CN115074349A - Patchouli alcohol synthase mutant and coding gene and application thereof - Google Patents

Patchouli alcohol synthase mutant and coding gene and application thereof Download PDF

Info

Publication number
CN115074349A
CN115074349A CN202210683574.8A CN202210683574A CN115074349A CN 115074349 A CN115074349 A CN 115074349A CN 202210683574 A CN202210683574 A CN 202210683574A CN 115074349 A CN115074349 A CN 115074349A
Authority
CN
China
Prior art keywords
glu
leu
val
ala
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210683574.8A
Other languages
Chinese (zh)
Other versions
CN115074349B (en
Inventor
刘敏
陶欣艺
郭姣姣
魏东芝
马昱澍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN202210683574.8A priority Critical patent/CN115074349B/en
Publication of CN115074349A publication Critical patent/CN115074349A/en
Application granted granted Critical
Publication of CN115074349B publication Critical patent/CN115074349B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/002—Preparation of hydrocarbons or halogenated hydrocarbons cyclic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/0307—Patchoulol synthase (4.2.3.70)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a patchouli alcohol synthase mutant and a coding gene and application thereof, wherein the patchouli alcohol synthase mutant comprises mutants K136A, K136T, K136S and K136V formed by mutation of 136 th lysine, mutants L297V and L297A formed by mutation of 297 th leucine, mutants C405A, C405T and C405S formed by mutation of 405 th cysteine, a mutant R464I formed by mutation of 464 th arginine, a mutant Y525F formed by mutation of 525 th tyrosine, and a mutant Y531F formed by mutation of 531 th tyrosine, wherein the wild type patchouli alcohol synthase shown in SEQ ID NO.2 is used as a template. The invention improves patchouli alcohol synthase by an enzyme engineering means to improve the yield of patchouli alcohol, provides reference for the improvement of terpene synthase, and has important production significance and practical application value.

Description

Patchouli alcohol synthase mutant and coding gene and application thereof
Technical Field
The invention belongs to the technical field of enzyme engineering, and particularly relates to a patchouli alcohol synthase mutant and a coding gene and application thereof.
Background
Patchouli alcohol is one of the main components of patchouli (pogostmon cablin (Blanco) Benth.) belonging to the family labiatae, is widely recognized due to its unique pleasant and persistent woody, earthy and camphor odor, has various effects such as antibacterial and anti-inflammatory effects, is a three-membered ring sesquiterpene compound, and has great export potential due to low production cost of patchouli oil and high demand of perfume and cosmetic industries. Patchouli oil is currently used in cosmetics and daily necessities worldwide in quantities of up to ten thousand tons per year. The biosynthesis of patchouli alcohol is catalyzed by patchouli alcohol synthase, which, like terpene synthase, contains a similar conserved domain DDXXD (X denotes any amino acid). At present, the utilization of patchouli alcohol synthase is limited by the catalytic efficiency of the patchouli alcohol synthase, the specific stability catalysis of a substrate and the like, so that the patchouli alcohol synthase is improved by means of enzyme engineering to improve the yield of the patchouli alcohol, and the method has important significance and practical application value.
Disclosure of Invention
The invention aims to provide a patchouli alcohol synthase mutant and a coding gene and application thereof, so as to solve the problems of low catalytic efficiency, insufficient specificity to a substrate and low stability of patchouli alcohol synthase in the prior art, thereby causing low yield of patchouli alcohol.
In order to solve the technical problems, the invention adopts the following technical scheme:
according to the first aspect of the invention, a patchouli alcohol synthase mutant is provided, which comprises a mutant K136A formed by mutating 136 th lysine into alanine by using a wild-type patchouli alcohol synthase shown in SEQ ID No.2 as a template, wherein the amino acid sequence of the mutant is shown in SEQ ID No. 3; the 136 th lysine is mutated into a mutant K136T formed by threonine, and the amino acid sequence of the mutant K136T is shown in SEQ ID NO. 4; the 136 th lysine is mutated into a mutant K136S formed by serine, and the amino acid sequence of the mutant K136S is shown as SEQ ID NO. 5; the 136 th lysine is mutated into a mutant K136V formed by valine, and the amino acid sequence of the mutant is shown as SEQ ID NO. 6; a mutant L297V formed by mutating leucine at position 297 to valine, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 7; a mutant L297A formed by mutating leucine at position 297 to alanine, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 8; the 405 th cysteine is mutated into a mutant C405A formed by alanine, and the amino acid sequence of the mutant C is shown in SEQ ID NO. 9; the 405 th cysteine is mutated into a mutant C405T formed by threonine, and the amino acid sequence of the mutant C is shown in SEQ ID NO. 10; the 405 th cysteine is mutated into a mutant C405S formed by serine, and the amino acid sequence of the mutant C is shown in SEQ ID NO. 11; arginine at position 464 is mutated into a mutant R464I formed by isoleucine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 12; the 525 th tyrosine is mutated into a mutant Y525F formed by phenylalanine, and the amino acid sequence of the mutant is shown as SEQ ID NO. 13; the 531 th tyrosine is mutated into a mutant Y531F formed by phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 14.
According to a second aspect of the present invention, there is provided a gene encoding a patchouli alcohol synthase mutant, the encoding gene encoding an amino acid sequence of any one of the patchouli alcohol synthase mutants described above.
According to a third aspect of the present invention, there is provided a recombinant genetically engineered bacterium comprising a gene encoding a patchouli alcohol synthase mutant as described above.
Preferably, the recombinant genetically engineered bacterium takes prokaryotic host cells (such as escherichia coli) or eukaryotic host cells (such as saccharomyces cerevisiae cells) as host bacteria.
According to a fourth aspect of the present invention, there is provided the use of a patchouli alcohol synthase mutant as described above in the preparation of patchouli alcohol.
The application comprises the step of carrying out reaction by using the patchouli alcohol synthase mutant as a catalyst to catalyze farnesyl pyrophosphate cyclization in cells to obtain a product containing patchouli alcohol.
The application comprises the following steps: the gene encoding the patchouli alcohol synthase mutant as described above is transformed into a host cell, and the cell is cultured, thereby obtaining a product comprising patchouli alcohol.
According to the invention, the product comprises: patchoulic alcohol, alpha-quinoa, alpha-guaialene.
According to a preferred embodiment of the present invention, there is provided a method for producing patchouli alcohol, the specific method comprising: expressing a gene coding the patchouli alcohol synthase and the mutant thereof by taking saccharomyces cerevisiae as a host to obtain a recombinant strain; and activating the recombinant saccharomyces cerevisiae by a seed culture medium, transferring the activated saccharomyces cerevisiae into a fermentation culture medium, culturing at the temperature of 30 ℃ and the rotating speed of 200rpm for 7 days to obtain a patchouli alcohol product.
According to the patchouli alcohol synthase mutant and the coding gene and application thereof provided by the invention, the patchouli alcohol synthase is modified by an enzyme engineering means, so that the catalytic efficiency of the obtained patchouli alcohol synthase mutant is improved, the specificity to a substrate is enhanced, the stability is improved, the yield of patchouli alcohol is finally improved, a reference is provided for the modification of terpene synthase, and the patchouli alcohol synthase mutant has important production significance and important practical application value.
Drawings
FIG. 1 is a model diagram of the three-dimensional structure of PTS enzyme;
FIG. 2 is a plasmid map of pESC-URA-FPTs;
FIG. 3 shows the patchouli alcohol production of the genetically engineered bacteria of example 3 after 7 days of fermentation.
Detailed Description
The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.
The experimental methods without specifying the specific conditions in the following examples are generally performed under conventional conditions, such as molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). The primer is synthesized by Czeri bioengineering GmbH.
For better understanding of the present invention, we will use BY4741 as the original strain to transform a Saccharomyces cerevisiae strain HPT14 (BY 4741 as the original strain to overexpress UPC2-1, tHMG, and HXT1 as the promoter to replace the ERG9 promoter of the strain itself, to knock out the off-path related genes, see in particular LIU M, LINY C, GUO J J J, et al, high-Level Production of Sesquiterpen Patcholol in Saccharomyces cerevisiae [ J ] ACS Synth Biol,2021,10(1):158-72.) as further description of specific examples.
Example 1 creation of PTS enzyme three-dimensional Structure model
The patchouli alcohol synthase was homologously modeled using a homology modeling tool with PDB ID:4GAX as a reference model. After model evaluation, a reliable three-dimensional structure model is obtained, and a three-dimensional structure model diagram is shown in fig. 1.
Example 2 construction of site-directed mutagenesis library
By using PCR technology, the site-directed mutagenesis is carried out on the 136 th, 297 th, 405 th, 464 th, 525 th and 531 th positions of PTS enzyme by taking plasmid pESC-URA-FPTs (the specific construction process of the plasmid can be seen in Chinese patent application CN 112175848A: a patchouli alcohol production yeast strain and the construction method thereof, and the plasmid map is shown in figure 2) expressing wild PTS genes as a template.
Design of mutation primers, forward and reverse primers are PCR upstream and downstream primers designed according to different mutation sites, and specific primer information is shown in Table 1.
TABLE 1 primers used for obtaining PTS mutants
Primer and method for producing the same Primer sequences
K136A-F(SEQ ID NO.15) AGATGGTGCTGATGGTTTTAAAGTTCCTAATGAGGA
K136A-R(SEQ ID NO.16) AACCATCAGCACCATCTTTGAATTTTTCAAAAACTTC
K136T-F(SEQ ID NO.17) AGATGGTACTGATGGTTTTAAAGTTCCTAATGAGGA
K136T-R(SEQ ID NO.18) AACCATCAGTACCATCTTTGAATTTTTCAAAAACTTC
K136S-F(SEQ ID NO.19) AGATGGTTCTGATGGTTTTAAAGTTCCTAATGAGGA
K136S-R(SEQ ID NO.20) AACCATCAGAACCATCTTTGAATTTTTCAAAAACTTC
K136V-F(SEQ ID NO.21) AGATGGTGTTGATGGTTTTAAAGTTCCTAATGAGGA
K136V-R(SEQ ID NO.22) AACCATCAACACCATCTTTGAATTTTTCAAAAACTTC
L297V-F(SEQ ID NO.23) GCAAAAGGTGTTGCTGTTTTGTCACTCATGGATGA
L297V-R(SEQ ID NO.24) ACAGCAACACCTTTTGCCAAAATCATCCTAGC
L297A-F(SEQ ID NO.25) CAAAAGGTGCTGCTGTTTTGTCACTCATGGATGA
L297A-R(SEQ ID NO.26) AACAGCAGCACCTTTTGCCAAAATCATCCTAGC
C405A-F(SEQ ID NO.27) GCAACTAAAACTGCTGGTTATATTACTTTGATTATTTTGTCATGTT
C405A-R(SEQ ID NO.28) CCAGCAGTTTTAGTTGCCAATTTCATATATTCTT
C405T-F(SEQ ID NO.29) GCAACTAAAACTTCAGGTTATATTACTTTGATTATTTTGTCATGTT
C405T-R(SEQ ID NO.30) CCTGAAGTTTTAGTTGCCAATTTCATATATTCTT
C405S-F(SEQ ID NO.31) GCAACTAAAACTTCTGGTTATATTACTTTGATTATTTTGTCATGTT
C405S-R(SEQ ID NO.32) CCAGAAGTTTTAGTTGCCAATTTCATATATTCTT
R464I-F(SEQ ID NO.33) ACATGTTATTACAGCTGTTGAATGTTATATGGAAGAA
R464I-R(SEQ ID NO.34) CAGCTGTAATAACATGTTCCCTTTTCTTCTCAAAT
Y525F-F(SEQ ID NO.35) TTTAAAGAAGGGGATTCTTATACTCATGTTGG
Y525F-R(SEQ ID NO.36) GAATCCCCTTCTTTAAATATAACTTCCAATGTCCTAACAGAATTTAA
Y531F-F(SEQ ID NO.37) GGGGATTCTTTTACTCATGTTGGTCCAGCTATGCA
Y531F-R(SEQ ID NO.38) TGAGTAAAAGAATCCCCTTCTTTGTATATAACTTCC
Wherein, K136A-F and K136A-R can be used for obtaining a mutant K136A;
K136T-F and K136T-R can be used to obtain mutant K136T;
K136S-F and K136S-R can be used to obtain mutant K136S;
K136V-F and K136V-R can be used to obtain mutant K136V;
L297V-F and L297V-R can be used to obtain mutant L297V;
L297A-F and L297A-R can be used to obtain mutant L297A;
C405A-F and C405A-R can be used to obtain mutant C405A;
C405T-F and C405T-R can be used to obtain mutant C405T;
C405S-F and C405S-R can be used to obtain mutant C405S;
R464I-F and R464I-R can be used to obtain a mutant R464I;
Y525F-F and Y525F-R can be used to obtain mutant Y525F;
Y531F-F and Y531F-R can be used to obtain mutant Y531F.
According to this embodiment, there is also provided a method of preparing a patchouli alcohol synthase mutant comprising the steps of:
and carrying out PCR amplification by using a mutation primer and taking the plasmid pESC-URA-FPTs as a template to obtain a mutation product, and transforming the mutation product into a host cell to obtain the expression strain of the patchouli alcohol synthase mutant.
The PCR reaction systems are as follows: PrimeSTAR Max (from Takara) 25. mu.L, each of the forward primer, reverse primer and template DNA 1. mu.L, and sterilized water 22. mu.L was added thereto.
The ligation reaction was performed overnight at 50 ℃ and the ligation system: one Step Cloning enzyme 5. mu.L, sample 5. mu.L.
mu.L of the ligation product was added to the competent cells of E.coli DH 5. alpha. in their entirety, mixed well, and left on ice for 5min, followed by heat shock of the well-mixed suspension with the plasmid in a water bath at 42 ℃ for 90 s. After the heat shock is finished, the mixture is placed in ice water for 2min, 600 mu L of LB culture medium is added, the mixture is uniformly mixed, and the mixture is revived at 37 ℃ for 45 min. Then, the bacterial suspension was applied to LB plates containing ampicillin resistance and cultured overnight at 37 ℃. The transformants on the picked plates were sent to Czeri bioengineering GmbH for sequencing verification.
The kit for recycling the target gene fragment glue comprises the following specific steps:
(1) the DNA fragment of interest is separated by agarose electrophoresis and the agarose gel containing the fragment of interest is rapidly cut.
(2) The excised agarose gels were weighed and then transferred to a clean 1.5mL centrifuge tube, melted at a rate of 100. mu.L GDP solution per 100mg of agarose gel, and then the ep tube was placed in a metal bath to melt the gel until it was completely dissolved. After the dissolution was complete, the solution on the cap was centrifuged off, and the mixed solution was transferred to a HiPure DNA Column and placed on a collection tube and centrifuged at 12000rpm for 30 s.
(3) The filtrate in the cannula was discarded, and then 300. mu.L of GDP Buffer was added to the column, left for about 1min, and centrifuged at 12000rpm for 30 s.
(4) The filtrate was again decanted, 600. mu.L of DW2 Buffer was added to the column and centrifuged for 30s at a speed of ten thousand. The filtrate was decanted again and washed again. It is particularly noted that DW2 Buffer was diluted with absolute ethanol before use.
(5) The filtrate was decanted and the column was returned to the collection tube and centrifuged at 12000rpm for 3 minutes.
(6) The column was placed in a clean 1.5mL centrifuge tube, the lid was opened, and drying was carried out for about 10min in order to remove the residual ethanol. After completion, 20-40. mu.L of double distilled water preheated at 65 ℃ in advance was added and left for about 2min, and centrifuged at 12000rpm for 2 min.
(7) The solution in the 1.5mL centrifuge tube was subjected to concentration determination, concentration measurement was performed using Nanodrop, and the final DNA solution was stored in a-20 ℃ refrigerator.
Example 3 Shake flask fermentation and product determination
Shake flask fermentation of Yeast strains the patchouli alcohol synthase and its mutant plasmids constructed in example 2 were transformed into Saccharomyces cerevisiae HPT14, respectively, spread on corresponding defective solid plates, cultured at 30 ℃ for about 3d, selected from the corresponding solid medium, cultured for about 3d, single colonies were activated in 5mL YPD tubes at 30 ℃ for 24h, and transferred to seed medium 20mL YPD in 250mL conical flasks with initial OD600 of 0.3, 12-14 h. Transferring the bacterial liquid in the cultured seed culture medium into 50mL YPD fermentation medium, culturing for 7d, and sampling the yield of patchouli alcohol at proper time.
YPD, glucose 20g/L, Yeast extract 10g/L and Peptone 20 g/L.
GC analysis of fermentation product:
and (3) taking 600 mu L of the fermentation liquor out of the fermentation liquor, mixing the fermentation liquor with ethyl acetate with the same volume, adding 1.5-2.0 g of grinding beads into a crushing tube, adding ethyl acetate and bacterial liquid into the crushing tube, carrying out vortex oscillation, and carrying out cell crushing by using a freeze grinder.
The crushing procedure is as follows: the oscillation time is 10min, the oscillation speed is 300Hz, and the cycle times are 3 times.
Centrifuging the crushed crushing tube at 12000rpm for 10min, allowing the solution to be in a layered state (if the solution is not layered, shaking again for crushing), and sucking 500-600 μ L of the extract liquid of the organic layer into an EP tube while adding anhydrous sodium sulfate. Vortex mixing for 3min to remove water, centrifuging at 12000rpm for 10min, and sucking 500 μ L liquid into liquid phase vial for GC detection of product content.
Gas phase detection conditions:
a chromatographic column: HP-5(30m x 0.32mm, 0.25 μm, Agilent, USA); the injection port temperature is 250 ℃; temperature programming: the initial temperature of the column temperature is 80 deg.C for 1min, then is increased to 120 deg.C (10 deg.C/min) for 0min, then is increased to 150 deg.C (3 deg.C/min) for 0min, and finally is increased to 270 deg.C (30 deg.C/min) for 1 min; hydrogen Flame Ionization Detector (FID) temperature: 300 ℃; no flow diversion; air flow rate: 400 mL/min; hydrogen flow rate: 30 mL/min; tail blow N 2 Gas flow rate: 15 mL/min; average linear velocity: 31.275 cm/s; pressure: 14.54 psi; sample introduction amount: 1 μ L.
Fermentation results of mutant strains:
as shown in A in figure 3, after 7 days of mutant culture, the yield of patchouli alcohol is improved by K136S, K136A, K136T and K136V, and is respectively improved by 32% (132.28mg/L), 45% (145.53mg/L), 47% (147.33mg/L) and 47% (147.80 mg/L); L297A increased patchouli alcohol yield by 22% (122.03 mg/L); L297V increased patchouli alcohol yield by 62% (162.04 mg/L). The C405S, C405A and C405T all improve the yield of patchouli alcohol by 27% (127.27mg/L), 30% (130.96mg/L) and 60% (160.82mg/L) respectively; the R464I mutant can catalyze to generate more patchouli alcohol than the wild type, and the yield is improved by about 30 percent (130 mg/L); the Y525F mutant improves the yield of patchouli alcohol by about 34% (134.99mg/L), and Y531F improves the yield of patchouli alcohol by about 48% (148.93 mg/L). It can be seen that the mutant has improved patchouli alcohol production compared to the wild type strain, in particular the mutant L297V has the highest patchouli alcohol production among all mutants, followed by mutant C405T.
As shown in fig. 3B, the yields of the two major byproducts varied more than the main product patchouli alcohol, L297V increased the relative yield of α -buchenene by about 2.9-fold and α -guaiene by about 2.2-fold.
The above embodiments are merely preferred embodiments of the present invention, which are not intended to limit the scope of the present invention, and various changes may be made in the above embodiments of the present invention. All simple and equivalent changes and modifications made according to the claims and the content of the specification of the present application fall within the scope of the claims of the present patent application. The invention has not been described in detail in order to avoid obscuring the invention.
SEQUENCE LISTING
<110> university of east China's college of science
<120> patchouli alcohol synthase mutant and coding gene and application thereof
<160> 38
<170> PatentIn version 3.5
<210> 1
<211> 1659
<212> DNA
<213> Pogostemon cablin
<400> 1
atggagttgt atgcccaaag tgttggagtg ggtgctgcct ctcgtcctct tgcgaatttt 60
catcaatgtg tgtggggaga caaattcatt gtgtacaacc cacaatcaag ccaggctgga 120
gagagagaac aggctgagga gctgaaagtg gagctgaaaa gagagctgaa ggaagcatca 180
gacaactaca tgcggcaact gaaaatggtg gatgcaatac aacgattagg cattgactat 240
ctttttgtgg aagatgttga tgaagctttg aagaatctgt ttgaaatgtt tgatgctttc 300
tgcaagaata atcatgacat gcacgccact gctctcagct ttcgccttct aagacaacat 360
ggctatagag tttcatgtga agtttttgaa aagtttaagg atggcaaaga tggatttaag 420
gttccaaatg aggatggagc ggttgcagtc cttgaattct tcgaagccac gcatctcaga 480
gtccatggag aagacgtcct tgataatgct tttgtcttca ctaggaacta cttggaatca 540
gtctatgcaa ctttgaacga tccaaccgcg aatcaagtcc acaacgcatt gaatgagttc 600
tcttttcgaa gaggattgcc acgcgtggaa gcaaggaagt acatatcaat ctacgagcaa 660
tacgcatctc atcacaaagg cttgctcaaa cttgctaagc tggatttcaa cttggtacaa 720
gctttgcaca gaagggagct gagtgaagat tctaggtggt ggaagacttt acaagtgccc 780
acagagctat cattcgttag agatcgattg gtggagtcct acttttgggc ttcgggatct 840
tatttcgaac cgaattattc ggtagctagg atgattttag caaaagggct ggctgtatta 900
tctcttatgg acgatgtgta tgatgcatat ggtacttttg aggaattaca agtgttcaca 960
gatgcaatcg aaaggtggga tgcttcgtgt ttagataaac ttccagagta catgaaaata 1020
gtatacaagg cccttttgga tgtgtttgag gaagttgacg aggaggtgat caagctaggt 1080
gcaccatatc gagtctacta tggaaaagaa gccatgaaat atgccgctag agcttacatg 1140
gaagaggccc aatggaggga gcaaaagcac aaacccacaa ctaaggagta tatgaagctg 1200
gcaacaaaga cctgtggcta tataactcta ataatattat catttcttgg agtggaagag 1260
ggcattgtga ctaaagaagc cttcgattgg gttttctccc gacctccttt cgtcgaggct 1320
acgttaatca ttgctaggct catcaatgat attacaggat gcgagtttga gaacaaacga 1380
gagcacgttc gcactgcagt agaatgctac atggaagagc acaaagtggg aaagcaagag 1440
gtggtgtctg aattctacaa ccaaatggag tcagcatgga aggacataaa tgagtgcctc 1500
ctcagaccag ctgaatttcc aatccctcta cttaatctta ttctcaattc tgtccgaaca 1560
cttgaggtta tttacaaaga gggcgattcc tatacacacg tgggtcctgc aatgcaaaac 1620
atcatcaagc agttgtacct tcaccctgtt ccatattaa 1659
<210> 2
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 2
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 3
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 3
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Ala Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 4
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 4
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Thr Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 5
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 5
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Ser Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 6
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 6
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Val Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 7
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 7
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Val Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 8
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 8
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Ala Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 9
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 9
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Ala Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 10
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 10
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Thr Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 11
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 11
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Ser Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 12
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 12
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Ile
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 13
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 13
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Phe Lys Glu Gly
515 520 525
Asp Ser Tyr Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 14
<211> 552
<212> PRT
<213> Pogostemon cablin
<400> 14
Met Glu Leu Tyr Ala Gln Ser Val Gly Val Gly Ala Ala Ser Arg Pro
1 5 10 15
Leu Ala Asn Phe His Gln Cys Val Trp Gly Asp Lys Phe Ile Val Tyr
20 25 30
Asn Pro Gln Ser Ser Gln Ala Gly Glu Arg Glu Gln Ala Glu Glu Leu
35 40 45
Lys Val Glu Leu Lys Arg Glu Leu Lys Glu Ala Ser Asp Asn Tyr Met
50 55 60
Arg Gln Leu Lys Met Val Asp Ala Ile Gln Arg Leu Gly Ile Asp Tyr
65 70 75 80
Leu Phe Val Glu Asp Val Asp Glu Ala Leu Lys Asn Leu Phe Glu Met
85 90 95
Phe Asp Ala Phe Cys Lys Asn Asn His Asp Met His Ala Thr Ala Leu
100 105 110
Ser Phe Arg Leu Leu Arg Gln His Gly Tyr Arg Val Ser Cys Glu Val
115 120 125
Phe Glu Lys Phe Lys Asp Gly Lys Asp Gly Phe Lys Val Pro Asn Glu
130 135 140
Asp Gly Ala Val Ala Val Leu Glu Phe Phe Glu Ala Thr His Leu Arg
145 150 155 160
Val His Gly Glu Asp Val Leu Asp Asn Ala Phe Val Phe Thr Arg Asn
165 170 175
Tyr Leu Glu Ser Val Tyr Ala Thr Leu Asn Asp Pro Thr Ala Asn Gln
180 185 190
Val His Asn Ala Leu Asn Glu Phe Ser Phe Arg Arg Gly Leu Pro Arg
195 200 205
Val Glu Ala Arg Lys Tyr Ile Ser Ile Tyr Glu Gln Tyr Ala Ser His
210 215 220
His Lys Gly Leu Leu Lys Leu Ala Lys Leu Asp Phe Asn Leu Val Gln
225 230 235 240
Ala Leu His Arg Arg Glu Leu Ser Glu Asp Ser Arg Trp Trp Lys Thr
245 250 255
Leu Gln Val Pro Thr Glu Leu Ser Phe Val Arg Asp Arg Leu Val Glu
260 265 270
Ser Tyr Phe Trp Ala Ser Gly Ser Tyr Phe Glu Pro Asn Tyr Ser Val
275 280 285
Ala Arg Met Ile Leu Ala Lys Gly Leu Ala Val Leu Ser Leu Met Asp
290 295 300
Asp Val Tyr Asp Ala Tyr Gly Thr Phe Glu Glu Leu Gln Val Phe Thr
305 310 315 320
Asp Ala Ile Glu Arg Trp Asp Ala Ser Cys Leu Asp Lys Leu Pro Glu
325 330 335
Tyr Met Lys Ile Val Tyr Lys Ala Leu Leu Asp Val Phe Glu Glu Val
340 345 350
Asp Glu Glu Val Ile Lys Leu Gly Ala Pro Tyr Arg Val Tyr Tyr Gly
355 360 365
Lys Glu Ala Met Lys Tyr Ala Ala Arg Ala Tyr Met Glu Glu Ala Gln
370 375 380
Trp Arg Glu Gln Lys His Lys Pro Thr Thr Lys Glu Tyr Met Lys Leu
385 390 395 400
Ala Thr Lys Thr Cys Gly Tyr Ile Thr Leu Ile Ile Leu Ser Phe Leu
405 410 415
Gly Val Glu Glu Gly Ile Val Thr Lys Glu Ala Phe Asp Trp Val Phe
420 425 430
Ser Arg Pro Pro Phe Val Glu Ala Thr Leu Ile Ile Ala Arg Leu Ile
435 440 445
Asn Asp Ile Thr Gly Cys Glu Phe Glu Asn Lys Arg Glu His Val Arg
450 455 460
Thr Ala Val Glu Cys Tyr Met Glu Glu His Lys Val Gly Lys Gln Glu
465 470 475 480
Val Val Ser Glu Phe Tyr Asn Gln Met Glu Ser Ala Trp Lys Asp Ile
485 490 495
Asn Glu Cys Leu Leu Arg Pro Ala Glu Phe Pro Ile Pro Leu Leu Asn
500 505 510
Leu Ile Leu Asn Ser Val Arg Thr Leu Glu Val Ile Tyr Lys Glu Gly
515 520 525
Asp Ser Phe Thr His Val Gly Pro Ala Met Gln Asn Ile Ile Lys Gln
530 535 540
Leu Tyr Leu His Pro Val Pro Tyr
545 550
<210> 15
<211> 36
<212> DNA
<213> Artificial sequence
<400> 15
agatggtgct gatggtttta aagttcctaa tgagga 36
<210> 16
<211> 37
<212> DNA
<213> Artificial sequence
<400> 16
aaccatcagc accatctttg aatttttcaa aaacttc 37
<210> 17
<211> 36
<212> DNA
<213> Artificial sequence
<400> 17
agatggtact gatggtttta aagttcctaa tgagga 36
<210> 18
<211> 37
<212> DNA
<213> Artificial sequence
<400> 18
aaccatcagt accatctttg aatttttcaa aaacttc 37
<210> 19
<211> 36
<212> DNA
<213> Artificial sequence
<400> 19
agatggttct gatggtttta aagttcctaa tgagga 36
<210> 20
<211> 37
<212> DNA
<213> Artificial sequence
<400> 20
aaccatcaga accatctttg aatttttcaa aaacttc 37
<210> 21
<211> 36
<212> DNA
<213> Artificial sequence
<400> 21
agatggtgtt gatggtttta aagttcctaa tgagga 36
<210> 22
<211> 37
<212> DNA
<213> Artificial sequence
<400> 22
aaccatcaac accatctttg aatttttcaa aaacttc 37
<210> 23
<211> 35
<212> DNA
<213> Artificial sequence
<400> 23
gcaaaaggtg ttgctgtttt gtcactcatg gatga 35
<210> 24
<211> 32
<212> DNA
<213> Artificial sequence
<400> 24
acagcaacac cttttgccaa aatcatccta gc 32
<210> 25
<211> 34
<212> DNA
<213> Artificial sequence
<400> 25
caaaaggtgc tgctgttttg tcactcatgg atga 34
<210> 26
<211> 33
<212> DNA
<213> Artificial sequence
<400> 26
aacagcagca ccttttgcca aaatcatcct agc 33
<210> 27
<211> 46
<212> DNA
<213> Artificial sequence
<400> 27
gcaactaaaa ctgctggtta tattactttg attattttgt catgtt 46
<210> 28
<211> 34
<212> DNA
<213> Artificial sequence
<400> 28
ccagcagttt tagttgccaa tttcatatat tctt 34
<210> 29
<211> 46
<212> DNA
<213> Artificial sequence
<400> 29
gcaactaaaa cttcaggtta tattactttg attattttgt catgtt 46
<210> 30
<211> 34
<212> DNA
<213> Artificial sequence
<400> 30
cctgaagttt tagttgccaa tttcatatat tctt 34
<210> 31
<211> 46
<212> DNA
<213> Artificial sequence
<400> 31
gcaactaaaa cttctggtta tattactttg attattttgt catgtt 46
<210> 32
<211> 34
<212> DNA
<213> Artificial sequence
<400> 32
ccagaagttt tagttgccaa tttcatatat tctt 34
<210> 33
<211> 37
<212> DNA
<213> Artificial sequence
<400> 33
acatgttatt acagctgttg aatgttatat ggaagaa 37
<210> 34
<211> 35
<212> DNA
<213> Artificial sequence
<400> 34
cagctgtaat aacatgttcc cttttcttct caaat 35
<210> 35
<211> 32
<212> DNA
<213> Artificial sequence
<400> 35
tttaaagaag gggattctta tactcatgtt gg 32
<210> 36
<211> 47
<212> DNA
<213> Artificial sequence
<400> 36
gaatcccctt ctttaaatat aacttccaat gtcctaacag aatttaa 47
<210> 37
<211> 35
<212> DNA
<213> Artificial sequence
<400> 37
ggggattctt ttactcatgt tggtccagct atgca 35
<210> 38
<211> 36
<212> DNA
<213> Artificial sequence
<400> 38
tgagtaaaag aatccccttc tttgtatata acttcc 36

Claims (8)

1. A patchouli alcohol synthase mutant is characterized in that the patchouli alcohol synthase mutant comprises a wild patchouli alcohol synthase shown in SEQ ID NO.2 as a template,
the 136 th lysine is mutated into a mutant K136A formed by alanine, and the amino acid sequence of the mutant K136A is shown in SEQ ID NO. 3;
the 136 th lysine is mutated into a mutant K136T formed by threonine, and the amino acid sequence of the mutant K136T is shown in SEQ ID NO. 4;
the 136 th lysine is mutated into a mutant K136S formed by serine, and the amino acid sequence of the mutant K136S is shown as SEQ ID NO. 5;
the 136 th lysine is mutated into a mutant K136V formed by valine, and the amino acid sequence of the mutant is shown as SEQ ID NO. 6;
a mutant L297V formed by mutating leucine at position 297 to valine, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 7;
a mutant L297A formed by mutating leucine at position 297 to alanine, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 8;
the 405 th cysteine is mutated into a mutant C405A formed by alanine, and the amino acid sequence of the mutant C is shown in SEQ ID NO. 9;
a mutant C405T formed by mutating 405 th cysteine into threonine, wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 10;
the 405 th cysteine is mutated into a mutant C405S formed by serine, and the amino acid sequence of the mutant C is shown in SEQ ID NO. 11;
arginine at position 464 is mutated into a mutant R464I formed by isoleucine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 12;
the 525 th tyrosine is mutated into a mutant Y525F formed by phenylalanine, and the amino acid sequence of the mutant is shown as SEQ ID NO. 13;
the 531 th tyrosine is mutated into a mutant Y531F formed by phenylalanine, and the amino acid sequence of the mutant is shown in SEQ ID NO. 14.
2. A coding gene of a patchouli alcohol synthase mutant, wherein the coding gene encodes the amino acid sequence of any one of the patchouli alcohol synthase mutants of claim 1.
3. A recombinant genetically engineered bacterium comprising a gene encoding the patchouli alcohol synthase mutant according to claim 2.
4. The recombinant genetically engineered bacterium of claim 3, wherein the recombinant genetically engineered bacterium uses Escherichia coli or Saccharomyces cerevisiae as a host bacterium.
5. Use of the patchouli alcohol synthase mutant according to claim 1 for the preparation of patchouli alcohol.
6. The use as claimed in claim 5, wherein the use comprises reacting the mutant patchouli alcohol synthase of claim 1 as a catalyst to catalyze the cyclization of farnesyl pyrophosphate in cells to obtain a product comprising patchouli alcohol.
7. The application of claim 6, wherein the application comprises: transforming the gene encoding the patchouli alcohol synthase mutant according to claim 2 into a host cell, and culturing the cell, thereby obtaining a product comprising patchouli alcohol.
8. The use of claim 7, wherein the product comprises: patchoulic alcohol, alpha-bulen, alpha-guaiene.
CN202210683574.8A 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof Active CN115074349B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210683574.8A CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210683574.8A CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Publications (2)

Publication Number Publication Date
CN115074349A true CN115074349A (en) 2022-09-20
CN115074349B CN115074349B (en) 2023-11-17

Family

ID=83253185

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210683574.8A Active CN115074349B (en) 2022-06-17 2022-06-17 Patchouli alcohol synthase mutant and encoding gene and application thereof

Country Status (1)

Country Link
CN (1) CN115074349B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117987434A (en) * 2024-04-07 2024-05-07 北京未名拾光生物技术有限公司 Patchouli alcohol synthase coding gene and expression system thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206026A (en) * 2018-11-21 2020-05-29 中国科学院上海生命科学研究院 Patchouli alcohol synthase mutant with changed enzyme catalytic specificity and application thereof
CN112175848A (en) * 2020-09-17 2021-01-05 华东理工大学 Patchouli alcohol production yeast strain and construction method and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111206026A (en) * 2018-11-21 2020-05-29 中国科学院上海生命科学研究院 Patchouli alcohol synthase mutant with changed enzyme catalytic specificity and application thereof
CN112175848A (en) * 2020-09-17 2021-01-05 华东理工大学 Patchouli alcohol production yeast strain and construction method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
王禹锡 等: "重组大肠杆菌发酵合成广藿香醇", 食品与发酵工业 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117987434A (en) * 2024-04-07 2024-05-07 北京未名拾光生物技术有限公司 Patchouli alcohol synthase coding gene and expression system thereof

Also Published As

Publication number Publication date
CN115074349B (en) 2023-11-17

Similar Documents

Publication Publication Date Title
JP4760951B2 (en) Recombinant microorganism having butanol-producing ability and method for producing butanol
US10000749B2 (en) Valencene synthase polypeptides, encoding nucleic acid molecules and uses thereof
CN104017794B (en) Method for producing (+)-khusene
JP4700617B2 (en) Sesquiterpene synthase from patchouli
CN113755354B (en) Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof
CN115074349B (en) Patchouli alcohol synthase mutant and encoding gene and application thereof
CN111004763A (en) Engineering bacterium for producing β -caryophyllene and construction method and application thereof
CN111593014B (en) Method for co-production of 1, 3-propylene glycol and D-1,2, 4-butanetriol
CN114591923B (en) Cannabidiol synthetase mutant and construction method and application thereof
CN114262702B (en) Application of ergothioneine synthesis gene in reconstructing ergothioneine metabolic pathway in corynebacterium glutamicum and method thereof
CN114480512B (en) Application of oxidoreductase and mutant thereof in biosynthesis of nootkatone
CN111424020A (en) Epimedium-derived galactosyltransferase and application thereof in preparation of hyperoside
CN113444701B (en) Saccharomyces cerevisiae endogenous squalene monooxygenase mutant and application thereof
CN110331173B (en) Application of phenylpyruvic acid decarboxylase mutant M538A in production of phenethyl alcohol through biological fermentation
CN111032875B (en) Use of type III polyketide synthases as phloroglucinol synthases
CN114277024B (en) Novel triterpene synthase and application thereof
CN114164129B (en) Recombinant pichia pastoris for heterologously expressing myrosinase and application of recombinant pichia pastoris in preparation of sulforaphane
CN113604444B (en) Carboxylic acid reductase mutant with improved catalytic activity, encoding gene thereof, genetically engineered bacterium and application
CN113265391B (en) Linalool synthase CcLS and coding gene and application thereof
CN110004129A (en) A kind of β-glucosidase mutants and its application
WO2021032159A1 (en) Blumea balsamifera monoterpene synthase bbtps3 and related biological materials thereof and use thereof
CN111849937B (en) Sichuan mulberry N-acetyl-5 hydroxytryptamine transferase SNAT5 and application thereof
CN103540558B (en) A kind of method of biological process synthesis prenol
CN111647589A (en) Euphorbia dienol synthase and coding gene and application thereof
CN114606212B (en) Coumarin synthase from clematis terniflora, gene, vector and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant