074444A (en) 2022-09-20
CN115074444B true CN115074444B (en) 2023-07-07

Family

ID=83258565

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210772486.5A Active CN115074444B (en) 2022-06-30 2022-06-30 Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment

Country Status (1)

Country Link
CN (1) CN115074444B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107164554A (en) * 2017-07-20 2017-09-15 北京泱深生物信息技术有限公司 Applications of the ASPRV1 as biomarker in larynx squamous carcinoma diagnosis and treatment
WO2017207690A1 (en) * 2016-06-01 2017-12-07 Centre Léon-Bérard Prognostic relevance of mir-422a in head and neck squamous cell carcinoma

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018032062A1 (en) * 2016-08-18 2018-02-22 University Of Technology Sydney Biomarkers of oral, pharyngeal and laryngeal cancers
EP3899043A2 (en) * 2018-12-18 2021-10-27 Hummingbird Diagnostics GmbH Mirnas as biomarkers for parkinson's syndrome
CN110157808A (en) * 2019-06-04 2019-08-23 河北医科大学第二医院 A kind of application of non-coding RNA relevant to larynx squamous carcinoma occurrence and development

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017207690A1 (en) * 2016-06-01 2017-12-07 Centre Léon-Bérard Prognostic relevance of mir-422a in head and neck squamous cell carcinoma
CN107164554A (en) * 2017-07-20 2017-09-15 北京泱深生物信息技术有限公司 Applications of the ASPRV1 as biomarker in larynx squamous carcinoma diagnosis and treatment

Also Published As

Publication number Publication date
CN115074444A (en) 2022-09-20

Similar Documents

Publication Publication Date Title
WO2017156015A2 (en) Micrornas and methods of their use
CN111455059A (en) Application of reagent for detecting and targeting biomarkers in oral squamous cell carcinoma
US9421218B2 (en) Compositions and methods for treatment of melanoma
CN108220446B (en) Application of LINC01356 as molecular marker in gastric cancer
CN112094913B (en) Colorectal cancer biomarker and application thereof
CN107312855B (en) Gene related to laryngeal squamous cell carcinoma and application thereof
CN111172290B (en) MiRNA for diagnosis and treatment of hepatocellular carcinoma
CN108660211B (en) Hepatocellular carcinoma-related biomarker LINC01549 and application thereof
CN111455060A (en) Related biomarker for diagnosing and treating oral squamous cell carcinoma and application
CN111455061A (en) Application of lncRNA biomarker in oral squamous cell carcinoma diagnosis and treatment
CN111440874A (en) Biomarker for diagnosing and treating oral squamous cell carcinoma
CN115074444B (en) Application of miR-5189-3p in head and neck squamous cell carcinoma diagnosis and treatment
CN108165631B (en) Osteosarcoma biomarker SYT12 and application thereof
CN107893119B (en) Application of ZCCHC12 in osteosarcoma
CN108624689B (en) Application of biomarker LINC01451
CN111440875A (en) Biomarker-based diagnosis and use for treating cancer
CN107184983B (en) Diagnosis and treatment target for lung adenocarcinoma
CN111560437A (en) Biomarkers for predicting oral squamous carcinoma and their use in therapy
CN111575381A (en) Novel use of biomarkers
CN111088357A (en) Tumor marker for ESCC and application thereof
CN112813158B (en) MiRNA marker related to myocardial fibrosis disease auxiliary diagnosis and application thereof
CN110592218B (en) Biomarker for diagnosing and treating breast cancer
CN112795644B (en) Application of miRNA biomarker in diagnosis of myocardial fibrosis diseases
CN108384856B (en) Non-coding RNA for regulating and controlling expression of C4B gene and application thereof
CN111394464B (en) Detection reagent for radioactive damage diseases and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant