CN115074349B - Patchouli alcohol synthase mutant and encoding gene and application thereof - Google Patents

Patchouli alcohol synthase mutant and encoding gene and application thereof Download PDF

Info

Publication number
CN115074349B
CN115074349B CN202210683574.8A CN202210683574A CN115074349B CN 115074349 B CN115074349 B CN 115074349B CN 202210683574 A CN202210683574 A CN 202210683574A CN 115074349 B CN115074349 B CN 115074349B
Authority
CN
China
Prior art keywords
glu
leu
val
ala
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210683574.8A
Other languages
Chinese (zh)
Other versions
CN115074349A (en
Inventor
刘敏
陶欣艺
郭姣姣
魏东芝
马昱澍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN202210683574.8A priority Critical patent/CN115074349B/en
Publication of CN115074349A publication Critical patent/CN115074349A/en
Application granted granted Critical
Publication of CN115074349B publication Critical patent/CN115074349B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/002—Preparation of hydrocarbons or halogenated hydrocarbons cyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/0307—Patchoulol synthase (4.2.3.70)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a patchouli alcohol synthase mutant, a coding gene and application thereof, wherein the patchouli alcohol synthase mutant comprises a mutant K136A, K136T, K S, K V formed by mutation of 136 th lysine, a mutant L297V, L297A formed by mutation of 297 th leucine, a mutant C405A, C405T, C S formed by mutation of 405 th cysteine, a mutant R464I formed by mutation of 464 th arginine, a mutant Y525F formed by mutation of 525 th tyrosine and a mutant Y531F formed by mutation of 531 th tyrosine, which are used as templates of wild patchouli alcohol synthase shown in SEQ ID No. 2. The patchouli alcohol synthase is modified by an enzyme engineering means to improve the yield of patchouli alcohol, provides a reference for the modification of terpene synthases, and has important production significance and practical application value.

Description

Patchouli alcohol synthase mutant and encoding gene and application thereof
Technical Field
The invention belongs to the technical field of enzyme engineering, and particularly relates to a patchouli alcohol synthase mutant and a coding gene and application thereof.
Background
Patchouli alcohol is one of the main components of the plant patchouli [ Pogostemon cablin (Blanco) Benth ] of the Labiatae family, is widely accepted for its unique pleasant and durable woody, earthy and camphora smell, and also has various effects of resisting bacteria, resisting inflammation and the like, is a three-membered ring sesquiterpene compound, and has great export potential due to the low production cost of patchouli oil and the high requirements of perfume and cosmetic industries. The amount of patchouli oil used in cosmetics and daily necessities worldwide is up to ten thousand tons each year. Patchouli alcohol biosynthesis is catalyzed by patchouli alcohol synthase, which, like terpene synthases, all contain a similar conserved domain DDXXD (X refers to any amino acid). At present, the catalytic efficiency of patchouli alcohol synthase, the specific stability catalysis of the substrate and the like limit the utilization of patchouli alcohol synthase, so that the patchouli alcohol synthase is modified by means of enzyme engineering to improve the yield of patchouli alcohol, and the patchouli alcohol synthase has important significance and practical application value.
Disclosure of Invention
The invention aims to provide a patchouli alcohol synthase mutant, a coding gene and application thereof, so as to solve the problems of low catalytic efficiency, insufficient substrate specificity and low stability of patchouli alcohol synthase, and low patchouli alcohol yield in the prior art.
In order to solve the technical problems, the invention adopts the following technical scheme:
according to a first aspect of the invention, a patchouli alcohol synthase mutant is provided, wherein the patchouli alcohol synthase mutant comprises a mutant K136A formed by taking wild patchouli alcohol synthase shown as SEQ ID NO.2 as a template and mutating lysine at position 136 into alanine, and the amino acid sequence of the mutant K136A is shown as SEQ ID NO. 3; the 136 th lysine is mutated into a mutant K136T formed by threonine, and the amino acid sequence of the mutant K136T is shown as SEQ ID NO. 4; the 136 th lysine is mutated into a mutant K136S formed by serine, and the amino acid sequence of the mutant K136S is shown as SEQ ID NO. 5; the 136 th lysine is mutated into a mutant K136V formed by valine, and the amino acid sequence of the mutant K136V is shown as SEQ ID NO. 6; a mutant L297V formed by mutating leucine at position 297 into valine, and the amino acid sequence of the mutant L297V is shown as SEQ ID NO. 7; the amino acid sequence of the mutant L297A formed by mutating leucine at position 297 into alanine is shown as SEQ ID NO. 8; mutation of cysteine at 405 to alanine to form mutant C405A, the amino acid sequence of which is shown in SEQ ID NO. 9; mutation of cysteine at 405 to threonine to form mutant C405T with an amino acid sequence shown in SEQ ID NO. 10; mutation of cysteine at 405 to serine forms mutant C405S, the amino acid sequence of which is shown in SEQ ID NO. 11; the 464 th arginine is mutated into a mutant R464I formed by isoleucine, and the amino acid sequence of the mutant R464I is shown as SEQ ID NO. 12; the 525 th tyrosine is mutated into a mutant Y525F formed by phenylalanine, and the amino acid sequence of the mutant Y525F is shown as SEQ ID NO. 13; the 531 rd tyrosine is mutated into phenylalanine mutant Y531F, and the amino acid sequence of the mutant Y531F is shown as SEQ ID NO. 14.
According to a second aspect of the present invention there is provided a gene encoding a patchouli alcohol synthase mutant, the gene encoding an amino acid sequence of any one of the patchouli alcohol synthase mutants as described above.
According to a third aspect of the present invention, there is provided a recombinant genetically engineered bacterium comprising a gene encoding a patchouli alcohol synthase mutant as described above.
Preferably, the recombinant genetically engineered bacterium uses a prokaryotic host cell (such as escherichia coli) or a eukaryotic host cell (such as saccharomyces cerevisiae) as a host bacterium.
According to a fourth aspect of the present invention there is provided the use of a patchouli alcohol synthase mutant as described above for the preparation of patchouli alcohol.
The application comprises the steps of reacting with the patchouli alcohol synthase mutant as a catalyst, and catalyzing farnesyl pyrophosphate cyclization to be carried out in cells to obtain a product containing patchouli alcohol.
The application comprises: the gene encoding the patchouli alcohol synthase mutant as described above was transformed into a host cell, and the cell was cultured, thereby obtaining a product comprising patchouli alcohol.
According to the invention, the product comprises: patchouli alcohol, alpha-quinoene, alpha-guaiacene.
According to a preferred embodiment of the present invention, there is provided a method for producing patchouli alcohol, comprising: expressing genes encoding the patchouli alcohol synthase and mutants thereof by taking saccharomyces cerevisiae as a host to obtain recombinant strains; and then activating the recombinant saccharomyces cerevisiae by a seed culture medium, transferring the activated saccharomyces cerevisiae into a fermentation culture medium, and culturing the saccharomyces cerevisiae at 30 ℃ and 200rpm for 7 days to obtain patchouli alcohol products.
According to the patchouli alcohol synthase mutant, the coding gene and the application thereof, the patchouli alcohol synthase is modified by an enzyme engineering means, so that the catalytic efficiency of the patchouli alcohol synthase mutant is improved, the specificity of the patchouli alcohol synthase mutant to a substrate is enhanced, the stability of the patchouli alcohol synthase mutant is improved, the yield of patchouli alcohol is finally improved, a reference is provided for the modification of terpene synthases, and the patchouli alcohol synthase mutant has important production significance and great practical application value.
Drawings
FIG. 1 is a three-dimensional structure model diagram of PTS enzyme;
FIG. 2 is a plasmid map of pESC-URA-FPTs;
FIG. 3 shows patchouli alcohol yield of the genetically engineered bacterium of example 3 at 7 days of fermentation.
Detailed Description
The invention will be further illustrated with reference to specific examples. It should be understood that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention.
The experimental procedure, which does not specify specific conditions in the following examples, is generally followed by conventional conditions, such as "molecular cloning: the conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) were followed. The primer is synthesized by Jierui bioengineering Co.
For a better understanding of the present invention, a Saccharomyces cerevisiae strain HPT14 (BY 4741 is used as a starting strain to overexpress UPC2-1, tHMG is used as a starting strain to replace the promoter of ERG9 of the strain itself with the promoter of HXT1, and off-path related genes are knocked out, see in particular, LIU M, LINY C, GUO J, et al high-Level Production of Sesquiterpene Patchoulol in Saccharomyces cerevisiae [ J ]. ACS Synth Biol,2021,10 (1): 158-72) modified BY BY4741 is used as a specific example for further explanation.
EXAMPLE 1 construction of three-dimensional Structure model of PTS enzyme
And carrying out homologous modeling on patchouli alcohol synthase by using a homologous modeling tool and using PDB ID 4GAX as a reference model. After model evaluation, a reliable three-dimensional structure model is obtained, and a three-dimensional structure model diagram is shown in fig. 1.
EXAMPLE 2 construction of site-directed mutagenesis library
The PCR technology is utilized, plasmid pESC-URA-FPTs with wild PTS gene expressed is used as template, and specific construction process of the plasmid can be seen in Chinese patent application CN 112175848A, namely patchouli alcohol producing yeast strain and construction method thereof, wherein plasmid map is shown as figure 2, site-directed mutagenesis is carried out on 136 th, 297 th, 405 th, 464 th, 525 th and 531 th positions of PTS enzyme.
The mutant primers were designed, forward and reverse primers were PCR upstream and downstream primers designed according to the different mutation sites, and specific primer information is shown in Table 1.
TABLE 1 primers used to obtain PTS mutants
Primer(s) Primer sequences
K136A-F(SEQ ID NO.15) AGATGGTGCTGATGGTTTTAAAGTTCCTAATGAGGA
K136A-R(SEQ ID NO.16) AACCATCAGCACCATCTTTGAATTTTTCAAAAACTTC
K136T-F(SEQ ID NO.17) AGATGGTACTGATGGTTTTAAAGTTCCTAATGAGGA
K136T-R(SEQ ID NO.18) AACCATCAGTACCATCTTTGAATTTTTCAAAAACTTC
K136S-F(SEQ ID NO.19) AGATGGTTCTGATGGTTTTAAAGTTCCTAATGAGGA
K136S-R(SEQ ID NO.20) AACCATCAGAACCATCTTTGAATTTTTCAAAAACTTC
K136V-F(SEQ ID NO.21) AGATGGTGTTGATGGTTTTAAAGTTCCTAATGAGGA
K136V-R(SEQ ID NO.22) AACCATCAACACCATCTTTGAATTTTTCAAAAACTTC
L297V-F(SEQ ID NO.23) GCAAAAGGTGTTGCTGTTTTGTCACTCATGGATGA
L297V-R(SEQ ID NO.24) ACAGCAACACCTTTTGCCAAAATCATCCTAGC
L297A-F(SEQ ID NO.25) CAAAAGGTGCTGCTGTTTTGTCACTCATGGATGA
L297A-R(SEQ ID NO.26) AACAGCAGCACCTTTTGCCAAAATCATCCTAGC
C405A-F(SEQ ID NO.27) GCAACTAAAACTGCTGGTTATATTACTTTGATTATTTTGTCATGTT
C405A-R(SEQ ID NO.28) CCAGCAGTTTTAGTTGCCAATTTCATATATTCTT
C405T-F(SEQ ID NO.29) GCAACTAAAACTTCAGGTTATATTACTTTGATTATTTTGTCATGTT
C405T-R(SEQ ID NO.30) CCTGAAGTTTTAGTTGCCAATTTCATATATTCTT
C405S-F(SEQ ID NO.31) GCAACTAAAACTTCTGGTTATATTACTTTGATTATTTTGTCATGTT
C405S-R(SEQ ID NO.32) CCAGAAGTTTTAGTTGCCAATTTCATATATTCTT
R464I-F(SEQ ID NO.33) ACATGTTATTACAGCTGTTGAATGTTATATGGAAGAA
R464I-R(SEQ ID NO.34) CAGCTGTAATAACATGTTCCCTTTTCTTCTCAAAT
Y525F-F(SEQ ID NO.35) TTTAAAGAAGGGGATTCTTATACTCATGTTGG
Y525F-R(SEQ ID NO.36) GAATCCCCTTCTTTAAATATAACTTCCAATGTCCTAACAGAATTTAA
Y531F-F(SEQ ID NO.37) GGGGATTCTTTTACTCATGTTGGTCCAGCTATGCA
Y531F-R(SEQ ID NO.38) TGAGTAAAAGAATCCCCTTCTTTGTATATAACTTCC
Wherein K136A-F and K136A-R can be used to obtain mutant K136A;
K136T-F and K136T-R can be used to obtain mutant K136T;
K136S-F and K136S-R can be used to obtain mutant K136S;
K136V-F and K136V-R can be used to obtain mutant K136V;
L297V-F and L297V-R can be used to obtain mutants L297V;
L297A-F and L297A-R can be used to obtain mutant L297A;
C405A-F and C405A-R may be used to obtain mutant C405A;
C405T-F and C405T-R may be used to obtain mutant C405T;
C405S-F and C405S-R may be used to obtain mutant C405S;
R464I-F and R464I-R can be used to obtain mutant R464I;
Y525F-F and Y525F-R can be used to obtain mutant Y525F;
Y531F-F and Y531F-R can be used to obtain mutants Y531F.
According to this example, there is also provided a method for preparing patchouli alcohol synthase mutant comprising the steps of:
PCR amplification is carried out by using a mutation primer and taking plasmid pESC-URA-FPTs as a template to obtain a mutation product, and the mutation product is transformed into a host cell to obtain an expression strain of the patchouli alcohol synthase mutant.
The PCR reaction system is as follows: primeSTAR Max (available from Takara Co.) was added at 25. Mu.L, and 1. Mu.L each of the forward primer, reverse primer, and template DNA, and sterilized water was added at 22. Mu.L.
The ligation reaction was carried out overnight at 50℃and the ligation system: one Step Cloning enzyme 5. Mu.L, sample 5. Mu.L.
10. Mu.L of the whole ligation product was added to competent cells of E.coli DH 5. Alpha. And mixed well, and left on ice for 5min, followed by heat shock of the well mixed bacterial solution and plasmid in a water bath at 42℃for 90s. After the heat shock is completed, the mixture is placed in ice water for 2min, 600 mu L of LB culture medium is added, the mixture is uniformly mixed, and the mixture is resuscitated at 37 ℃ for 45min. The bacterial solution was then spread on LB plates containing ampicillin resistance, and cultured overnight at 37 ℃. Transformants on the plates were picked and sent to the JieRui bioengineering Co.Ltd for sequencing verification.
The target gene fragment gel recycling kit comprises the following specific steps:
(1) The target DNA fragment was separated by agarose nucleic acid electrophoresis, and the agarose gel containing the target fragment was rapidly cleaved.
(2) The cut agarose gel was weighed and then transferred to a clean 1.5mL centrifuge tube, with a melting ratio of 100 μl GDP solution added per 100mg agarose gel, and then the ep tube was placed in a metal bath to melt the gel until it was completely dissolved. After the dissolution was completed, the solution on the cap was centrifuged off, and then the mixed solution was transferred to a HiPure DNA Column column and placed on a collection tube, and centrifuged at 12000rpm for 30s.
(3) The filtrate in the cannula was discarded, and then 300. Mu.L of GDP Buffer was added to the column and left for about 1min, followed by centrifugation at 12000rpm for 30s.
(4) The filtrate was again poured off, 600. Mu.L of DW2 Buffer was added to the column and centrifuged at two thousand rpm for 30s. The filtrate was again poured off and washed again. Of particular note is the dilution of DW2 Buffer with absolute ethanol prior to use.
(5) The filtrate was discarded and the column was returned to the collection tube and centrifuged at 12000rpm for 3 minutes.
(6) The column was placed in a clean 1.5mL centrifuge tube, the lid was opened, and drying was performed for about 10 minutes, in order to remove residual ethanol. After completion, 20-40. Mu.L of double distilled water preheated in advance at 65℃was added and left for about 2min, and centrifuged at 12000rpm for 2min.
(7) The concentration of the solution in a 1.5mL centrifuge tube was determined using Nanodrop and the final DNA solution was stored in a-20℃refrigerator.
Example 3 shake flask fermentation and product determination
Shake flask fermentation of yeast strains the patchouli alcohol synthase and its mutant plasmids constructed in example 2 were transformed into Saccharomyces cerevisiae HPT14, spread onto corresponding defective solid plates, incubated at 30℃for about 3d, single colonies of about 3d size were picked from the corresponding solid medium, activated in 5mL YPD tubes at 30℃for 24h, and transferred to 250mL Erlenmeyer flasks of 20mL YPD in seed medium with an initial OD600 of 0.3, 12-14h. The bacterial liquid in the cultured seed culture medium is transferred into 50mL YPD fermentation culture medium, the initial OD600 is 0.3, the culture is carried out for 7d, and the yield of patchouli alcohol is sampled at a proper time.
YPD, glucose 20g/L, yeast extract 10g/L, peptone 20g/L.
GC analysis of fermentation product:
600. Mu.L of the fermentation broth was mixed with an equal volume of ethyl acetate, 1.5 to 2.0g of grinding beads were added to the crushing tube, ethyl acetate and bacterial liquid were added to the crushing tube, and the mixture was vortexed and oscillated to crush cells using a freeze mill.
The crushing procedure is as follows: the oscillation time is 10min, the oscillation speed is 300Hz, and the cycle number is 3.
The crushed tube 12000rpm was centrifuged for 10min, the solution was in a layered state (crushed again by shaking if not layered), and 500-600. Mu.L of the extract of the organic layer was sucked into the EP tube while anhydrous sodium sulfate was added. Vortex mixing for 3min to remove water, centrifuging at 12000rpm for 10min, and sucking 500 μl of liquid into liquid phase vial for GC detection.
Gas phase detection conditions:
chromatographic column: HP-5 (30m x 0.32mm,0.25 μm, agilent, USA); the temperature of the sample inlet is 250 ℃; programming temperature: the initial temperature of the column temperature is 80 ℃ for 1min, then the temperature is raised to 120 ℃ (10 ℃/min) for 0min, then the temperature is raised to 150 ℃ (3 ℃/min) for 0min, finally the temperature is raised to 270 ℃ (30 ℃/min) for 1min; hydrogen Flame Ionization Detector (FID) temperature: 300 ℃; not split; air flow rate: 400mL/min; hydrogen flow rate: 30mL/min; tail blowing N 2 Air flow rate: 15mL/min; average linear velocity: 31.275cm/s; pressure: 14.54psi; sample injection amount: 1 mul.
Fermentation results of the mutant strains:
as shown in A in FIG. 3, after 7 days of culture, the K136S, K136A, K136T, K V all improved the yield of patchouli alcohol by 32% (132.28 mg/L), 45% (145.53 mg/L), 47% (147.33 mg/L) and 47% (147.80 mg/L), respectively; L297A increases patchouli alcohol yield by 22% (122.03 mg/L); L297V results in a 62% increase in patchouli alcohol yield (162.04 mg/L). C405S, C405A, C T improves patchouli alcohol yield by 27% (127.27 mg/L), 30% (130.96 mg/L) and 60% (160.82 mg/L) respectively; the R464I mutant can catalyze the production of more patchouli alcohol than the wild type, and the yield is improved by about 30 percent (130 mg/L); the Y525F mutant increased patchouli alcohol yield by about 34% (134.99 mg/L), and Y531F increased patchouli alcohol yield by about 48% (148.93 mg/L). Thus, the mutants showed improved patchouli alcohol yield compared to the wild type strain, especially the highest patchouli alcohol yield of mutant L297V among all mutants, followed by mutant C405T.
As shown in FIG. 3B, the yield change of the two major by-products was greater, L297V increased the relative yield of alpha-quinoene by about 2.9-fold, and the relative yield of alpha-guaiacene by about 2.2-fold, as compared to the main product patchouli alcohol.
The foregoing description is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention, and various modifications can be made to the above-described embodiment of the present invention. All simple, equivalent changes and modifications made in accordance with the claims and the specification of the present application fall within the scope of the patent claims. The present invention is not described in detail in the conventional art.
SEQUENCE LISTING
<110> university of Industy of Huadong
<120> patchouli alcohol synthase mutant and encoding gene and application thereof
<160> 38
<170> PatentIn version 3.5
<210> 1
<211> 1659
<212> DNA
<213> Pogostemon cablin (Pogostemon cablin)
<400> 1
atggagttgt atgcccaaag tgttggagtg ggtgctgcct ctcgtcctct tgcgaatttt 60
catcaatgtg tgtggggaga caaattcatt gtgtacaacc cacaatcaag ccaggctgga 120
gagagagaac aggctgagga gctgaaagtg gagctgaaaa gagagctgaa ggaagcatca 180
gacaactaca tgcggcaact gaaaatggtg gatgcaatac aacgattagg cattgactat 240
ctttttgtgg aagatgttga tgaagctttg aagaatctgt ttgaaatgtt tgatgctttc 300
tgcaagaata atcatgacat gcacgccact gctctcagct ttcgccttct aagacaacat 360
ggctatagag tttcatgtga agtttttgaa aagtttaagg atggcaaaga tggatttaag 420
gttccaaatg aggatggagc ggttgcagtc cttgaattct tcgaagccac gcatctcaga 480
gtccatggag aagacgtcct tgataatgct tttgtcttca ctaggaacta cttggaatca 540
gtctatgcaa ctttgaacga tccaaccgcg aatcaagtcc acaacgcatt gaatgagttc 600
tcttttcgaa gaggattgcc acgcgtggaa gcaaggaagt acatatcaat ctacgagcaa 660
tacgcatctc atcacaaagg cttgctcaaa cttgctaagc tggatttcaa cttggtacaa 720
gctttgcaca gaagggagct gagtgaagat tctaggtggt ggaagacttt acaagtgccc 780
acagagctat cattcgttag agatcgattg gtggagtcct acttttgggc ttcgggatct 840
tatttcgaac cgaattattc ggtagctagg atgattttag caaaagggct ggctgtatta 900
tctcttatgg acgatgtgta tgatgcatat ggtacttttg aggaattaca agtgttcaca 960
gatgcaatcg aaaggtggga tgcttcgtgt ttagataaac ttccagagta catgaaaata 1020
gtatacaagg cccttttgga tgtgtttgag gaagttgacg aggaggtgat caagctaggt 1080
gcaccatatc gagtctacta tggaaaagaa gccatgaaat atgccgctag agcttacatg 1140
gaagaggccc aatggaggga gcaaaagcac aaacccacaa ctaaggagta tatgaagctg 1200
gcaacaaaga cctgtggcta tataactcta ataatattat catttcttgg agtggaagag 1260
ggcattgtga ctaaagaagc cttcgattgg gttttctccc gacctccttt cgtcgaggct 1320
acgttaatca ttgctaggct catcaatgat attacaggat gcgagtttga gaacaaacga 1380
gagcacgttc gcactgcagt agaatgctac atggaagagc acaaagtggg aaagcaagag 1440
gtggtgtctg aattctacaa ccaaatggag tcagcatgga aggacataaa tgagtgcctc 1500
ctcagaccag ctgaatttcc aatccctcta cttaatctta ttctcaattc tgtccgaaca 1560
cttgaggtta tttacaaaga gggcgattcc tatacacacg tgggtcctgc aatgcaaaac 1620
atcatcaagc agttgtacct tcaccctgtt ccatattaa 1659
<210> 2
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 2
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 3
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 3
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Ala Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 4
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 4
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Thr Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 5
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 5
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Ser Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 6
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 6
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Val Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 7
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 7
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Val Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 8
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 8
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Ala Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 9
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 9
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Ala Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 10
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 10
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Thr Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 11
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 11
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Ser Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 12
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 12
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Ile
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 13
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 13
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Phe Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 14
<211> 552
<212> PRT
<213> Pogostemon cablin (Pogostemon cablin)
<400> 14
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Phe Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 15
<211> 36
<212> DNA
<213> artificial sequence
<400> 15
agatggtgct gatggtttta aagttcctaa tgagga 36
<210> 16
<211> 37
<212> DNA
<213> artificial sequence
<400> 16
aaccatcagc accatctttg aatttttcaa aaacttc 37
<210> 17
<211> 36
<212> DNA
<213> artificial sequence
<400> 17
agatggtact gatggtttta aagttcctaa tgagga 36
<210> 18
<211> 37
<212> DNA
<213> artificial sequence
<400> 18
aaccatcagt accatctttg aatttttcaa aaacttc 37
<210> 19
<211> 36
<212> DNA
<213> artificial sequence
<400> 19
agatggttct gatggtttta aagttcctaa tgagga 36
<210> 20
<211> 37
<212> DNA
<213> artificial sequence
<400> 20
aaccatcaga accatctttg aatttttcaa aaacttc 37
<210> 21
<211> 36
<212> DNA
<213> artificial sequence
<400> 21
agatggtgtt gatggtttta aagttcctaa tgagga 36
<210> 22
<211> 37
<212> DNA
<213> artificial sequence
<400> 22
aaccatcaac accatctttg aatttttcaa aaacttc 37
<210> 23
<211> 35
<212> DNA
<213> artificial sequence
<400> 23
gcaaaaggtg ttgctgtttt gtcactcatg gatga 35
<210> 24
<211> 32
<212> DNA
<213> artificial sequence
<400> 24
acagcaacac cttttgccaa aatcatccta gc 32
<210> 25
<211> 34
<212> DNA
<213> artificial sequence
<400> 25
caaaaggtgc tgctgttttg tcactcatgg atga 34
<210> 26
<211> 33
<212> DNA
<213> artificial sequence
<400> 26
aacagcagca ccttttgcca aaatcatcct agc 33
<210> 27
<211> 46
<212> DNA
<213> artificial sequence
<400> 27
gcaactaaaa ctgctggtta tattactttg attattttgt catgtt 46
<210> 28
<211> 34
<212> DNA
<213> artificial sequence
<400> 28
ccagcagttt tagttgccaa tttcatatat tctt 34
<210> 29
<211> 46
<212> DNA
<213> artificial sequence
<400> 29
gcaactaaaa cttcaggtta tattactttg attattttgt catgtt 46
<210> 30
<211> 34
<212> DNA
<213> artificial sequence
<400> 30
cctgaagttt tagttgccaa tttcatatat tctt 34
<210> 31
<211> 46
<212> DNA
<213> artificial sequence
<400> 31
gcaactaaaa cttctggtta tattactttg attattttgt catgtt 46
<210> 32
<211> 34
<212> DNA
<213> artificial sequence
<400> 32
ccagaagttt tagttgccaa tttcatatat tctt 34
<210> 33
<211> 37
<212> DNA
<213> artificial sequence
<400> 33
acatgttatt acagctgttg aatgttatat ggaagaa 37
<210> 34
<211> 35
<212> DNA
<213> artificial sequence
<400> 34
cagctgtaat aacatgttcc cttttcttct caaat 35
<210> 35
<211> 32
<212> DNA
<213> artificial sequence
<400> 35
tttaaagaag gggattctta tactcatgtt gg 32
<210> 36
<211> 47
<212> DNA
<213> artificial sequence
<400> 36
gaatcccctt ctttaaatat aacttccaat gtcctaacag aatttaa 47
<210> 37
<211> 35
<212> DNA
<213> artificial sequence
<400> 37
ggggattctt ttactcatgt tggtccagct atgca 35
<210> 38
<211> 36
<212> DNA
<213> artificial sequence
<400> 38
tgagtaaaag aatccccttc tttgtatata acttcc 36

Claims (8)

1. A patchouli alcohol synthase mutant is characterized in that the patchouli alcohol synthase mutant takes wild patchouli alcohol synthase shown as SEQ ID NO.2 as a template, leucine at position 297 is mutated into valine to form mutant L297V, and the amino acid sequence of the mutant L297V is shown as SEQ ID NO. 7.
2. A gene encoding a patchouli alcohol synthase mutant according to claim 1, wherein the encoding gene encodes the amino acid sequence of the patchouli alcohol synthase mutant.
3. A recombinant genetically engineered bacterium comprising a gene encoding the patchouli alcohol synthase mutant as claimed in claim 2.
4. The recombinant genetically engineered bacterium of claim 3, wherein the recombinant genetically engineered bacterium uses escherichia coli or saccharomyces cerevisiae as a host bacterium.
5. Use of the patchouli alcohol synthase mutant according to claim 1 for the preparation of patchouli alcohol.
6. The use according to claim 5, which comprises carrying out a reaction with the patchouli alcohol synthase mutant according to claim 1 as a catalyst, which catalyzes the cyclization of farnesyl pyrophosphate in cells to obtain a product comprising patchouli alcohol.
7. The application of claim 6, wherein the application comprises: transforming the gene encoding the patchouli alcohol synthase mutant according to claim 2 into a host cell, and culturing the cell, thereby obtaining a product comprising patchouli alcohol.
8. The use of claim 7, wherein the product comprises: patchouli alcohol, alpha-quinoene, alpha-guaiacene.
CN202210683574.8A 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof Active CN115074349B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210683574.8A CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210683574.8A CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Publications (2)

Publication Number Publication Date
CN115074349A CN115074349A (en) 2022-09-20
CN115074349B true CN115074349B (en) 2023-11-17

Family

ID=83253185

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210683574.8A Active CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Country Status (1)

Country Link
CN (1) CN115074349B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117987434A (en) * 2024-04-07 2024-05-07 北京未名拾光生物技术有限公司 Patchouli alcohol synthase coding gene and expression system thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206026A (en) * 2018-11-21 2020-05-29 中国科学院上海生命科学研究院 Patchouli alcohol synthase mutant with changed enzyme catalytic specificity and application thereof
CN112175848A (en) * 2020-09-17 2021-01-05 华东理工大学 Patchouli alcohol production yeast strain and construction method and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206026A (en) * 2018-11-21 2020-05-29 中国科学院上海生命科学研究院 Patchouli alcohol synthase mutant with changed enzyme catalytic specificity and application thereof
CN112175848A (en) * 2020-09-17 2021-01-05 华东理工大学 Patchouli alcohol production yeast strain and construction method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
重组大肠杆菌发酵合成广藿香醇;王禹锡 等;食品与发酵工业 *

Also Published As

Publication number Publication date
CN115074349A (en) 2022-09-20

Similar Documents

Publication Publication Date Title
JP4760951B2 (en) Recombinant microorganism having butanol-producing ability and method for producing butanol
RU2723620C2 (en) System, methods and compositions for bioprocessing
KR102121888B1 (en) Recombinant microorganisms and uses therefor
EP3085778B1 (en) Valencene synthase polypeptides, encoding nucleic acid molecules and uses thereof
US10696991B2 (en) Nepetalactol oxidoreductases, nepetalactol synthases, and microbes capable of producing nepetalactone
CN104017794B (en) Method for producing (+)-khusene
CN110484572B (en) Method for increasing yield of saccharomyces cerevisiae nerolidol
CN112280722B (en) Recombinant bacterium for producing optically pure 1, 3-butanediol and application thereof
CN115074349B (en) Patchouli alcohol synthase mutant and encoding gene and application thereof
US20150099283A1 (en) Method for producing patchoulol and 7-epi-alpha-selinene
CN114480512B (en) Application of oxidoreductase and mutant thereof in biosynthesis of nootkatone
CN113444701B (en) Saccharomyces cerevisiae endogenous squalene monooxygenase mutant and application thereof
CN110964708A (en) Bacillus subtilis L-aspartic acid α -decarboxylase mutant and application thereof
CN102533870A (en) Method, enzyme system and recombinant cell for synthesizing isoprene by biological method, and application thereof
Kataoka et al. Gene cloning of an NADPH-dependent menadione reductase from Candida macedoniensis, and its application to chiral alcohol production
CN102892892B (en) The manufacture method of isopropanol and the recombination yeast with isopropanol production capacity
JPWO2014058034A1 (en) Yeast producing ethanol from xylose
US20220325313A1 (en) Biosynthesis of alpha-ionone and beta-ionone
CN112280723A (en) Recombinant bacterium for co-production of 1, 3-propylene glycol and 1, 3-butanediol and application thereof
CN110331173A (en) Application of the phenylpyruvate decarboxylase mutant M538A in biofermentation production benzyl carbinol
CN103540558B (en) A kind of method of biological process synthesis prenol
EP1231266B1 (en) Arabidopsis-origin gdp-4-keto-6-deoxy-d-mannose-3,5-epimerase-4-reductase gene
CN114606212B (en) Coumarin synthase from clematis terniflora, gene, vector and application thereof
CN113481175B (en) Active and stereoselectivity improved olefinic bond reductase mutant and encoding gene and application thereof
CN110295204B (en) Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant