CN114989995B - Hansenula polymorpha HX17 strain with grape juice and application thereof - Google Patents
Hansenula polymorpha HX17 strain with grape juice and application thereof Download PDFInfo
- Publication number
- CN114989995B CN114989995B CN202210429351.9A CN202210429351A CN114989995B CN 114989995 B CN114989995 B CN 114989995B CN 202210429351 A CN202210429351 A CN 202210429351A CN 114989995 B CN114989995 B CN 114989995B
- Authority
- CN
- China
- Prior art keywords
- wine
- hansenula polymorpha
- fermentation
- strain
- grape juice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G1/00—Preparation of wine or sparkling wine
- C12G1/02—Preparation of must from grapes; Must treatment and fermentation
- C12G1/0203—Preparation of must from grapes; Must treatment and fermentation by microbiological or enzymatic treatment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G2200/00—Special features
- C12G2200/05—Use of particular microorganisms in the preparation of wine
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly relates to Hansenula polymorpha HX17 strain of grape juice and application thereof in grape wine brewing. The invention obtains a yeast strain which has strong alcohol producing capability and can produce aroma substances such as esters, namely Hansenula polymorpha HX17. The wine obtained by fermenting the saccharomycete has excellent quality, strong alcohol producing capacity, alcohol content up to about 14%, pH value of about 3.4, fragrant smell, rich ester smell and capacity of producing specific fragrant matters, such as 3-methyl-2-butanol, 2-hexadecanol, 2-ethyl phenylacetate, ethyl nonanoate, heptyl formate, etc. and attracts the attention of taste. Has important significance for improving the taste of the wine and the quality of the wine.
Description
Technical field:
the invention belongs to the technical field of biology, and particularly relates to Hansenula polymorpha HX17 strain of grape juice and application thereof in grape wine brewing.
The background technology is as follows:
in the process of wine brewing, yeasts play a very important role. Industrial fermentation of wine tends to use s.cerevisiae to ensure that fermentation of wine proceeds smoothly, but also reduces the flavour diversity of wine to some extent. With the recent deepening of knowledge of non-saccharomyces cerevisiae in improving the quality of wine aroma, taste, color, etc., more and more non-saccharomyces cerevisiae is applied to wine fermentation.
It is found that many non-Saccharomyces cerevisiae can produce a large amount of metabolites such as glycerin and esters, and can also produce glycosidase which is favorable for the hydrolysis of fragrance precursors and release of free fragrance components, and has important effects on the flavor formation of wine, but also has the defects of weak ethanol resistance, low fermentation performance and the like. Therefore, the method for screening the non-saccharomyces cerevisiae with good aroma producing capability and a certain alcohol producing capability for fermenting the wine is an effective method for avoiding homogenization of the product and obtaining high-quality wine.
In view of this, the present invention has been made.
The invention comprises the following steps:
the invention aims to provide non-saccharomyces cerevisiae with good aroma producing capability and a certain alcohol producing capability and application thereof in fermentation of wine.
One of the technical schemes provided by the invention is a non-saccharomyces cerevisiae, in particular to Hansenula polymorpha (Hanseniaspora uvarum) HX17 in grape juice, which is preserved in China general microbiological culture Collection center (address: north West Lu No. 1, national institute of microbiology, national academy of sciences, beijing, korea) at 3 months and 31 days 2022, and the preservation number is CGMCC No.24625.
The second technical scheme provided by the invention is the application of Hansenula polymorpha HX17 in grape wine production;
the Hansenula polymorpha HX17 has higher alcohol producing capability and aroma producing capability in the grape juice fermentation process:
(1) The wine obtained by fermenting the saccharomycete has excellent quality, high alcohol producing capacity and alcohol content up to about 14%;
(2) The wine obtained by fermenting the saccharomycete has strong fragrance, and the total content of esters such as ethyl acetate, ethyl decanoate, 2-phenyl ethyl acetate and the like reaches 89.35mg/L.
The beneficial effects of the invention are as follows:
the invention screens out a non-saccharomyces cerevisiae strain which has strong alcohol production capacity and can produce ester fragrance, namely Hansenula polymorpha HX17 grape juice by researching the aspects of morphology, physiological characteristics and the like of saccharomycetes. The wine obtained by fermenting the saccharomycete has alcohol content up to about 14%, pH value of about 3.4, strong fragrance, rich ester fragrance, and some special fragrant substances, such as 3-methyl-2-butanol, 2-hexadecanol, 2-ethyl phenylacetate, ethyl pelargonate, heptyl formate, etc., and attracts the attractive taste. This is of great importance for improving the mouthfeel and quality of the wine.
Description of the drawings:
FIG. 1 is a morphology of a single colony of Hansenula polymorpha HX17 in this grape juice.
FIG. 2 is a 40-fold microscopic morphology of Hansenula polymorpha HX17 cells in the grape juice.
FIG. 3 shows the change in weight loss during fermentation of wine.
FIG. 4 shows the glucose, fructose, glycerol and ethanol changes during fermentation of wine.
The specific embodiment is as follows:
in order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention. All other embodiments, based on the examples herein, which are within the scope of the invention as defined by the claims, will be within the scope of the invention as defined by the claims.
The technical scheme of the invention is further illustrated by the following examples.
Example 1 screening and isolation of Hansenula polymorpha HX17 in grape juice
YPD medium composition: 20g/L peptone, 10g/L yeast powder, 20g/L glucose, 1.5g/L agar and the balance of water.
WL medium: yeast powder 5g/L, casein 5g/L, glucose 50g/L, KH 2 PO 4 0.55g/L，KCl 0.425g/L，CaCl 2 0.125g/L，MgSO 4 0.125g/L, the balance being water.
The preparation method comprises the following steps: adding the above components into 1L distilled water, dissolving, packaging into 100mL conical flask, and sterilizing at 115deg.C for 20min. To exclude bacterial interference during the screening process, 60. Mu.g/ml chloramphenicol was added.
Taking 10g of broken grape in a 250mL sterile triangular flask, sealing the bottle mouth with a breathable sealing film, and placing the bottle mouth in a biochemical incubator at 28 ℃ for 2-3d; after bubbles are generated, taking out the fermentation liquor, and diluting the fermentation liquor with sterile water to obtain a diluted liquor;
the diluted solution is evenly coated on YPD culture medium, grows for 1-2d in a constant temperature incubator at 28 ℃, and single colony with typical yeast characteristics is selected and inoculated into liquid culture medium for culture. Diluting the bacterial liquid according to the concentration of the bacterial liquid, streaking and inoculating the bacterial liquid onto a WL culture medium, further purifying the yeast (purifying for 2-3 times according to the separation effect) until a single strain is obtained by separation, and carrying out molecular identification.
The process is to perform preliminary screening on yeast, and the process is to screen single bacterial colony with different appearance forms and fragrance in the culture medium, and then perform fermentation test analysis on bacterial strains in the single bacterial colony to screen and obtain the yeast with optimal performance. The single bacteria have different forms, wherein bacterial colony of the strain HX17 is white and round, the surface is smooth and moist, the edge is complete, the shape is approximately round, the surface is smooth and opaque (shown in figure 1), and the microscopic form is shown in figure 2.
Example 2 identification of Hansenula polymorpha HX17 in grape juice
Pure HX17 strain is selected and inoculated in YPD liquid culture medium, and cultured for 24 hours at 28 ℃ for activation. Taking a proper amount of activated bacterial liquid, centrifugally collecting bacterial cells, extracting genomic DNA of a pure culture target strain by adopting a kit extraction method, and using an upstream primer NL1:5'-GCATATCAATAAGCGGAGGAAAAG-3', downstream primer NL4:5'-GGTCCGTGTTTCAAGACGG-3' the conserved region of its 26SrDNA gene was amplified and sent to sequencing company for sequencing analysis.
The PCR reaction conditions were: denaturation at 95 ℃,15s; annealing at 55 ℃ for 15s; extending at 72 ℃ for 15s;30 cycles, extension at 72℃for 10min. Sequence alignment was performed in the GenBank database using the BLAST function of NCBI, and the classification of the analyzed strains was: hanseniaspora uvarum it is named Hansenula polymorpha (Hanseniaspora uvarum) HX17 and is preserved in China general microbiological culture Collection center with the preservation number of CGMCC No.24625.
The 26SrDNA gene sequence is as follows:
TTAGTACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGGTACTTTCAGTGCCCGAGTTGTAATTTGTAGAATTTGTCTTTGATTAGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTTTGGCGAGGATACCTTTTCTCTGTAAGACTTTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTTTGCATGCACTCGCCTCTCGTGGGCTTGGGCCTCTCAAAAATTTCACTGGGCCAACATCAATTCTGGCAGCAGGATAAATCATTAAGAATGTAGCTACTTCGGTAGTGTTATAGCTTTTTGGAATACTGTTAGCCGGGATTGAGGACTGCGCTTCGGCAAGGATGTTGGCATAATGGTTAAATGCCGCCC(SEQ ID NO.1)。
example 3 fermentation Effect verification of wine
The separated grape juice Hansenula polymorpha HX17 is used for fermenting grape wine, and the weight loss, glucose, fructose, glycerol and ethanol changes in the fermentation process of the grape wine are measured:
crushing Cabernet Sauvignon grape, packaging in triangular flask, and pasteurizing at 70deg.C for 15 min. The activated saccharomycete HX17 is centrifuged (6000 r/min,5 min) and then the thalli are collected, washed twice by 0.9 percent physiological saline and then connected into a triangular flask. The inoculation amount is 10 6 CFU/mL, fermentation at 25deg.C by daily CO determination 2 Weight loss monitors the progress of fermentation, and if the weight change for two consecutive days is less than 0.2g, the fermentation is considered to be ended. Filtering with gauze after fermentation, centrifuging the filtrate at 10000r/min for 10min, and discarding the precipitate to obtain supernatant for subsequent analysis. A commercially active dry yeast MT (identified as Saccharomyces cerevisiae) fermentation from LAMOTHE ABIET, france was also used as a control.
FIG. 3 shows the amount of carbon dioxide released during fermentation of wine. As can be seen from FIG. 3, HX17 started slower than commercial Saccharomyces cerevisiae MT and the fermentation time was longer, but the final weight loss was similar to that of Saccharomyces cerevisiae MT.
The pH value is measured by a pH meter; the soluble solids (Brix) were measured with a glycometer. And (3) measuring the contents of glucose, fructose, glycerol and ethanol in the fermentation liquid by adopting a high performance liquid chromatography. The chromatographic conditions are as follows: the chromatographic column is Bio-Rad HPX-87H, 300X 7.8mm; the detector is a differential refraction detector (RID); the mobile phase is 5mmol/L sulfuric acid with the flow rate of 0.6mL/min; the detector temperature was 45 ℃, the column temperature was 65 ℃, and each sample was measured for 23min, and in order to maintain the accuracy of the data, each sample was sampled three times and averaged, and the results are shown in table 1 and fig. 4.
As can be seen from FIG. 3, MT and HX17 complete the alcoholic fermentation on days 7 and 10, respectively, and Table 1 shows the basic indicators of the wine when the fermentation was completed. Wherein, the content of residual sugar is lower than 4g/L, and the concentration of ethanol reaches 14.17% at the end of HX17 fermentation, which is higher than the ethanol production capacity of other non-Saccharomyces cerevisiae in the prior art. In general, the glycerol content in the wine is 4-15 g/L, the ratio of glycerol to ethanol (abbreviated as glycerol ratio) is 6% -10%, and the glycerol content of the wine fermented by MT and HX17 is in the normal range. The pH value of the wine is generally between 2.8 and 3.8, otherwise, the stability is poor, and the pH value of 2 wine samples in the test is between 3.5 and 3.7, which indicates that the stability of the wine is better.
Table 1 MT and basic indicators of wine after the end of HX17 alcohol fermentation
As is clear from FIG. 4, the fermentation time of Hansenula polymorpha HX17 was longer (10 days) than that of Saccharomyces cerevisiae MT (7 days of fermentation), but the final consumption of glucose and fructose was not significantly different from that of MT in the production of glycerol and ethanol. It is demonstrated that HX17 is able to make full use of sugar in grape, producing alcohol and glycerol levels similar to Saccharomyces cerevisiae fermentation.
Example 4 measurement and comparison of organic acids and aroma Components in wine
The organic acids and aroma components in the wine sample obtained in example 3 in which Hansenula polymorpha HX17 was fermented for 10 days and in the sample obtained in MT fermentation for 7 days were measured as follows:
(1) Determination of organic acids (tartaric, malic, succinic) in wine samples using high performance liquid chromatographyAcid, lactic acid and acetic acid) concentration, the samples were centrifuged at 7000rpm for 10min and passed through a 0.22 μm filter. The chromatographic column was an Aminex HPX-87H (300X 7.8mm, bio-Rad); fluidity of 5mM H 2 SO 4 The method comprises the steps of carrying out a first treatment on the surface of the The flow rate is 0.6mL/min; column temperature 60 ℃; the sample injection amount is 20 mu L; the detection wavelength was 210nm, as shown in Table 2.
Organic acid is an important flavor substance in the wine, is a main determining factor of the acidity of the wine, influences the flavor and balance of the wine, and determines the quality and elegance of the wine to a great extent. Tartaric acid and malic acid are both present in grapes, wherein tartaric acid is the characteristic acid of wine, the highest content of organic acids, and tartaric acid can control acidity of wine, plays a key role in mouthfeel, flavor and color of wine, and is generally between 0.5 and 7g/L, and malic acid is generally between 0.05 and 5 g/L. And lactic acid, succinic acid and acetic acid are derived from fermentation processes, wherein the lactic acid content is between 0.01 and 5g/L, the succinic acid content is between 0.05 and 2g/L, and the acetic acid content is between 0.02 and 2 g/L. As can be seen from Table 2, the HX17 fermented wine tartaric acid, malic acid, succinic acid, lactic acid and acetic acid contents are all within this range.
TABLE 2 HX17 organic acid content of fermented wine
(2) Volatile component content determination: the volatile components of the wine are detected by adopting a solid phase microextraction-gas chromatography-mass spectrometry technology. Using fiber needle type solid phase microextraction, taking 8mL of centrifugal supernatant of a fermentation sample, placing the centrifugal supernatant into a 20mL headspace bottle, adding 2.5g of anhydrous sodium chloride, balancing at 60 ℃ for 15min, inserting an extraction head for headspace solid phase microextraction, and extracting for 45min.
Gas chromatography mass spectrometry conditions: CP-WAX 57CB (60 m×0.25mm×0.4 μm), the extraction head analyzes at 200 ℃ for 5min, adopts a non-split mode sample injection, a constant flow mode, column flow of 1.0mL/min, temperature programming, initial temperature of 40 ℃ and 2min holding, 2 ℃/min rising to 100 ℃, 4 ℃/min rising to 190 ℃ and 5min holding, running time of 59.5min, MSD transmission line 250 ℃ and mass spectrum selecting SCAN mode for scanning. Adopting a standard database to analyze, and carrying out qualitative analysis by searching a spectrum database and carrying out qualitative analysis on mass spectrum fragment information, retention index, retention time and the like of volatile components; quantification was performed using an internal standard method. The detection results are shown in Table 3.
As can be seen from Table 3, 21 total volatile compounds including 8 alcohols, 12 esters, 1 acid were detected in the wine fermented by Saccharomyces cerevisiae MT; in the wine fermented by Hansenula polymorpha HX17, 31 volatile compounds including 14 alcohols, 16 esters and 2 acids were detected in total.
Higher alcohols are the largest class of compounds among aroma compounds. Higher alcohols are acceptable at concentrations in the range of 300 to 400mg/L in wine and have pleasing characteristics when at optimum concentrations (less than 300 mg/L). The total amount of higher alcohol of HX17 fermented wine was increased by 56.7% compared with MT, up to 287.37mg/L, and the variety was increased by 6 kinds including 1-butanol, 1, 3-dimethoxy-2-propanol, 3-methyl-2-butanol, 3-ethoxy-1-propanol, 1, 3-octanediol, 1,3, 5-pentanetriol and 2-hexadecanol. Wherein 3-methyl-2-butanol has fruit fragrance, and 2-hexadecanol has rose fragrance, and can give wine a richer fragrance.
The esters are important aroma compounds in the wine, can provide pleasant flower aroma and fruit aroma for the wine, and are important components of the wine aroma. Compared with the control MT, the non-Saccharomyces cerevisiae HX17 can increase the total amount of the ester substances by 2.53 times, reaching 89.35mg/L. Ethyl acetate is an important aroma component in wine, and the quality concentration of the ethyl acetate is lower than 150mg/L, so that the complexity of the wine aroma can be increased, the higher the content of the ethyl acetate in the range, the greater the contribution to the wine aroma is, and the content of the ethyl acetate in HX17 reaches 59.30mg/L and is 2.98 times that of MT in a control group. The ethyl decanoate can bring fragrance of green apples, bananas and the like to the wine, and the content of the ethyl decanoate in HX17 is 2.36 times that of the MT of a control group. In addition, the 2-phenyl ethyl acetate, the ethyl pelargonate and the heptyl formate produced by HX17 fermentation all have fruit fragrance, flower fragrance and the like, so that the fragrance of the wine is more abundant.
Table 3 MT and comparison of aroma components of HX17 fermented wine
The above description is merely a preferred embodiment of the present invention, and the scope of the present invention is not limited to the above examples. Any modification, equivalent replacement, improvement, etc. made by those skilled in the art without departing from the technical idea of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> university of Tianjin science and technology
<120> Hansenula polymorpha HX17 strain of grape juice and application thereof
<130> 1
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 555
<212> DNA
<213> Hansenula polymorpha (Hanseniaspora uvarum) HX17 as grape juice
<400> 1
ttagtacggc gagtgaagcg gtaaaagctc aaatttgaaa tctggtactt tcagtgcccg 60
agttgtaatt tgtagaattt gtctttgatt aggtccttgt ctatgttcct tggaacagga 120
cgtcatagag ggtgagaatc ccgtttggcg aggatacctt ttctctgtaa gactttttcg 180
aagagtcgag ttgtttggga atgcagctca aagtgggtgg taaattccat ctaaagctaa 240
atattggcga gagaccgata gcgaacaagt acagtgatgg aaagatgaaa agaactttga 300
aaagagagtg aaaaagtacg tgaaattgtt gaaagggaag ggcatttgat cagacatggt 360
gttttttgca tgcactcgcc tctcgtgggc ttgggcctct caaaaatttc actgggccaa 420
catcaattct ggcagcagga taaatcatta agaatgtagc tacttcggta gtgttatagc 480
tttttggaat actgttagcc gggattgagg actgcgcttc ggcaaggatg ttggcataat 540
ggttaaatgc cgccc 555
Claims (2)
1. The non-saccharomyces cerevisiae is characterized by specifically comprising Hansenula polymorpha (Hanseniaspora uvarum) HX17 of grape juice, wherein the preservation number is CGMCC No.24625.
2. The use of hansenula polymorpha (Hanseniaspora uvarum) HX17 as claimed in claim 1 for wine brewing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210429351.9A CN114989995B (en) | 2022-04-22 | 2022-04-22 | Hansenula polymorpha HX17 strain with grape juice and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210429351.9A CN114989995B (en) | 2022-04-22 | 2022-04-22 | Hansenula polymorpha HX17 strain with grape juice and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114989995A CN114989995A (en) | 2022-09-02 |
| CN114989995B true CN114989995B (en) | 2023-08-18 |
Family
ID=83025108
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210429351.9A Active CN114989995B (en) | 2022-04-22 | 2022-04-22 | Hansenula polymorpha HX17 strain with grape juice and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114989995B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951631A (en) * | 2019-12-31 | 2020-04-03 | 江南大学 | Hansenula polymorpha capable of producing geraniol and fermentation method thereof |
| CN112625928A (en) * | 2021-01-15 | 2021-04-09 | 江南大学 | Hansenula polymorpha strain capable of increasing wine brewing aroma |
| CN112746029A (en) * | 2021-01-22 | 2021-05-04 | 西北农林科技大学 | Hansenula polymorpha strain QTX22 for producing aroma substances at high yield and application thereof |
-
2022
- 2022-04-22 CN CN202210429351.9A patent/CN114989995B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110951631A (en) * | 2019-12-31 | 2020-04-03 | 江南大学 | Hansenula polymorpha capable of producing geraniol and fermentation method thereof |
| CN112625928A (en) * | 2021-01-15 | 2021-04-09 | 江南大学 | Hansenula polymorpha strain capable of increasing wine brewing aroma |
| CN112746029A (en) * | 2021-01-22 | 2021-05-04 | 西北农林科技大学 | Hansenula polymorpha strain QTX22 for producing aroma substances at high yield and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114989995A (en) | 2022-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108239608B (en) | Torulaspora delbrueckii and application thereof in wine brewing | |
| CN109988720B (en) | Yeast ZB412 and application thereof | |
| CN113717870B (en) | Saccharomyces cerevisiae, leavening agent and application of saccharomyces cerevisiae and leavening agent in wine brewing | |
| CN101792719A (en) | Saccharomyces cerevisiae and application thereof in wine brewing | |
| CN111961603B (en) | Saccharomyces cerevisiae and bacterial agents and their use in the preparation of fermented products, in particular in the brewing of Huai drop of water basin wines | |
| CN107164251A (en) | One Accharomyces cerevisiae and its purposes for improving grape wine Ester content | |
| CN112725209B (en) | Saccharomyces cerevisiae and leaven for efficiently utilizing maltotriose and application of saccharomyces cerevisiae and leaven in fermented grain beverage and malt PYF factor detection | |
| CN116515654B (en) | Saccharomyces cerevisiae and application thereof in longan wine brewing | |
| CN117448182A (en) | Aroma-producing yeast and culture method and application thereof | |
| CN114989995B (en) | Hansenula polymorpha HX17 strain with grape juice and application thereof | |
| CN108949595B (en) | Aroma-producing yeast and application thereof in red yeast rice yellow wine brewing | |
| CN112226377B (en) | Saccharomyces cerevisiae and application thereof in making fruit-flavor dry red wine | |
| CN116478837A (en) | Pichia kudriavzevii ZB426 and application thereof in yellow rice wine | |
| CN115927023A (en) | Abnormal yeast Weikehan and application thereof, and wolfberry wine and preparation method thereof | |
| CN109666594B (en) | Method for intensively producing Shanxi mature vinegar by utilizing excellent native high-alcohol-yield saccharomyces cerevisiae and Artemisia annua Candida | |
| CN112920957A (en) | Candida glabrata and application thereof in increasing variety fragrance in wine brewing process | |
| CN115093981B (en) | Method for improving wine producing performance of wine producing yeast under acid stress environment | |
| CN116103171B (en) | Saccharomyces cerevisiae resistant to environmental stress and capable of producing ethanol through rapid fermentation and application thereof | |
| CN113897297B (en) | Beta-glucosidase yeast with high enzyme activity under low pH condition and application thereof | |
| CN114456962B (en) | Preparation method for fermenting grapefruit rice wine by utilizing composite microorganisms | |
| CN114940951B (en) | Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base | |
| CN117126753B (en) | Saccharomyces cerevisiae for producing polysaccharide and application thereof in longan wine brewing | |
| CN116676202A (en) | Composite fermentation microbial inoculum and application thereof | |
| Papathanasiou et al. | Winemaking ability of wild yeast strains and comparative volatile profiles of wines fermented at 12° or 20° C | |
| CN116751722A (en) | Acetobacter pasteurii X4 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |