CN114940951B - Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base - Google Patents
Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base Download PDFInfo
- Publication number
- CN114940951B CN114940951B CN202210501009.5A CN202210501009A CN114940951B CN 114940951 B CN114940951 B CN 114940951B CN 202210501009 A CN202210501009 A CN 202210501009A CN 114940951 B CN114940951 B CN 114940951B
- Authority
- CN
- China
- Prior art keywords
- yeast
- temperature
- culture
- covered
- saccule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G3/00—Preparation of other alcoholic beverages
- C12G3/02—Preparation of other alcoholic beverages by fermentation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G3/00—Preparation of other alcoholic beverages
- C12G3/02—Preparation of other alcoholic beverages by fermentation
- C12G3/021—Preparation of other alcoholic beverages by fermentation of botanical family Poaceae, e.g. wheat, millet, sorghum, barley, rye, or corn
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The invention discloses a saccule-buckling compound film yeast (Saccharomycopsis fibuligera) Y162 and application thereof in the production of Xiaoqu fen-flavor liquor. The strain is preserved in China Center for Type Culture Collection (CCTCC) with a preservation date of 2022, 3 months and 10 days and a preservation number of CCTCC No. M2022245. The invention discloses a preparation method of a saccule-covered yeast Y162 reinforced distiller's yeast, and the reinforced distiller's yeast prepared by the yeast is applied to the brewing of a small yeast fen-flavor raw wine, the ethyl acetate content in the produced wine body reaches 2g/L, which is obviously improved by 50.37 percent (P is less than 0.01) compared with a production control group, and the produced small yeast raw wine has the advantages of faint scent, pure taste, sweet taste, prominent ester fragrance, harmonious fragrance, clean and refreshing taste and typical style.
Description
Technical Field
The invention relates to the technical field of bioengineering, in particular to a saccule-covering film-covering yeast and application thereof in Xiaoqu fen-flavor wine base.
Background
The ascomycetes tectorial membrane yeast (Saccharomycopsis fibuligera), also called ascomycetes amycolatopsis (Endomycopsis fibuligera), is a two-state yeast capable of producing ascospores, and can secrete amylase, saccharifying enzyme, acid protease, beta-glucosidase and the like, so that the ascospores can be widely applied to the industries of foods, fermentation, biofuels and medicines. The enzyme activity of the saccule-buckling compound film yeast in the white wine production determines that the saccule-buckling compound film yeast can ferment with various raw materials as substrates to produce alcohol, and also provides nutrient substances for the growth of other white wine microorganisms. Sun Saijia (food and fermentation industry, 2019) researches enzyme production conditions and enzyme properties of 1 strain of high-yield amylase, namely, aschersonia aleyrodis, in the high-temperature Daqu of sesame-flavor white spirit, and the amylase activity reaches 12297U/g after optimization, and the produced amylase can adapt to an acidic high-temperature environment of Daqu fermentation and has potential of being applied to high-temperature Daqu production. Chinese patent (CN 201810274972.8) reports a strain of covered with film spore and application thereof, the strain produces alpha-amylase with 2.56 times of the currently known highest enzyme activity (7425.4U/g), and simultaneously has the capability of producing 7 enzymes such as saccharifying enzyme, acid proteinase, lipase and the like, and can directly, quickly and thoroughly decompose vinasse when applied to a quick-decomposing inoculant. Chinese patent (CN 201710539656.4) reports a saccule-covered sporotrichum and application thereof in the production of medium-high temperature Daqu, and the amylase activity of the strain can reach 7425.7U/g. The strain is prepared and processed into a microbial inoculum, and is applied to the production of sesame-flavor medium-high temperature Daqu, the saccharification force and the liquefaction force of the enhanced medium-high temperature Daqu are obviously higher than those of a control Daqu, and the utilization rate of raw materials in the preparation process of the Daqu is improved.
In addition, the saccule-covered yeast can produce various esters, lactones, alcohols, organic acids and aldehyde ketone compounds, and has important effect on the formation of the flavor of the white wine. Wang Xiaodan (food science, 2017) is to separate a strain of film covered yeast with FBKL2.0071 from Maotai daqu, and the solid state fermentation product has rich fruit flavor, wherein ethyl acetate, isoamyl acetate, phenethyl alcohol, phenethyl acetate and ethyl palmitate are used for higher content. Zhangrui (China brewing, 2021) to separate, screen and identify high acid-producing yeasts in 10 different rice wine yeasts and yellow wine yeasts, and screening a strain of saccule-covered yeast with high acid production rate, high temperature resistance and strong ethanol capability. Chinese patent (201510636469.9) reports a Saccharomycetes sinensis and application thereof, and the strain can produce isoamyl alcohol in Maotai-flavor liquor. And the synergistic effect of the sacculus tectorial membrane yeast and other microorganisms has important contribution to the generation of alcohol and the formation of white spirit flavor. Su et al (Food Research International, 2020) have shown that the microbial strengthening inoculant of Sichuan-process Xiaoqu liquor prepared by inoculating the strengthening inoculant has significantly improved activity of saccharifying enzyme and acid protease of the strengthening yeast, the brewed white spirit ethanol and total ester content are respectively increased by 42.5% and 11.8%, and the aldehyde ketone and heterocyclic compound content is respectively reduced by 73.7% and 77.1% compared with the traditional Xiaoqu liquor. Wu Jian (Chinese brewing, 2020) is prepared by co-culturing the sacculus laminating yeast with other yeasts, pure rhizopus oryzae to prepare flavored rice yeast, and taking commercial small yeast as a reference, and the result shows that the addition of the flavor producing yeast obviously improves the ester producing capability and the acid producing capability of the flavored rice yeast and greatly improves the fragrance of the rice-flavor white spirit. Chinese patent (CN 201910264999.3) reports an ester-producing yeast ZB406 and application thereof, and the co-fermentation of the screened and separated saccule-covered yeast and Saccharomyces cerevisiae realizes synchronous alcohol fermentation and aroma substance synthesis, thus realizing obvious improvement of aroma flavor of the liquid fermented rice vinegar.
At present, the problem of low ester content of the Xiaoqu fen-flavor liquor generally exists, so that the quality and the taste of the liquor are improved greatly. Therefore, the improvement of the main ester-ethyl acetate of the Xiaoqu fen-flavor liquor is an urgent problem to be solved, and the application of the ester-producing yeast is a key method for improving the ethyl acetate content in the liquor. The literature reports that most yeasts for producing ethyl acetate with high yield are Wick yeast, saccharomyces cerevisiae, debaryomyces hansenii, pichia kudriavzevii and the like, and the application of the bursa-pastoris in white wine has only the functions of producing isoamyl alcohol and improving the saccharification power and the liquefaction power of Daqu. In view of the high enzyme activity and the ester-producing and aroma-producing capability of the saccule-covered yeast, the saccule-covered yeast has a great effect in the brewing industry, but the application of the saccule-covered yeast in the Xiaoqu fen-flavor liquor is still blank. As dominant yeast strains in the fen-flavor liquor, how the dominant yeast strains contribute to the quality of the Xiaoqu liquor, the functions of the buckling bag covered yeast are necessary to be researched, and the strains with excellent performance are obtained to strengthen the yeast making, so that the quality of the distiller's yeast is improved, and finally, the yeast strains are applied to the production of the liquor and the quality of the Xiaoqu liquor is improved.
Disclosure of Invention
The invention aims to provide a saccule-covered yeast strain, which is used for strengthening starter propagation by obtaining the strain with excellent performance, improving the quality of distiller's yeast, and finally improving the quality of small-yeast white spirit when being applied to white spirit production.
The strain is preserved in China center for type culture Collection (China, the preservation unit address is university of Wuhan, china, the preservation date is 2022, 3 months and 10 days, and the preservation number is CCTCC NO. M2022245.
The invention also aims to provide a preparation method of the solid-state wine yeast containing the saccule-covered yeast, which comprises the following steps:
(1) Preparation of starter propagation and Yeast culture Medium
Soaking early long-shaped rice for 8-10h, pulping, adding early long-shaped rice powder and rice bran which are sieved by a 20-mesh sieve into rice pulp, uniformly stirring, and inoculating rhizopus hypnoticus, wherein the inoculation amount is 3.0-3.5% of the total weight of the early long-shaped rice, the rice flour and the rice bran; kneading into cake-shaped curved blanks with the diameter of 6-7cm by hands, arranging the curved blanks on a wooden box in a culture room, covering a bamboo pad, wherein the distance between the curved blanks is 2-3 cm; the temperature of the culture room is controlled at 30-32 ℃, and when the temperature of Qu Pipin is raised to 35 ℃, the bamboo mat is removed; continuously culturing until the temperature of the yeast blank Wen Jiangzhi is 25-28 ℃, and then drying the yeast blank at 35 ℃ to obtain the yeast;
weighing molasses, adding hot water with the volume of 85 ℃ which is2 times of the weight of the molasses, stirring until the molasses is dissolved to obtain a solution, adding concentrated sulfuric acid with the volume of 0.1 percent of the solution, stirring uniformly, standing for 12 hours, adding supernatant into a fermentation tank, and supplementing water until the sugar degree of a molasses culture medium is 10BX-15BX; weighing ammonium sulfate, urea, monoammonium phosphate, magnesium sulfate, yeast extract and defoamer according to the mass percentage of 0.2%, 0.1%, 0.2% and 10%, pouring into a fermentation tank, adding water to 60-80% of the tank volume, starting stirring to completely dissolve nutrient salts, sterilizing and cooling to obtain a yeast culture medium;
(2) Preparation of pure strain microbial inoculum of saccule-covered yeast Y162
Weighing malt extract powder according to the proportion of 1g/100mL, dissolving the malt extract powder with water, subpackaging the malt extract powder into 1000mL triangular bottles, and sterilizing for later use, wherein the liquid filling amount of each bottle is 500 mL; inoculating pure culture of the saccule-covered yeast (Saccharomycopsis fibuligera) Y162 test tube with the preservation number of CCTCC No. M2022245 into a triangular flask, and shake culturing at 140rpm for 20-36h at 30 ℃; inoculating the triangular flask for culturing Y162 into a fermentation tank filled with the yeast culture medium prepared in the step (1) for fermentation, inoculating the fermentation tank into the sterilized bran culture medium, culturing at 30 ℃ for 36h, and drying to prepare the Y162 pure strain microbial inoculum;
(3) Preparation of solid-state wine yeast of reinforced saccule-covered yeast
Pulverizing Guanyin soil, sieving with 14 mesh sieve, sieving rice bran with 16 mesh sieve, pulverizing the seed yeast prepared in step (1), and sieving with 20 mesh sieve; uniformly mixing and stirring the Y162 pure strain microbial inoculum prepared in the step (2) with rice bran and yeast, and then adding kaolin to uniformly stir, wherein the kaolin is prepared by the following steps: rice bran: and (3) yeast: the weight ratio of the pure strain microbial inoculum of Y162 is 75:25:1.4-1.8:0.7, and the mixture is obtained; adding water into the mixture to make the water content in the mixture be 50%; uniformly stirring, preparing the mixture into spherical yeast blank with the diameter of 7-8cm, orderly placing the prepared yeast blank in an incubator in a culture room, and paving a bamboo mat on the yeast blank for culture; after the culture is finished, the yeast blank is placed in a drying room and dried at the temperature of 35-40 ℃ until the water content is less than or equal to 5%, and then the solid-state wine yeast of the reinforced buckling capsule laminated yeast Y162 is obtained.
Preferably, the long-grained nonglutinous rice of step (1): early rice flour: the weight ratio of rice bran is 63:35:2.
Preferably, in the step (2), the dissolved oxygen amount of the fermentation tank is set to 45%, the pH=3-5, the rotating speed is 100-500rpm, the temperature is 35 ℃, and the fermentation is carried out for 22 hours.
Preferably, in the step (3), the temperature of the culture chamber is controlled to be 28-30 ℃, and the culture is carried out for 16 hours; checking the temperature of the curved blank in the incubator, and uncovering the bamboo mat when the temperature of Qu Pipin is raised to 30-35 ℃ to prop up the incubator; when the temperature of the yeast blank is reduced to room temperature, the yeast blank is picked up, the yeast blanks cannot be extruded mutually, and the culture is continued for 5 days.
The invention also aims to provide an application of the solid brewing distiller's yeast containing the saccule-covered film yeast in the production of small-yeast fen-flavor liquor, which comprises the following steps:
soaking waxy sorghum in 70-80 ℃ water for 20 hours, performing primary steaming, stewing and re-steaming to obtain cooked grain, cooling the cooked grain to 30 ℃, adding the solid-state wine yeast of the reinforced capsule-covered film-covered yeast Y162 prepared in the step (3) according to the inoculation amount of 0.8-1.2%, uniformly stirring the solid-state wine yeast of the reinforced capsule-covered film-covered yeast Y162 and the grain, and then delivering the mixture to a saccharification tank field for bacteria cultivation and saccharification; adding the mixed grains according to the grain-grain ratio of 1:4-1:5, mixing uniformly, and putting into a fermentation tank at low temperature, wherein the temperature of putting into the tank is controlled at 15-20 ℃; fermenting the grain lees in a pool, fully and uniformly stirring, wherein the fermentation period is 8 days, and distilling to obtain the Xiaoqu wine base.
Preferably, the temperature of the container is controlled to be 23-28 ℃ in the saccharification process, the temperature difference between the upper grain layer, the middle grain layer and the lower grain layer is not more than 2 ℃, and the container is opened after saccharification for 22-26 hours by bacteria cultivation.
The invention uses the reinforced buckling bag film-covered yeast Y162 to be applied to the brewing of the Xiaoqu fen-flavor original wine, the ethyl acetate content in the produced wine body reaches 2g/L, which is obviously improved by 50.37 percent (P is less than 0.01) compared with the production control group, and the produced Xiaoqu original wine has the advantages of faint scent, pure and sweet taste, prominent ester fragrance, coordinated fragrance, clean and refreshing taste and typical style.
Drawings
FIG. 1 is a macro-morphology of Y162 yeast colonies;
FIG. 2 is a schematic diagram of the enzyme activity of amylase produced by liquid culture of different laminated film yeasts;
FIG. 3 is a schematic diagram showing growth conditions of different sacculus-forming laminated yeasts at different temperatures;
FIG. 4 is a schematic diagram showing the growth of different sacculus-forming yeasts at different ethanol concentrations;
FIG. 5 is a schematic diagram showing the growth of different oocyst yeasts under different acidic conditions;
FIG. 6 is a comparative schematic diagram of the application of the saccule-covered yeast Y162-enriched distiller's yeast to the production data of Xiaoqu liquor.
Detailed Description
In order that the manner in which the above recited features, objects and advantages of the present invention are obtained will become readily apparent, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings. Based on the examples in the embodiments, those skilled in the art can obtain other examples without making any inventive effort, which fall within the scope of the invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.
The invention discloses a saccule-covered yeast Y162 strain which is obtained by separating and screening from Xiaoqu fen-flavor liquor distiller's yeast. The strain has the following characteristics:
colony morphology characteristics of the oocyst complex yeast Y162 cultured for 2d on YPD plates were: white, round protrusions, rough surface, micro fluff, and dry, with neat outer edge. The microscopic morphological characteristics of the culture for 30h in the YPD liquid culture medium are as follows: the cells are round or elliptic, the pseudobacteria are filiform, and bud multiplication is carried out.
Isolation and screening procedure of Y162
1.1 preparation of culture Medium
(1) YPD agar medium
Glucose 20g/L, peptone 20g/L, yeast powder 10g/L, agar powder 20g/L, and pH is natural.
(2) YPD liquid culture medium
Glucose 20g/L, peptone 20g/L, yeast powder 10g/L, and pH is natural.
(3) Starch culture medium
5g/L of soluble starch, 5g/L of peptone, 5g/L of yeast extract powder, 5g/L of sodium chloride, 1g/L of monopotassium phosphate, 0.5g/L of calcium chloride, 0.5g/L of magnesium sulfate, 0.05g/L of ferrous sulfate and natural pH. The solid culture medium is added with 20g/L agar powder.
The culture medium is sterilized at 121deg.C for 20min.
1.2 isolation, screening and identification of Strain
Pulverizing the distiller's yeast sample of Xiaoqu fen-flavor liquor with pulverizer, and making into powder. 5g of yeast powder is weighed and put into a 250mL triangular flask containing 95mL of sterile water and provided with glass beads, and the yeast powder and the water are fully mixed by shaking for 30min at 200r/min to prepare bacterial suspension. 1mL of the bacterial suspension is sucked from a triangular flask by a 1mL pipetting gun and injected into a test tube containing 9mL of sterile water to prepare 10 -1 The diluted yeast powder solutions are respectively prepared into 10 according to the same method and the like -2 、10 -3 And 10 -4 Diluted yeast powder solution. Then respectively from 10 -1 、10 -2 、 10 -3 And 10 -4 Absorbing 0.2mL of yeast powder solution in a dilution test tube, placing the yeast powder solution into a prepared sterile YPD (YP) culture dish, arranging two parallel samples for each gradient, uniformly coating bacterial liquid on a flat plate by using a sterile glass coating rod, then placing the flat plate on a test bed for 20-30 min to enable the bacterial liquid to permeate into the surface layer of a culture medium, and then placing the flat plate in a 30 ℃ incubator for culture. After culturing for 24-48 h, single colonies on the plates are picked out by a sterile inoculating loop, streaked and inoculated on another blank YPD plate, culturing is continued, and the initially purified colonies obtained after streaking of the plates for 2-3 times are transferred into a YPD inclined plane test tube for low-temperature preservation.
1.2.1 preliminary screening of enzyme-producing active Strain plates
And (3) inoculating the purified single strain to a starch culture medium, culturing, adding a proper amount of dilute iodine solution after bacterial colonies grow out, and observing whether transparent rings exist or not, wherein the bacterial colonies with obvious transparent rings are bacterial strains for primarily producing amylase enzyme activities.
1.2.2 liquid culture and re-screening of enzyme-producing active Strain
And (3) inoculating the strain with the primary screened amylase activity into a starch liquid culture medium for culture, centrifuging after the culture is finished, taking supernatant, and measuring the alpha-amylase activity to determine the strain producing the amylase activity.
TABLE 1 transparent circle method plate preliminary screening for enzyme activity of amylase produced by yeast
As is clear from Table 1, strain No. 3 gives the highest amylase activity, and the yeast strain with higher enzyme activity in distiller's yeast is initially determined, and the strain is stored in a laboratory strain library by glycerol tube and is numbered Y162. Y162 Yeast colony features: white, rounded protrusions, rough surface, micro-fluff, and dry, with neat outer edges, easy pick up of colonies, colony diameter d=3 mm, see fig. 1. The microscopic morphological characteristics of the culture for 30h in the YPD liquid culture medium are as follows: the cells are round or oval, and can form pseudomycelium and ascospores.
1.2.3 identification of species
And (3) carrying out molecular biological identification on the screened strain with higher enzyme activity, amplifying 18sRNA of the strain by utilizing a yeast specific classification identification primer, detecting by gel electrophoresis, and then carrying out sequencing comparison to determine the genus and species of the strain, thereby obtaining the saccule-covered yeast.
The sequence of the sacculus laminating yeast is as follows:
aaaaaaagggtataagttttagacctgcgcttactgcgcggtttaataaactcttatacacagtgtttttgtttgcgaattt ggtttagtttgttggttttcattcgaaaggatgaagattgattgctaaatcttattcagctttttaaactcagatctctttttaagagaa atgtatttttttaattacaactagtcgattttacaaactaaaagtttaaaactttcagcaacggatctcttggttctcgcatcgatga agaacgcagcgaattgcgataagtaatgtgaattgcagattttcgtgaatcatcgaatctttgaacgcatattgcgctctatagt attctatagagcatgcctgtttgagcgtcatttctctcttaaacctttgggtttagtattgaaggttgtgttagcttctgctaactcct ttgaaatgacttggcaattgattgagttttccatatatttgcttaaggatttaatattaggttctaccaacttattaaatacccttttgc gaaggacttactcgtgtatcaaggccttataactttgtcattaattttgacctcaaatcaggtaaggatacccgctgaacttaag catatcaataagccgggagaaaaggtattctgtttttttatttaaaaaaggggttaaatggggggttta。
1.2.4 comparison of enzyme Activity of different sources of the saccule-covered Yeast
Activating Y162 yeast and different source bursa tectorum yeast preserved in a strain library in YPD liquid culture medium, inoculating in starch culture medium, shake culturing, centrifuging to obtain supernatant as crude enzyme liquid, and measuring the enzyme activity of alpha-amylase. As can be seen from the results of FIG. 2, the conditions of the enzyme activities of the alpha-amylase produced by the saccule-coated yeasts of the same genus and different sources are different under the same culture conditions, the enzyme activity of the amylase produced by the saccule-coated yeast Y162 separated from the small yeast in the faint scent type is the highest, and the enzyme activity of the amylase produced by the saccule-coated yeast Y162 is 155.58U/mL, so that the yeast of the same genus is determined to be a strain with higher enzyme activity of the alpha-amylase produced by the yeast.
Since yeast plays a leading role in the white spirit brewing production process, the brewing environment has very important influence on the growth and metabolism of the yeast. In the process of brewing white spirit, the environment in which the yeast is positioned is changed at any time due to the continuous change of oxygen content, ethanol concentration, acidity, nutrient substances and the like in the fermented grains, so that the existence of the yeast is limited by various stress factors. Only when these stress conditions are met, fermentation can be smoothly performed. We performed a series of tolerance tests on Y162 yeast strains, as follows.
Y162 Yeast Strain tolerance test
1) Yeast activation
A ring of yeast cells was inoculated into 10mL of YPD liquid medium, and after stationary culture at 30℃for 3 days, 50. Mu.L of the cells were collected in each of the following media.
2) Tolerance test
a temperature resistance experiment
Preparing YPD liquid culture medium, sterilizing at 121deg.C for 20min, respectively taking 2mL culture solution in test tube, inoculating different sources of yeasts Y112, Y115, Y120, Y162, Y168 and Y231, respectively, standing at 25deg.C, 30deg.C, 37deg.C, 40deg.C, 45deg.C and 50deg.C for 4d, and measuring absorbance at 600 nm.
As can be seen from FIG. 3, when the temperature exceeded 30℃the yeast biomass decreased with increasing temperature, and when the temperature reached 40℃the strain died faster, and 45 and 50℃were almost no growth. The culture temperature of the sacculus laminating yeast is not higher than 40 ℃. And the heat resistance of yeasts from different sources is different to a certain extent, for example, the biomass of the saccule-covered yeast Y168 is the highest and the biomass of the saccule-covered yeast Y231 is the lowest at 40 ℃.
b alcohol resistance test
Preparing YPD liquid culture medium, sterilizing at 121deg.C for 20min, and adding absolute ethanol to obtain the alcohol concentrations in the culture medium respectively: 4%, 6%, 8%, 10%, 12% (v/v), respectively taking 3mL of culture solution into test tubes, correspondingly inoculating Y112, Y115, Y120, Y162, Y168 and Y231 6 strains of yeast, performing stationary culture at 30 ℃ for 4d, and measuring the concentration of bacteria at 600nm by using an enzyme-labeled instrument, wherein the test result is shown in FIG. 4.
The high concentration ethanol produced during fermentation process may poison the metabolism of yeast cells, and may cause the growth or death of yeast. As can be seen from fig. 4, the growth of yeast is inhibited with an increase in ethanol concentration, and when the ethanol concentration exceeds 6%, the yeast biomass decreases with an increase in ethanol concentration. Y115, Y168 and Y231 were tolerant to 8% ethanol concentration, and none of the remaining 3 yeasts were tolerant. When the ethanol concentration reached 10%, none of the yeasts could grow. The concentration of ethanol in the fermented grains in the later period of fermentation is not more than 6%, so that the saccule-buckling compound film yeast can endure the increase of the ethanol content in the fermentation process.
c lactic acid resistance test
Preparing YPD liquid culture medium, sterilizing at 121deg.C for 20min, cooling, and adding lactic acid to different acidity (% v/v): 4 (ph=2.90), 6 (ph=2.69), 8 (ph=2.54), 10 (ph=2.43), 12 (ph=2.32), respectively taking 3mL of culture solution into test tubes, correspondingly inoculating the strains Y112, Y115, Y120, Y162, Y168 and Y231 6, standing and culturing for 4d at 30 ℃, and then measuring the concentration of bacteria at 600nm by using an enzyme-labeled instrument, and the test results are shown in fig. 5.
Since high concentrations of acids reduce the metabolic rate of yeast cells, inhibiting or killing the cells and thus affecting the fermentation capacity. As can be seen from FIG. 5, the yeast with a coated saccule can grow at a lactic acid concentration of 1% (pH 3.55), and the yeast biomass is low (absorbance at about 0.1) at a lactic acid concentration of 4% (pH 2.87), i.e., the growth of the yeast with a coated saccule is inhibited at a pH lower than 3. The pH value of the fermented grains is about 4, so that the buckling and laminating yeast can adapt to the acidic environment of the fermented grains.
The invention also aims to provide a preparation method of the solid-state wine yeast containing the saccule-covered yeast, which comprises the following steps:
(1) Preparation of starter propagation and Yeast culture Medium
Soaking early long-shaped rice for 8-10h, pulping, and adding 20 mesh early-shaped rice powder and rice bran into rice pulp, wherein the early-shaped rice is prepared by the following steps: early rice flour: the weight ratio of rice bran is 63:35:2, and after uniformly stirring, rhizopus hypnoticus is inoculated, wherein the inoculation amount is 3.0-3.5% of the total weight of the long-shaped rice, the rice flour and the rice bran; kneading into cake-shaped curved blanks with the diameter of 6-7cm by hands, arranging the curved blanks on a wooden box in a culture room, covering a bamboo pad, wherein the distance between the curved blanks is about 2-3 cm; the temperature of the culture room is controlled at 30-32 ℃, and when the temperature of Qu Pipin is raised to 35 ℃, the bamboo mat is removed; continuously culturing until the temperature of the yeast blank Wen Jiangzhi is 25-28 ℃, and then drying the yeast blank at 35 ℃ to obtain the starter.
Weighing molasses, adding hot water with the volume of 85 ℃ which is2 times of the weight of the molasses, stirring until the molasses is dissolved to obtain a solution, adding concentrated sulfuric acid with the volume of 0.1 percent of the solution, stirring uniformly, standing for 12 hours, adding supernatant into a fermentation tank, and supplementing water until the sugar degree of a molasses culture medium is 10BX-15BX; weighing ammonium sulfate, urea, monoammonium phosphate, magnesium sulfate, yeast extract powder and defoamer according to the mass ratio of 2 per mill, 1 per mill, 2 per mill and 10 percent, pouring the mixture into a fermentation tank, adding water to 60 to 80 percent of the volume of the tank, starting stirring to completely dissolve nutrient salts, sterilizing and cooling to obtain the yeast culture medium.
(2) Preparation of pure strain microbial inoculum of saccule-covered yeast Y162
Weighing malt extract powder according to the proportion of 1g/100mL, dissolving the malt extract powder with water, subpackaging the malt extract powder into 1000mL triangular bottles, and sterilizing for later use, wherein the liquid filling amount of each bottle is 500 mL; inoculating pure culture of the saccule-covered yeast (Saccharomycopsis fibuligera) Y162 test tube with the preservation number of CCTCC No. M2022245 into a triangular flask, and shake culturing at 140rpm for 20-36h at 30 ℃; and (2) inoculating the triangular flask for culturing Y162 into a fermentation tank filled with the yeast culture medium prepared in the step (1), setting the dissolved oxygen amount of the fermentation tank to 45%, setting the pH value to be 3-5, culturing at the rotating speed of 100-500rpm and the temperature of 35 ℃ for 22 hours, inoculating into the sterilized bran culture medium, culturing at the temperature of 30 ℃ for 36 hours, and drying to prepare the Y162 pure strain microbial inoculum.
(3) Preparation of solid-state wine yeast of reinforced saccule-covered yeast
Pulverizing Guanyin soil, sieving with a 14-mesh sieve, sieving rice bran with a 16-mesh sieve, sieving the crushed seed yeast prepared in the step (1) with a 20-mesh sieve, mixing the crushed seed yeast prepared in the step (2) with pure Y162 bran yeast prepared in the step (2), stirring uniformly with rice bran, adding bentonite, and stirring uniformly, wherein the bentonite is: rice bran: and (3) yeast: the weight ratio of the pure yeast bran seeds is 75:25:1.4-1.8:0.7, and the mixture is obtained; adding water into the mixture to make the water content in the mixture be 50%; uniformly stirring, preparing the mixture into spherical yeast blank with diameter of 7-8cm, placing the prepared yeast blank in an incubator in a culture chamber, spreading a bamboo pad on the yeast blank, controlling the temperature of the culture chamber to be 28-30deg.C, and culturing for 16 hr; checking the temperature of the curved blank in the incubator, and uncovering the bamboo mat when the temperature of Qu Pipin is raised to 30-35 ℃ to prop up the incubator; when the temperature of the yeast blank is reduced to room temperature, picking up the yeast blanks, wherein the yeast blanks cannot be extruded mutually, and continuously culturing for 5 days; after the culture is finished, the yeast blank is placed in a drying room and dried at the temperature of 35-40 ℃ until the water content is less than or equal to 5%, and then the solid-state wine yeast of the reinforced buckling capsule laminated yeast Y162 is obtained.
The invention also aims to provide the application of the solid-state wine distiller's yeast of the saccule-buckling compound film yeast in the production of small-yeast fen-flavor liquor, which comprises the following steps:
(1) Preparation of Xiaoqu fen-flavor wine base
Soaking waxy sorghum in 70-80 ℃ water for 20 hours, performing primary steaming, stewing and re-steaming to obtain cooked grain, cooling to 30 ℃ after spreading and cooling the cooked grain, adding distiller's yeast of the reinforced capsule-buckling compound film yeast prepared in the step (3) according to 1% of inoculation amount, uniformly stirring the distiller's yeast and the grain, then delivering the mixture to a saccharification tank field for bacteria cultivation and saccharification, controlling the tank-loading temperature to be 23-28 ℃, controlling the temperature difference between upper, middle and lower grain layers to be not more than 2 ℃, and opening the tank after bacteria cultivation and saccharification for 22-26 hours. Adding the mixed grains according to the grain-grain ratio of 1:4-1:5, mixing uniformly, and adding 5.4m at low temperature 3 And (3) fermenting the mixture in a fermenting tank, wherein the temperature of the mixture entering the fermenting tank is controlled at 15-20 ℃. Fermenting the grain lees in a tank for 8 days to obtain Xiaoqu wine base. And the wine base brewed by the distiller's yeast without adding the saccule-buckling compound film yeast in the same time period is used as a control.
(2) Raw wine detection and data comparison analysis
Accurately transferring 1mL of the wine base obtained in the step (1) into a 2mL sample bottle, adding 10 mu L of a three internal standard use solution (tert-amyl alcohol (IS 1): 17028.1mg/L, n-amyl acetate (IS 2): 16864mg/L and 2-ethylhexanol (IS 3): 12104.2 mg/L), covering a bottle cap, shaking uniformly, and measuring the content of each component in the wine base by adopting a gas chromatography method. The chromatographic conditions are as follows: agilent 780A gas chromatograph, detector FID, CP-WAX capillary column (50 m 0.2 μm 0.25 mm). Heating program: the column temperature was maintained at 40℃for 8min and raised to 150℃at 5℃per min. The temperature of the sample inlet is 250 ℃, the temperature of the detector is 260 ℃, the flow rate ratio of air to hydrogen is 300:30, the carrier gas is nitrogen, the split ratio is 30:1, the flow rate of the column is 1.0mL/min, and the sample injection mode is as follows: an autosampler. The detection results are shown in FIG. 6.
As can be seen from FIG. 6, the ethyl acetate content in the enriched Y162 distiller's yeast wine reaches 2g/L, and the ethyl acetate content of the reference distiller's yeast is 1.33g/L, which is significantly improved by 50.37% (P < 0.01) compared with the reference; the wine rate and other chromatographic indexes are equivalent to those of the control. Therefore, the reinforced saccule-covered yeast Y162 has obvious advantages in ethyl acetate extraction on the basis of the original distiller's yeast, and the yeast has obvious promotion effect on the ethyl acetate extraction in the Xiaoqu fen-flavor wine base. And through the evaluation of professional evaluation personnel, the Xiaoqu original wine produced by the method has the advantages of pure fragrance, mellow and sweet taste, prominent ester fragrance, coordinated fragrance, clean and refreshing taste and typical style.
Examples
The application of the solid-state wine yeast of the reinforced saccule-buckling compound film yeast in the small yeast fen-flavor wine base comprises the following steps:
(1) Preparation of starter propagation and Yeast culture Medium
Soaking early long-shaped rice for 8-10h, pulping, and adding 20 mesh early-shaped rice powder and rice bran into rice pulp, wherein the early-shaped rice is prepared by the following steps: early rice flour: the weight ratio of rice bran is 63:35:2, and after uniform stirring, rhizopus hypnoticus is inoculated, wherein the inoculation amount is 3.2% of the total weight of the early long-shaped rice, the rice flour and the rice bran; kneading into cake-shaped curved blanks with the diameter of 6-7cm by hands, arranging the curved blanks on a wooden box in a culture room, covering a bamboo pad, wherein the distance between the curved blanks is about 2-3 cm; the temperature of the culture room is controlled at 30-32 ℃, and when the temperature of Qu Pipin is raised to 35 ℃, the bamboo mat is removed; continuously culturing until the temperature of the yeast blank Wen Jiangzhi is 25-28 ℃, and then drying the yeast blank at 35 ℃ to obtain the starter.
Weighing molasses, adding hot water with the volume of 85 ℃ which is2 times of the weight of the molasses, stirring until the molasses is dissolved to obtain a solution, adding concentrated sulfuric acid with the volume of 0.1 percent of the solution, stirring uniformly, standing for 12 hours, adding supernatant into a fermentation tank, and supplementing water until the sugar degree of a molasses culture medium is 10BX-15BX; weighing ammonium sulfate, urea, monoammonium phosphate, magnesium sulfate, yeast extract powder and defoamer according to the mass ratio of 2 per mill, 1 per mill, 2 per mill and 10 percent, pouring the mixture into a fermentation tank, adding water to 60 to 80 percent of the volume of the tank, starting stirring to completely dissolve nutrient salts, sterilizing and cooling to obtain the yeast culture medium.
(2) Preparation of pure strain microbial inoculum of saccule-covered yeast Y162
Weighing malt extract powder according to the proportion of 1g/100mL, dissolving the malt extract powder with water, subpackaging the malt extract powder into 1000mL triangular bottles, and sterilizing for later use, wherein the liquid filling amount of each bottle is 500 mL; inoculating pure culture of the saccule-covered yeast (Saccharomycopsis fibuligera) Y162 test tube with the preservation number of CCTCC No. M2022245 into a triangular flask, and shake culturing at 30 ℃ for 30h at 140 rpm; and (2) inoculating the triangular flask for culturing Y162 into a fermentation tank filled with the yeast culture medium prepared in the step (1), setting the dissolved oxygen amount of the fermentation tank to 45%, the pH=4, culturing at the rotating speed of 400rpm and the temperature of 35 ℃ for 22 hours, inoculating into the sterilized bran culture medium, culturing at the temperature of 30 ℃ for 36 hours, and drying to prepare the pure strain Y162 microbial inoculum.
(3) Preparation of solid-state wine yeast of reinforced saccule-covered yeast
Pulverizing Guanyin soil, sieving with a 14-mesh sieve, sieving rice bran with a 16-mesh sieve, sieving the crushed seed yeast prepared in the step (1) with a 20-mesh sieve, mixing the crushed seed yeast prepared in the step (2) with pure Y162 bran yeast prepared in the step (2), stirring uniformly with rice bran, adding bentonite, and stirring uniformly, wherein the bentonite is: rice bran: and (3) yeast: the weight ratio of the pure yeast bran seeds is 75:25:1.6:0.7, and a mixture is obtained; adding water into the mixture to make the water content in the mixture be 50%; uniformly stirring, preparing the mixture into spherical yeast blank with diameter of 7-8cm, placing the prepared yeast blank in an incubator in a culture chamber, spreading a bamboo pad on the yeast blank, controlling the temperature of the culture chamber to be 28-30deg.C, and culturing for 16 hr; checking the temperature of the curved blank in the incubator, and uncovering the bamboo mat when the temperature of Qu Pipin is raised to 30-35 ℃ to prop up the incubator; when the temperature of the yeast blank is reduced to room temperature, picking up the yeast blanks, wherein the yeast blanks cannot be extruded mutually, and continuously culturing for 5 days; after the culture is finished, the yeast blank is placed in a drying room and dried at the temperature of 35-40 ℃ until the water content is less than or equal to 5%, and then the solid-state wine yeast containing the saccule-covered yeast Y162 is obtained.
(4) Preparation of Xiaoqu fen-flavor wine base
Soaking waxy sorghum in 70-80 ℃ water for 20 hours, performing primary steaming, stewing and re-steaming to obtain cooked grain, cooling to 30 ℃ after spreading and cooling the cooked grain, adding distiller's yeast of the reinforced capsule-buckling compound film yeast prepared in the step (3) according to 1% of inoculation amount, uniformly stirring the distiller's yeast and the grain, then delivering the mixture to a saccharification tank field for bacteria cultivation and saccharification, controlling the tank-loading temperature to be 23-28 ℃, controlling the temperature difference between upper, middle and lower grain layers to be not more than 2 ℃, and opening the tank after bacteria cultivation and saccharification for 24 hours. Adding the mixed grains according to the grain-grain ratio of 1:4, mixing uniformly, and adding 5.4m at low temperature 3 And (3) fermenting the mixture in a fermenting tank, wherein the temperature of the mixture entering the fermenting tank is controlled at 18 ℃. Fermenting the grain lees in a pool, fully and uniformly stirring, wherein the fermentation period is 8 days, and distilling to obtain the Xiaoqu wine base. And the wine base brewed by the distiller's yeast without adding the saccule-buckling compound film yeast in the same time period is used as a control. 1mL of the obtained wine base was accurately transferred into a 2mL sample bottle, 10. Mu.L of a triple internal standard use solution (tert-amyl alcohol (IS 1): 17028.1mg/L, n-amyl acetate (IS 2): 16864mg/L, 2-ethylhexanol (IS 3): 12104.2 mg/L) was added, the bottle cap was covered, shaking was carried out, and the content of each component in the wine base was measured by gas chromatography. The chromatographic conditions are as follows: agilent 780A gas chromatograph, detector FID, CP-WAX capillary column (50 m 0.2 μm 0.25 mm). Heating program: the column temperature was maintained at 40℃for 8min and raised to 150℃at 5℃per min. The temperature of the sample inlet is 250 ℃, the temperature of the detector is 260 ℃, the flow rate ratio of air to hydrogen is 300:30, the carrier gas is nitrogen, the split ratio is 30:1, the flow rate of the column is 1.0mL/min, and the sample injection mode is as follows: an autosampler. The result shows that the content of ethyl acetate in the wine produced by the reinforced saccule-covered composite film yeast Y162 distiller's yeast reaches 2g/L.
The ethyl acetate content of the distiller's yeast of the present synchronous non-use wine of the strain of the company is 1.33g/L, the buckle capsule compound film yeast (Saccharomycopsis fibuligera) Y162 with the preservation number of CCTCC No. M2022245 is applied to the production of the light-flavor distiller's yeast raw wine according to the method of the example 1, and compared with the prior method, the ethyl acetate content is obviously improved by 50.37%. The Xiaoqu original wine produced by the method is faint scent and pure, mellow and sweet in taste, prominent in ester fragrance, coordinated in fragrance, clean and refreshing in tail and typical in style. The method shows that the buckling bag laminated yeast Y162 microbial inoculum is matched with the traditional distiller's yeast to obviously improve the quality of the wine, so that the content of main aroma components in the small-yeast fen-flavor base wine is obviously increased, the aroma in the wine is more coordinated, and the taste is better.
Claims (7)
1. The saccule covered yeast (Saccharomycopsis fibuligera) Y162 is preserved in China center for type culture Collection with a preservation date of 2022, 3 and 10 days and a preservation number of CCTCC No. M2022245.
2. A method for preparing solid brewing distiller's yeast containing the saccule-covered yeast of claim 1, which is characterized by comprising the following steps:
(1) Preparation of starter propagation and Yeast culture Medium
Soaking early long-shaped rice for 8-10h, pulping, adding early long-shaped rice powder and rice bran which are sieved by a 20-mesh sieve into rice pulp, uniformly stirring, and inoculating rhizopus hypnoticus, wherein the inoculation amount is 3.0-3.5% of the total weight of the early long-shaped rice, the rice flour and the rice bran; kneading into cake-shaped curved blanks with the diameter of 6-7cm by hands, arranging the curved blanks on a wooden box in a culture room, covering a bamboo pad, wherein the distance between the curved blanks is 2-3 cm; the temperature of the culture room is controlled at 30-32 ℃, and when the temperature of Qu Pipin is raised to 35 ℃, the bamboo mat is removed; continuously culturing until the temperature of the yeast blank Wen Jiangzhi is 25-28 ℃, and then drying the yeast blank at 35 ℃ to obtain the yeast;
weighing molasses, adding hot water with the volume of 85 ℃ which is2 times of the weight of the molasses, stirring until the molasses is dissolved to obtain a solution, adding concentrated sulfuric acid with the volume of 0.1 percent of the solution, stirring uniformly, standing for 12 hours, adding supernatant into a fermentation tank, and supplementing water until the sugar degree of a molasses culture medium is 10BX-15BX; weighing ammonium sulfate, urea, monoammonium phosphate, magnesium sulfate, yeast extract and defoamer according to the mass percentage of 0.2%, 0.1%, 0.2% and 10%, pouring into a fermentation tank, adding water to 60-80% of the tank volume, starting stirring to completely dissolve nutrient salts, sterilizing and cooling to obtain a yeast culture medium;
(2) Preparation of pure strain microbial inoculum of saccule-covered yeast Y162
Weighing malt extract powder according to the proportion of 1g/100mL, dissolving the malt extract powder with water, subpackaging the malt extract powder into 1000mL triangular bottles, and sterilizing for later use, wherein the liquid filling amount of each bottle is 500 mL; inoculating pure culture of the saccule-covered yeast (Saccharomycopsis fibuligera) Y162 test tube with the preservation number of CCTCC No. M2022245 into a triangular flask, and shake culturing at 140rpm for 20-36h at 30 ℃; inoculating the triangular flask for culturing Y162 into a fermentation tank filled with the yeast culture medium prepared in the step (1) for fermentation, inoculating the fermentation tank into the sterilized bran culture medium, culturing at 30 ℃ for 36h, and drying to prepare the Y162 pure strain microbial inoculum;
(3) Preparation of solid-state wine yeast of reinforced saccule-covered yeast
Pulverizing Guanyin soil, sieving with 14 mesh sieve, sieving rice bran with 16 mesh sieve, pulverizing the seed yeast prepared in step (1), and sieving with 20 mesh sieve; uniformly mixing and stirring the Y162 pure strain microbial inoculum prepared in the step (2) with rice bran and yeast, and then adding kaolin to uniformly stir, wherein the kaolin is prepared by the following steps: rice bran: and (3) yeast: the weight ratio of the pure strain microbial inoculum of Y162 is 75:25:1.4-1.8:0.7, and the mixture is obtained; adding water into the mixture to make the water content in the mixture be 50%; uniformly stirring, preparing the mixture into spherical yeast blank with the diameter of 7-8cm, orderly placing the prepared yeast blank in an incubator in a culture room, and paving a bamboo mat on the yeast blank for culture; after the culture is finished, the yeast blank is placed in a drying room and dried at the temperature of 35-40 ℃ until the water content is less than or equal to 5%, and then the solid-state wine yeast of the reinforced buckling capsule laminated yeast Y162 is obtained.
3. The process according to claim 2, characterized in that in step (1) the rice is long-grained nonglutinous: early rice flour: the weight ratio of rice bran is 63:35:2.
4. The method according to claim 2, wherein in the step (2), the dissolved oxygen amount of the fermenter is set to 45%, ph=3 to 5, the rotation speed is 100 to 500rpm, the temperature is 35 ℃, and the cultivation is performed for 22 hours.
5. The method according to claim 2, wherein the temperature of the culture chamber is controlled to be 28-30 ℃ in the step (3), and the culture is performed for 16 hours; checking the temperature of the curved blank in the incubator, and uncovering the bamboo mat when the temperature of Qu Pipin is raised to 30-35 ℃ to prop up the incubator; when the temperature of the yeast blank is reduced to room temperature, the yeast blank is picked up, the yeast blanks cannot be extruded mutually, and the culture is continued for 5 days.
6. The application of the solid brewing distiller's yeast prepared by the method of any one of claims 2-5 in the production of small-distiller's yeast fen-flavor liquor, which is characterized by comprising the following steps:
soaking waxy sorghum in 70-80 ℃ water for 20 hours, performing primary steaming, stewing and re-steaming to obtain cooked grain, cooling the cooked grain to 30 ℃, adding the solid-state wine yeast of the reinforced capsule-covered film-covered yeast Y162 prepared in the step (3) according to the inoculation amount of 0.8-1.2%, uniformly stirring the solid-state wine yeast of the reinforced capsule-covered film-covered yeast Y162 and the grain, and then delivering the mixture to a saccharification tank field for bacteria cultivation and saccharification; adding the mixed grains according to the grain-grain ratio of 1:4-1:5, mixing uniformly, and putting into a fermentation tank at low temperature, wherein the temperature of putting into the tank is controlled at 15-20 ℃; fermenting the grain lees in a pool, fully and uniformly stirring, wherein the fermentation period is 8 days, and distilling to obtain the Xiaoqu wine base.
7. The method according to claim 6, wherein the temperature of the container is controlled to be 23-28 ℃ in the saccharification process, the temperature difference between the upper grain layer, the middle grain layer and the lower grain layer is not more than 2 ℃, and the container is opened after saccharification by bacteria culture for 22-26 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210501009.5A CN114940951B (en) | 2022-05-10 | 2022-05-10 | Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210501009.5A CN114940951B (en) | 2022-05-10 | 2022-05-10 | Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114940951A CN114940951A (en) | 2022-08-26 |
| CN114940951B true CN114940951B (en) | 2023-05-05 |
Family
ID=82907439
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210501009.5A Active CN114940951B (en) | 2022-05-10 | 2022-05-10 | Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114940951B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107189952A (en) * | 2017-07-04 | 2017-09-22 | 中国食品发酵工业研究院 | A kind of saccharomycopsis fibuligera and its application in high temperature Daqu production |
| CN107475030A (en) * | 2017-10-12 | 2017-12-15 | 绍兴文理学院 | A kind of production technology of purebred Chinese yeast |
| CN112662575A (en) * | 2021-01-28 | 2021-04-16 | 武汉轻工大学 | Saccharomycetes fibuligera with high protease activity and high wine yield, and composition and application thereof |
| CN114250157A (en) * | 2021-11-17 | 2022-03-29 | 华南农业大学 | Saccharomycopsis fibuligera cx-3 strain for high yield of aroma substances and application thereof |
-
2022
- 2022-05-10 CN CN202210501009.5A patent/CN114940951B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107189952A (en) * | 2017-07-04 | 2017-09-22 | 中国食品发酵工业研究院 | A kind of saccharomycopsis fibuligera and its application in high temperature Daqu production |
| CN107475030A (en) * | 2017-10-12 | 2017-12-15 | 绍兴文理学院 | A kind of production technology of purebred Chinese yeast |
| CN112662575A (en) * | 2021-01-28 | 2021-04-16 | 武汉轻工大学 | Saccharomycetes fibuligera with high protease activity and high wine yield, and composition and application thereof |
| CN114250157A (en) * | 2021-11-17 | 2022-03-29 | 华南农业大学 | Saccharomycopsis fibuligera cx-3 strain for high yield of aroma substances and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 唐洁等.绿衣观音土曲培养过程中微生物及酶系的动态变化.《中国酿造》.2020,第39卷(第5期),97-104. * |
| 王居伟 ; 韩培杰 ; 王雪薇 ; 周森 ; 王勇 ; 蔚慧欣 ; 梁振荣 ; 白逢彦 ; .白酒发酵过程中常见酵母菌扣囊复膜酵母的研究进展.广西科学.2020,(第01期),全文. * |
| 苏畅 ; 马莹莹 ; 杨建刚 ; .扣囊复膜酵母在酿酒中的应用研究进展.食品研究与开发.2018,(第01期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114940951A (en) | 2022-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11242502B2 (en) | Low urea-producing and flavor-producing Wickerhamomyces anomalus strain and use thereof in food production | |
| JP2019526228A (en) | Yeast strain for sake brewing producing high yield of β-phenethyl alcohol and use thereof | |
| CN106701518B (en) | Daqu strengthening method for reducing Daqu dosage and improving vinegar quality | |
| CN106635820B (en) | A kind of Aspergillus niger strain of high yield theabrownin and its application | |
| CN108330075B (en) | High-yield ethyl acetate yeast and application thereof in mechanized fen-flavor Xiaoqu liquor | |
| WO2023104005A1 (en) | Ester-producing yeast strain and use thereof | |
| CN107012103B (en) | Low-yield fusel oil yeast and application thereof in mechanical production of Xiaoqu raw wine | |
| CN109401989A (en) | A kind of acclimation method of an industrial strain of S.cerevisiae | |
| CN112662575B (en) | Saccharomycetes capulae with high protease activity and high liquor yield, and composition and application thereof | |
| CN107177519A (en) | Schizosaccharomyces pombe bacterium, its composition and application | |
| CN106753994B (en) | Method for improving alcohol content of alcohol fermentation liquor and reducing isoamyl alcohol content by using high-ester-yield indigenous aroma-producing yeast enhanced yeast | |
| CN113278536B (en) | Low-yield n-propanol Kluyveromyces marxianus and application thereof in fen-flavor Xiaoqu liquor | |
| CN109971661B (en) | Ester-producing yeast ZB406 and application thereof | |
| CN108179119B (en) | Fermentation process for improving aroma quality of ice wine by using non-saccharomyces cerevisiae | |
| CN106591160A (en) | Compound Xiaoqu and Xiaoqu Baijiu production method | |
| CN109456904A (en) | It is a kind of produce ethyl acetate yeast and its application | |
| CN110317734B (en) | Monascus with high yields of saccharifying enzyme, esterifying enzyme and protease and separation culture method and application thereof | |
| CN114940951B (en) | Sack-coating film yeast and application thereof in Xiaoqu fen-flavor wine base | |
| CN110699208A (en) | Method for producing white spirit by fermentation of eurotium shigaensis | |
| CN102643754B (en) | Aspergillus oryzae and application thereof in aspect of improving yield of alcohol | |
| CN109486693A (en) | A kind of S. cervisiae and its purposes in alcohol fermentation | |
| CN114181842B (en) | Saccharomycopsis fibuligera cx-3 strain for converting anthocyanin to produce protocatechuic acid and application thereof | |
| CN113528361B (en) | Saccharomyces cerevisiae suitable for brewing rice wine by liquefaction method and application thereof | |
| CN115197858B (en) | Application of high-yield ethyl acetate Fei Bien pichia pastoris in fen-flavor Xiaoqu liquor | |
| CN109198578A (en) | A method of high concentration esters blending liquor is prepared using soybean-flavor liquor by-product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |