CN114989995A

CN114989995A - Hansenula polymorpha HX17 strain and application thereof

Info

Publication number: CN114989995A
Application number: CN202210429351.9A
Authority: CN
Inventors: 杜丽平; 马立娟; 高熳熳; 胡江南; 张惠玲; 杨伟民
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2022-04-22
Filing date: 2022-04-22
Publication date: 2022-09-02
Anticipated expiration: 2042-04-22
Also published as: CN114989995B

Abstract

The invention belongs to the technical field of biology, and particularly relates to a Hansenula polymorpha HX17 strain of grape juice and application thereof in wine brewing. The invention obtains a yeast strain-Hansenula polymorpha HX17 with strong alcohol production capability and capable of producing aroma substances such as esters and the like through screening. The wine fermented by the yeast has good quality, strong alcohol production capacity, high alcohol content of about 14 percent, pH value of about 3.4, strong fragrance, rich ester fragrance and attractive taste, and can produce certain special fragrant substances such as 3-methyl-2-butanol, 2-hexadecanol, 2-ethyl phenylacetate, ethyl nonanoate, heptyl formate and the like. Has important significance for improving the taste of the wine and the quality of the wine.

Description

Hansenula polymorpha HX17 strain and application thereof

The technical field is as follows:

the invention belongs to the technical field of biology, and particularly relates to Hansenula polymorpha HX17 strain of grape juice and application thereof in wine brewing.

Background art:

in the process of brewing wine, the yeast plays a very important role. Winery industry fermentation tends to use s.cerevisiae to ensure that wine fermentation proceeds smoothly, but also to some extent reduces the flavour diversity of wine. In recent years, non-saccharomyces cerevisiae has been increasingly recognized in improving the quality of wine, such as aroma, taste, color, etc., and is increasingly used in wine fermentation.

Researches find that many non-saccharomyces cerevisiae can produce a large amount of metabolites such as glycerol and esters, can also produce glycosidase which is beneficial to hydrolysis of aroma precursors and releases free aroma components, has an important effect on flavor formation of wine, and has the defects of weak ethanol resistance, low fermentation performance and the like. Therefore, the screening of the non-saccharomyces cerevisiae with good aroma production capability and certain alcohol production capability for wine fermentation is an effective method for obtaining high-quality wine by avoiding product homogenization.

In view of this, the invention is particularly proposed.

The invention content is as follows:

the invention aims to provide a non-saccharomyces cerevisiae with good aroma production capability and certain alcohol production capability and application thereof in wine fermentation.

One of the technical schemes provided by the invention is a non-saccharomyces cerevisiae, in particular to hansenula polymorpha (Hanseniaspora uvarum) HX17, which is preserved in China general microbiological culture Collection center (address: West Lu No. 1 Hospital No. three, China academy of sciences microbiological research, zip code 100101, in the morning and Yangxi district, Beijing city) in 31 days at 2022, and the preservation number is CGMCC No. 24625.

The second technical scheme provided by the invention is the application of the Hansenula polymorpha HX17 in the production of wine;

the Hansenula polymorpha HX17 as the grape juice has higher alcohol production capacity and aroma production capacity in the grape juice fermentation process:

(1) the wine fermented by the yeast has good quality and high alcohol production capacity, and the alcohol content can reach about 14 percent;

(2) the grape wine fermented by the yeast has fragrant fragrance, and the total content of esters such as ethyl acetate, ethyl decanoate and 2-phenyl ethyl acetate reaches 89.35 mg/L.

The beneficial effects of the invention are as follows:

according to the invention, by researching the morphology, physiological characteristics and other aspects of the yeast, a non-saccharomyces cerevisiae strain-hansenula polymorpha HX17 with strong alcohol production capability and ester aroma can be screened out. The wine fermented by the yeast has the alcohol content of about 14 percent, the pH value of about 3.4, strong fragrance and rich ester fragrance, and has certain specific fragrant substances, such as 3-methyl-2-butanol, 2-hexadecanol, 2-ethyl phenylacetate, ethyl nonanoate, heptyl formate and the like, which attract the taste. The method has important significance for improving the taste of the wine and improving the quality of the wine.

Description of the drawings:

FIG. 1 shows a single colony morphology of Hansenula polymorpha HX17 belonging to this grape juice.

FIG. 2 is a 40-fold micrograph of the cells of Hansenula polymorpha HX17 belonging to Botrytis cinerea.

FIG. 3 shows the weight loss change during wine fermentation.

FIG. 4 shows the variation of glucose, fructose, glycerol and ethanol during the fermentation of wine.

The specific implementation mode is as follows:

in order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be described in detail below. It is to be understood that the embodiments described are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the examples given herein without any inventive step, are within the scope of the present invention.

The technical solution of the present invention is further illustrated by the following examples.

EXAMPLE 1 screening and isolation of Hansenula polymorpha HX17 from grape juice

YPD medium composition: 20g/L of peptone, 10g/L of yeast powder, 20g/L of glucose, 1.5g/L of agar and the balance of water.

WL medium: 5g/L of yeast powder, 5g/L of casein, 50g/L of glucose and KH ₂ PO ₄ 0.55g/L，KCl 0.425g/L，CaCl ₂ 0.125g/L，MgSO ₄ 0.125g/L, and the balance of water.

The preparation method comprises the following steps: dissolving the above components in 1L distilled water, packaging into 100mL conical flask, and sterilizing at 115 deg.C for 20 min. To exclude bacterial interference during the screening process, 60. mu.g/ml chloramphenicol was added.

Taking 10g of crushed grapes into a 250mL sterile triangular flask, sealing the bottle mouth with a breathable sealing film, and placing the bottle mouth into a 28 ℃ biochemical incubator for 2-3 d; after bubbles are generated, taking out the fermentation liquor and diluting the fermentation liquor with sterile water to obtain a diluent;

uniformly spreading the dilution on YPD medium, growing at 28 deg.C in a constant temperature incubator for 1-2d, selecting single colony with typical yeast characteristics, and inoculating into liquid medium for culture. Diluting the bacterial liquid according to the concentration of the bacterial liquid, streaking the bacterial liquid to a WL culture medium to further purify the yeast (purifying for 2-3 times according to the separation effect) until a single bacterial strain is obtained by separation, and carrying out molecular identification.

The process is to carry out primary screening on the yeast, and has the functions of screening out single bacterial colonies which have different appearance forms and generate fragrance in a culture medium, and then carrying out fermentation test analysis on bacterial strains in the single bacterial colonies so as to screen out the yeast with the optimal performance. The single bacterium has different morphologies, wherein the colony of the strain HX17 is white and round, the surface is smooth and wet, the edge is complete, the shape is approximately round, the surface is smooth and opaque (shown in figure 1), and the microscopic morphology is shown in figure 2.

Example 2 identification of Hansenula polymorpha HX17 on grape juice

The pure HX17 strain is selected and inoculated in YPD liquid culture medium, and cultured for 24h at 28 ℃ for activation. Taking a proper amount of activated bacteria liquid, centrifugally collecting thalli, extracting the genome DNA of a pure culture target strain by a kit extraction method, and performing amplification reaction on an upstream primer NL 1: 5'-GCATATCAATAAGCGGAGGAAAAG-3', downstream primer NL 4: 5'-GGTCCGTGTTTCAAGACGG-3' the conserved region of the 26SrDNA gene was amplified and sent to sequencing company for sequencing analysis.

The PCR reaction conditions were: denaturation at 95 ℃ for 15 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 15 s; 30 cycles, extension at 72 ℃ for 10 min. Sequence alignments were performed in the GenBank database using the BLAST function of NCBI, and the classification of the analyzed strains was: hanseniaspora uvarum, so the strain is named as Hanseniaspora uvarum (Hanseniaspora uvarum) HX17 and is preserved in China general microbiological culture Collection center with the preservation number of CGMCC No. 24625.

The 26SrDNA gene sequence is as follows:

TTAGTACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGGTACTTTCAGTGCCCGAGTTGTAATTTGTAGAATTTGTCTTTGATTAGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTTTGGCGAGGATACCTTTTCTCTGTAAGACTTTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTTTGCATGCACTCGCCTCTCGTGGGCTTGGGCCTCTCAAAAATTTCACTGGGCCAACATCAATTCTGGCAGCAGGATAAATCATTAAGAATGTAGCTACTTCGGTAGTGTTATAGCTTTTTGGAATACTGTTAGCCGGGATTGAGGACTGCGCTTCGGCAAGGATGTTGGCATAATGGTTAAATGCCGCCC(SEQ ID NO.1)。

example 3 wine fermentation Effect verification

The isolated hansenula polymorpha HX17 as grape juice was used for wine fermentation, and the weight loss, change of glucose, fructose, glycerol and ethanol during the wine fermentation were measured:

removing stem and crushing Cabernet Sauvignon, subpackaging in triangular bottles, and pasteurizing at 70 deg.C (15 min). The activated yeastAfter centrifugation (6000r/min, 5min) HX17, the thalli are collected, washed twice by 0.9% physiological saline and then connected into a triangular flask. The inoculation amount is 10 ⁶ CFU/mL, fermentation at 25 ℃ with standing, by daily CO determination ₂ Monitoring the fermentation process by the weight loss, and if the weight change of the mixture is less than 0.2g for two consecutive days, determining that the fermentation is finished. Filtering with gauze after fermentation, centrifuging the filtrate at 10000r/min for 10min, discarding the precipitate, and collecting the supernatant for subsequent analysis. Also employed as a control was the fermentation of commercially active dry yeast MT (identified as Saccharomyces cerevisiae) purchased from LAMOTHEE ABIET, France.

Figure 3 shows the carbon dioxide release during wine fermentation. As can be seen from FIG. 3, HX17 started slower and fermented for longer than commercial Saccharomyces cerevisiae MT, but the final weight loss was similar to that of Saccharomyces cerevisiae MT.

The pH value is measured by a pH meter; soluble solids (Brix) were measured by a saccharimeter. And measuring the contents of glucose, fructose, glycerol and ethanol in the fermentation liquor by adopting a high performance liquid chromatography. The chromatographic conditions are as follows: the chromatographic column is Bio-Rad HPX-87H, 300 multiplied by 7.8 mm; the detector is a differential refractometer detector (RID); the mobile phase is 5mmol/L sulfuric acid with the flow rate of 0.6 mL/min; the detector temperature was 45 ℃ and the column temperature was 65 ℃ and each sample was measured for 23min, and three injections were performed per sample to maintain the accuracy of the data and the results were averaged as shown in table 1 and fig. 4.

As can be seen from FIG. 3, MT and HX17 completed alcoholic fermentation on days 7 and 10, respectively, and Table 1 shows the basic wine indices at the completion of fermentation. Wherein, the residual sugar content is lower than 4g/L, and the ethanol concentration reaches 14.17 percent when HX17 fermentation is finished, which is higher than the ethanol production capacity of other non-saccharomyces cerevisiae in the prior art. Generally, the content of glycerin in the wine is 4-15 g/L, the ratio of the glycerin to ethanol (called glycerin ratio for short) is 6-10%, and the glycerin content of the wine fermented by MT and HX17 is in a normal range. The pH value of the wine is generally between 2.8 and 3.8, otherwise, the stability is poor, and the pH values of 2 wine samples in the test are between 3.5 and 3.7, which indicates that the stability of the wine is good.

TABLE 1 basic index of wine after termination of MT and HX17 alcohol fermentation

As can be seen from FIG. 4, the fermentation time of Hansenula polymorpha HX17, a grape juice, was longer (10 days) than that of Saccharomyces cerevisiae MT (7 days of fermentation), but the final consumption of glucose and fructose, and the production of glycerol and ethanol were not much different from that of MT. Indicating that HX17 can make full use of the sugar in grape to produce alcohol and glycerin content similar to that of Saccharomyces cerevisiae fermentation.

Example 4 measurement and comparison of organic acids and aroma Components in wine

The organic acids and aroma components of the wine sample fermented by Hansenula polymorpha HX17 for 10 days and the sample fermented by MT for 7 days obtained in the grape juice obtained in example 3 were measured as follows:

(1) the concentration of organic acids (tartaric acid, malic acid, succinic acid, lactic acid and acetic acid) in the wine samples was determined using high performance liquid chromatography, and the samples were centrifuged at 7000rpm for 10min and passed through a 0.22 μm filter. The chromatographic column is Aminex HPX-87H (300X 7.8mm, Bio-Rad); fluidity was 5mM H ₂ SO ₄ (ii) a The flow rate is 0.6 mL/min; the column temperature is 60 ℃; the sample injection amount is 20 mu L; the detection wavelength was 210nm, as shown in Table 2.

The organic acid is an important flavor substance in the wine, is a main determining factor of the acidity of the wine, influences the flavor and balance of the wine, and determines the quality and elegance of the wine to a great extent. Tartaric acid and malic acid are both present in grapes, wherein tartaric acid is the characteristic acid of wine, the content of tartaric acid is the highest in organic acid, tartaric acid can control the acidity of wine, plays a key role in taste, flavor and color of wine, the content of tartaric acid is usually between 0.5 and 7g/L, and the content of malic acid is between 0.05 and 5 g/L. Lactic acid, succinic acid and acetic acid are obtained from fermentation process, wherein the content of lactic acid is 0.01-5g/L, the content of succinic acid is 0.05-2 g/L, and the content of acetic acid is 0.02-2 g/L. As can be seen from Table 2, the contents of tartaric acid, malic acid, succinic acid, lactic acid and acetic acid by HX17 fermentation were all within this range.

TABLE 2 HX17 content of organic acids in fermented wine

(2) And (3) measuring the content of volatile components: and detecting the volatile components of the wine by adopting a solid phase microextraction-gas chromatography-mass spectrometry technology. Using a fiber needle type solid phase microextraction, taking 8mL of centrifugal supernatant of a fermentation sample, placing the centrifugal supernatant into a 20mL headspace bottle, adding 2.5g of anhydrous sodium chloride, balancing for 15min at 60 ℃, inserting an extraction head for performing headspace solid phase microextraction, and extracting for 45 min.

Gas chromatography mass spectrometry conditions: CP-WAX 57CB (60m is multiplied by 0.25mm is multiplied by 0.4 mu m), an extraction head is analyzed for 5min at the temperature of 200 ℃ of an injection port, the sample is injected in a non-shunt mode, a constant flow mode is adopted, the column flow is 1.0mL/min, the temperature is programmed, the initial temperature is 40 ℃, the temperature is kept for 2min, the temperature is raised to 100 ℃ at 2 ℃/min, the temperature is raised to 190 ℃ at 4 ℃/min, the temperature is kept for 5min, the running time is 59.5min, the MSD transmission line is 250 ℃, and the SCAN mode is selected for mass spectrum scanning. Analyzing by adopting a standard database, and qualitatively analyzing by spectrum library retrieval and mass spectrum fragment information, retention index, retention time and the like of volatile components; quantification was performed by internal standard method. The results are shown in Table 3.

As can be seen from table 3, a total of 21 volatile compounds were detected in wine fermented with saccharomyces cerevisiae MT, including 8 alcohols, 12 esters, 1 acid; in contrast, a total of 31 volatile compounds were detected in wine fermented with Hansenula polymorpha HX17 as grape juice, including 14 alcohols, 16 esters, and 2 acids.

Higher alcohols are the largest class of aroma compounds. The concentration of higher alcohols in wine is acceptable in the range of 300-400 mg/L and has pleasant properties when it is at the optimum concentration (below 300 mg/L). Compared with MT, the total amount of wine higher alcohol fermented by HX17 is increased by 56.7% to 287.37mg/L, and the variety is increased by 6 types, including 1-butanol, 1, 3-dimethoxy-2-propanol, 3-methyl-2-butanol, 3-ethoxy-1-propanol, 1, 3-octanediol, 1,3, 5-pentanetriol and 2-hexadecanol. Wherein the 3-methyl-2-butanol has fruit flavor, and the 2-hexadecanol has rose flavor, and can provide wine with richer flavor.

The ester substances are important aroma compounds in the wine, can provide pleasant flower fragrance and fruit fragrance for the wine, and are important components of the wine fragrance. Compared with the control group MT, the non-saccharomyces cerevisiae HX17 can increase the total amount of ester substances by 2.53 times, and the total amount reaches 89.35 mg/L. Ethyl acetate is an important aroma component in wine, the mass concentration of the ethyl acetate is lower than 150mg/L, the complexity of the aroma of the wine can be increased, the higher the content of the ethyl acetate in the range, the greater the contribution of the ethyl acetate to the aroma of the wine, the higher the content of the ethyl acetate in HX17, the content of the ethyl acetate in HX17 reaches 59.30mg/L which is 2.98 times of the MT of a control group. The ethyl decanoate can bring the fragrance of green apples, bananas and the like to the wine, and the content of the ethyl decanoate in HX17 is 2.36 times of that in the MT of the control group. In addition, the 2-phenyl ethyl acetate, the ethyl nonanoate and the heptyl formate generated by HX17 fermentation all have fruity fragrance, flower fragrance and the like, so that the fragrance of the wine can be enriched.

TABLE 3 comparison of aroma components of MT and HX17 fermented wines

The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited to the above-described examples. It will be understood by those skilled in the art that various changes, substitutions of equivalents, and alterations can be made without departing from the spirit and scope of the invention.

SEQUENCE LISTING

<110> Tianjin science and technology university

<120> Hansenula polymorpha HX17 strain of grape juice and application thereof

<130> 1

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 555

<212> DNA

<213> Hansenula polymorpha (Hanseniaspora uvarum) HX17

<400> 1

ttagtacggc gagtgaagcg gtaaaagctc aaatttgaaa tctggtactt tcagtgcccg 60

agttgtaatt tgtagaattt gtctttgatt aggtccttgt ctatgttcct tggaacagga 120

cgtcatagag ggtgagaatc ccgtttggcg aggatacctt ttctctgtaa gactttttcg 180

aagagtcgag ttgtttggga atgcagctca aagtgggtgg taaattccat ctaaagctaa 240

atattggcga gagaccgata gcgaacaagt acagtgatgg aaagatgaaa agaactttga 300

aaagagagtg aaaaagtacg tgaaattgtt gaaagggaag ggcatttgat cagacatggt 360

gttttttgca tgcactcgcc tctcgtgggc ttgggcctct caaaaatttc actgggccaa 420

catcaattct ggcagcagga taaatcatta agaatgtagc tacttcggta gtgttatagc 480

tttttggaat actgttagcc gggattgagg actgcgcttc ggcaaggatg ttggcataat 540

ggttaaatgc cgccc 555

Claims

1. A non-saccharomyces cerevisiae is characterized by specifically being hansenula polymorpha (Hanseniaspora uvarum) HX17 with the preservation number of CGMCC No. 24625.

2. Use of Hansenula sporulata (Hanseniaspora uvarum) HX17 as claimed in claim 1 for brewing wine.