CN114966013A

CN114966013A - Enzyme linked immunosorbent assay kit for detecting African swine fever virus antigen and application thereof

Info

Publication number: CN114966013A
Application number: CN202210505402.1A
Authority: CN
Inventors: 董春娜; 张蕾; 李静; 毕建敏; 李鹏宇; 于之清; 宋芳; 石守定; 刘伟; 刘鹏; 肖进; 齐鹏
Original assignee: China Animal Husbandry Industry Co Ltd
Current assignee: China Animal Husbandry Industry Co Ltd
Priority date: 2022-05-10
Filing date: 2022-05-10
Publication date: 2022-08-30

Abstract

The invention discloses an African swine fever virus antigen detection enzyme-linked immunosorbent assay kit and application thereof. The kit comprises an enzyme-linked reaction plate coated by a monoclonal antibody which can be specifically combined with the antigen of the CSFV and is used as a capture antibody, and an enzyme-labeled antibody which is prepared by a monoclonal antibody which is specifically combined with the antigen of the CSFV and is used as a detection antibody. The double-antibody sandwich enzyme-linked immunoassay kit prepared by two specific monoclonal antibodies of the African swine fever virus has the advantages of no cross reaction with other viruses when the kit is used for detection, high sensitivity and strong specificity, and can effectively detect the content of the African swine fever virus antigen.

Description

Enzyme linked immunosorbent assay kit for detecting African swine fever virus antigen and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to an African swine fever virus antigen detection enzyme-linked immunoassay kit which is suitable for specific, rapid and accurate detection of an African swine fever virus antigen.

Background

African Swine Fever (ASF) is a legal report animal epidemic disease specified by OIE, is an acute, febrile and highly contact infectious disease of pigs caused by African Swine Fever Virus (ASFV), and is clinically characterized by high fever, reticuloendothelial system hemorrhage and high mortality. The pig feed is introduced into China for the first time in 2018, and due to high lethality and high infectivity, huge loss is caused to the pig industry in China, so that the pig feed in China is greatly influenced. Epidemic situations are reported in a plurality of provinces and markets so far, and an African swine fever antibody detection kit is urgently needed in the market and is used for diagnosis and prevention of the disease.

The ASFV is a large and enveloped double-stranded DNA virus, the average particle diameter is about 200nm, the size of the virus genome is 170-190 kb, more than 150 main open reading frames are provided, and the ASFV can encode 150-200 proteins, wherein the p30 protein is one of the main structural proteins of the virus, is encoded by a CP204L gene, is positioned in the virus inner membrane, is an early-stage expression protein of the virus, can induce an organism to generate a neutralizing antibody, has good immunogenicity, and can realize effective detection at the early stage of virus infection.

The existing detection of African swine fever is divided into two types, one is pathogen detection; another is antibody detection. There are two methods for detecting pathogens, one is a molecular biological method, which detects nucleic acids of viruses; another is an immunological method, which detects protein antigens of viruses. Enzyme-Linked immunosorbent assay (ELISA) is a mainstream immunoassay technology in the market, is widely applied to clinical detection, is rapid and convenient, and has high sensitivity, at present, a common African swine fever virus antigen detection method is a series of detection methods established based on a PCR technology, depends on the specificity of a primer and a probe for detection, needs nucleic acid extraction, and has the defect that aerosol pollution of nucleic acid is easily caused to cause false positive results, so that the antigen detection by the ELISA double-antibody sandwich method is more accurate and reliable. The monoclonal antibody is an antibody which is generated by a single B cell clone, is highly uniform and only aims at a certain specific epitope, has stronger specificity, good uniformity and high purity, and an enzyme-linked immunosorbent assay established based on the monoclonal antibody technology can be used for antigen detection of African swine fever viruses.

Disclosure of Invention

The invention aims to establish an enzyme-linked immunosorbent assay kit for African swine fever virus antigen detection, the kit uses a monoclonal antibody ASF-3C12 which can be specifically combined with the African swine fever virus antigen as a capture antibody, and uses an enzyme-labeled antibody which is prepared by using a monoclonal antibody ASF-4F5 which can be specifically combined with the African swine fever virus antigen as a detection antibody, and a detection method for the African swine fever virus antigen with good specificity, sensitivity and repeatability is established, and the enzyme-linked immunosorbent assay kit is used for detecting including but not limited to suspected African swine fever virus infected swine serum or blood samples and African swine fever inactivated antigens.

Based on the aim, the African swine fever virus antigen detection enzyme linked immunosorbent assay kit comprises an enzyme linked immunosorbent assay plate coated by a monoclonal antibody ASF-3C12 specifically bound with the African swine fever virus antigen; the enzyme-labeled antibody is prepared by taking another monoclonal antibody ASF-4F5 which can be specifically combined with the antigen of the African swine fever virus as a detection antibody. The enzyme-labeled antibody is preferably an antibody labeled by a horseradish-labeled enzyme, and the horseradish peroxidase can be crosslinked on the antibody by a glutaraldehyde method or a periodic acid method.

Preferably, the capture antibody (monoclonal antibody ASF-3C12) is a heavy chain variable region-containing ASF-3C12-V _H And light chain variable region ASF-3C12-V _L (ii) a The ASF-3C12-V _H And said ASF-3C12-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-3C12-V _H And said ASF-3C12-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-3C12-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-84 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR3 is shown as amino acids 117-126 of SEQ ID No. 1; the ASF-3C12-V _L The amino acid sequence of the CDR1 is shown as amino acids 46-55 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of the CDR2 is shown as amino acids 71-77 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of CDR3 is shown as amino acids 110-118 of SEQ ID No. 2.

The detection antibody (monoclonal antibody ASF-4F5) contains heavy chain variable region ASF-4F5-V _H And light chain variable region ASF-4F5-V _L (ii) a The ASF-4F5-V _H And said ASF-4F5-V _L All of the determinant complementarity regions of (a) consist of CDR1, CDR2 and CDR 3; the ASF-4F5-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 3; the ASF-4F5-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-85 of SEQ ID No. 3; the ASF-4F5-V _H The amino acid sequence of the CDR3 is shown as amino acids 118-125 of SEQ ID No. 3; the ASF-4F5-V _L The amino acid sequence of the CDR1 is shown as amino acids 44-60 of SEQ ID No. 4; the ASF-4F5-V _L Ammonia of CDR2 ofThe amino acid sequence is shown as amino acids 76-82 of SEQ ID No. 4; the ASF-4F5-V _L The amino acid sequence of CDR3 is shown as amino acids 115-123 of SEQ ID No. 4.

Preferably, the ASF-3C12-V _H The amino acid sequence of (A) is shown as 1 st to 137 th sites of SEQ ID No.1 in a sequence table; the ASF-3C12-V _L The amino acid sequence of (A) is shown as 1 st to 128 th sites of SEQ ID No.2 in the sequence table.

Preferably, the ASF-4F5-V _H The amino acid sequence of (A) is shown as 1 st to 136 th sites of SEQ ID No.3 in a sequence table; the ASF-4F5-V _L The amino acid sequence of (A) is shown as 1 st to 133 th sites of SEQ ID No.4 in the sequence table.

The optimal coating preparation method and conditions of the ELISA plate are that a specific monoclonal antibody ASF-3C12 of African swine fever virus is diluted into 1-10 mu g/ml coating working solution by using a carbonate solution with pH of 9.6, then the coating working solution is added into a 96-hole polystyrene ELISA plate, 100 mu l/hole is placed for 8-12 hours at 2-8 ℃, so that the specific monoclonal antibody ASF-3C12 is fully combined with the ELISA plate, then PBS buffer solution containing 10mg/ml bovine serum albumin pH7.4 is added into the solution according to 300 mu l/hole, sealing treatment is carried out for 2-3 hours at 37 ℃, and after drying, the ELISA plate is sealed and stored at 2-8 ℃.

Preferably, the kit further comprises an antigen standard substance, wherein the antigen standard substance is African swine fever p30 purified protein, the antigen content is 4 mu g/ml, the antigen standard substance is diluted by a sample diluent (1: 20-1: 1280) in a multiplying mode when in use, and the measured OD is _450nm Values were used to plot a standard curve.

The kit is a double-antibody sandwich enzyme-linked immunoassay kit prepared by using a specific monoclonal antibody of the African swine fever virus, and the antigen content of the African swine fever virus in a sample is detected by detecting the signal change generated by an enzyme catalytic substrate.

Furthermore, the kit also comprises a sample diluent, a 20-time concentrated washing solution, a substrate solution A, a substrate solution B and a stop solution. The enzyme-linked reaction plate is a detachable 96-hole enzyme label plate. The sample diluent was a phosphate buffer solution containing 5mg/ml casein and having a value of 0.01M, pH of 7.4. The 20-time concentrated washing solution is 0.01M phosphate buffer solution with the pH value of 7.4 and contains 0.8-1.2% (ml/ml) of Tween-20. The substrate solution A is a citrate phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, and the substrate solution B is a tetramethylbenzidine solution containing 0.2mg/ml, and the substrate solution A and the substrate solution B are mixed in a ratio of 1:1 when in use. The stop solution is a 2mol/L sulfuric acid solution.

The invention also claims a monoclonal antibody which can be specifically combined with the antigen of the African swine fever virus and is the monoclonal antibody described in any one of the following items:

1) contains heavy chain variable region ASF-3C12-V _H And light chain variable region ASF-3C12-V _L (ii) a The heavy chain variable region is ASF-3C12-V _H And light chain variable region ASF-3C12-V _L Both consist of a determinant complementary region and a framework region; the ASF-3C12-V _H And said ASF-3C12-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-3C12-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-84 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR3 is shown as amino acids 117-126 of SEQ ID No. 1; the ASF-3C12-V _L The amino acid sequence of the CDR1 is shown as amino acids 46-55 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of the CDR2 is shown as amino acids 71-77 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of CDR3 is shown as amino acids 110-118 of SEQ ID No. 2.

2) Containing heavy chain variable region ASF-4F5-V _H And light chain variable region ASF-4F5-V _L (ii) a The heavy chain variable region is ASF-4F5-V _H And light chain variable region ASF-4F5-V _L Both consist of a determinant complementary region and a framework region; the ASF-4F5-V _H And said ASF-4F5-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-4F5-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 3; the ASF-4F5-V _H The amino acid sequence of the CDR2 is shown as the amino acids 69-85 of SEQ ID No.3Amino acid is shown in the specification; the ASF-4F5-V _H The amino acid sequence of the CDR3 is shown as amino acids 118-125 of SEQ ID No. 3; the ASF-4F5-V _L The amino acid sequence of the CDR1 is shown as amino acids 44-60 of SEQ ID No. 4; the ASF-4F5-V _L The amino acid sequence of the CDR2 is shown as amino acids 76-82 of SEQ ID No. 4; the ASF-4F5-V _L The amino acid sequence of CDR3 is shown as amino acids 115-123 of SEQ ID No. 4.

3) Contains heavy chain variable region ASF-3C12-V _H And light chain variable region ASF-3C12-V _L (ii) a The ASF-3C12-V _H The amino acid sequence of (A) is shown as 1 st to 137 th sites of SEQ ID No.1 in a sequence table; its ASF-3C12-V _L The amino acid sequence of (A) is shown as 1 st to 128 th sites of SEQ ID No.2 in a sequence table.

4) Containing heavy chain variable region ASF-4F5-V _H And light chain variable region ASF-4F5-V _L (ii) a The ASF-4F5-V _H The amino acid sequence of (A) is shown as 1 st to 136 th sites of SEQ ID No.3 in a sequence table; its ASF-4F5-V _L The amino acid sequence of (A) is shown as 1 st to 133 th sites of SEQ ID No.4 in the sequence table.

The heavy chain variable region and the light chain variable region sequences can be connected with animal-derived constant regions (such as heavy chain and light chain constant regions of a murine antibody) to prepare the monoclonal antibody capable of being specifically combined with the CSFV.

The application of the enzyme linked immunosorbent assay kit in the detection of the African swine fever virus antigen also belongs to the protection scope of the invention.

The application of the monoclonal antibody capable of being specifically combined with the African swine fever virus antigen in preparing the kit for detecting the African swine fever virus also belongs to the protection scope of the invention.

The method for obtaining the monoclonal antibody capable of being specifically combined with the antigen of the nonserial swine fever virus comprises the following steps: screening the African swine fever virus specific monoclonal cell strain according to a conventional method known in the art, determining the gene sequence of the specific monoclonal cell strain by adopting a gene sequencing method, and preparing a stably expressed monoclonal antibody as the capture monoclonal antibody and the detection monoclonal antibody of the invention by utilizing a method of gene synthesis and construction of a recombinant expression vector.

Specifically, the monoclonal antibody specific to African swine fever virus of the invention can comprise the following steps: 1) expression and identification of African swine fever virus p30 protein: according to the GenBank report (MK238347.1) p30 gene sequence, after codon optimization, the gene is synthesized, cloned and constructed into a pET-28a (+) prokaryotic expression vector, BL21(DE3) competent cells are transformed, positive clones are screened, and purified African swine fever virus p30 protein (the GenBank number is QAU54739.1) is obtained through induced expression.

2) Immunizing animals with African swine fever p30 protein as immunogen for 4 times, with interval of 14 days, the first 3 times adopting multi-point subcutaneous immunization mode, the 4 th time adopting intraperitoneal injection immunization mode, and each time 10 μ g/animal;

3) separating splenocytes from immune animals, fusing the splenocytes with myeloma cells, screening hybridoma cells by using HAT selective culture medium, and screening specific positive clones from the supernatant of the hybridoma cells by using an indirect ELISA method; when the serum antibody level of the immunized animal is detected by indirect ELISA with a titer exceeding 1:50000, spleen cells of the animal can be separated and prepared into a single cell suspension, and fused with myeloma cells (preferably mouse myeloma cells SP2/0) under the induction of a suitable fusing agent (such as polyethylene glycol) to form hybridomas, then cultured in HAT medium to screen the fused hybridoma cells, and further the desired specific monoclonal antibody cell strain can be identified by using indirect ELISA or the like, and the monoclonal cell strain secreting ASF-3C12 and the monoclonal cell strain secreting ASF-4F5 are preferably paired to detect the African swine fever virus antigen.

4) Extracting total RNA of the specific positive clone hybridoma cell strain: taking 250 mu l of hybridoma cell suspension, adding 750 mu l of Trizol, turning upside down and mixing evenly, adding 200 mu l of chloroform, mixing evenly, and centrifuging at 12000rpm at 4 ℃ for 15 min. The supernatant was pipetted into a new 1.5ml EP tube, 600. mu.l of isopropanol was added, mixed well and centrifuged for 10 min. The isopropanol was discarded, washed with 75% DEPC ethanol and centrifuged. The ethanol was discarded, oven dried and the RNA was dissolved in 20. mu.l of RNase-free water.

5) Reverse transcription,PCR amplification and gene sequencing: reverse transcription was performed using the Invitrogen reverse transcription kit as per the instructions to obtain cDNA for hybridoma cells. For the heavy chain (V) _H -1：5’-GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG-3’；V _H -2: 5'-ATGTCGACTGAGGAGACGGTGACCAGGGTGCC-3') and light chain (V) _L -1：5’-GTGAATTCATGGACATTGTGATGACCCAGTCTCC-3’；V _L -2: 5'-CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC-3') designing universal primer for variable region, amplifying target segment with amplification primer, recovering segment after amplification, and connecting with carrier for sequence determination to obtain sequence information of heavy chain and light chain variable region of monoclonal antibody.

6) Synthesis of gene sequence of specific monoclonal antibody, construction of shuttle vector, screening and extraction of recombinant Bacmid, and rescue of recombinant baculovirus: synthesis of gene sequence: according to the determined sequences of the heavy and light chain variable regions of the monoclonal antibodies ASF-3C12 and ASF-4F5, the sequences of the heavy and light chain constant regions of the murine antibody were supplemented in the variable region part, and then sent to Meitai and company, Beijing, for gene sequence synthesis and insect cell codon optimization. Secondly, constructing a shuttle vector: designing corresponding primers according to the sequence information of the heavy chain and the light chain and the sequence information of a pFastBacdual vector, amplifying full-length fragments of the heavy chain and the light chain, and connecting the recovered gel into the pFastBacdual vector by a homologous recombination method, wherein the pFastBacdual vector contains two promoters, namely a PH promoter and a P10 promoter, and performing sequence determination after connecting the pFastBacdual vector into the vector to ensure the accuracy of the sequence. Screening and extracting recombined Bacmid: transforming DH10Bac competence by the constructed shuttle vector, coating a three-resistance plate (kanamycin, gentamicin and tetracycline), culturing for 48h in an incubator at 37 ℃, picking out white spots, identifying, selecting clone shake bacteria completely without 300bp bands, extracting Bacmid by an isopropanol precipitation method after 12h, and then determining the concentration by using Nanodrop. Rescue of recombinant baculovirus: density was 2X 10 before transfection ⁶ The SF9 cells are laid on a six-hole plate, recombinant Bacmid is transfected according to the quantity of 5 mu g and 2.5 mu g, the dosage of a transfection reagent is 8 mu l, and the transfection reagent is fed in 4-6 h after transfectionAnd (4) carrying out liquid exchange, culturing at 28 ℃, harvesting and amplifying P2-generation virus after 72h, and carrying out P3-generation virus amplification by the same method. The amplification of the P4 generation virus adopts shake flask amplification, and the inoculation ratio of the virus is 1: 100.

7) expression and purification of specific monoclonal antibodies: inoculating the P4 generation virus at a ratio of 1:5 with a density of 2 × 10 ⁶ Hi5 cells, cultured at 28 ℃, harvested after 48h, centrifuged at 8000r/min for 1h to obtain the supernatant, and then filtered through a 0.22 μm filter for later use. And (3) balancing the ProteinA prepacked column by using a Na3PO4 solution with the pH value of 7.0, balancing the volume of the ProteinA prepacked column by 3-5 columns, then combining the cell supernatant with the ProteinA prepacked column, and eluting by using a Glycine-HCL eluent with the pH value of 3.0 after the sample is combined, thus obtaining the purified African swine fever virus gB specific monoclonal antibodies ASF-3C12 and ASF-4F 5.

The detection program of the kit of the invention is as follows:

1) balancing: taking out the kit from the refrigeration environment, and standing at room temperature for balancing for 30min for later use; the liquid reagents were mixed well before use.

2) Preparing liquid: diluting the concentrated washing solution by 20 times of distilled water or deionized water to obtain a washing buffer solution;

3) sample dilution: the antigen standard substance is serially diluted by 1: 20-1: 1280 times by using a sample diluent, the corresponding antigen concentrations are respectively 200ng/ml, 100ng/ml, 50ng/ml, 25ng/ml, 12.5ng/ml, 6.2ng/ml and 3.1ng/ml, and a sample to be detected is also subjected to 4-8 gradient dilution by using the sample diluent.

4) Sample adding: and taking out the required laths, filling the rest laths into an aluminum foil bag, sealing, and storing at 2-8 ℃ for later use. And adding the diluted sample to be detected and the serially diluted antigen standard into a coated plate, setting 1 hole as negative quality control at 100 mu l/hole, and only adding the sample diluent. The time span of the sample application process should be as short as possible. Loading as shown in figure 1: S1-S7: diluting an antigen standard substance at a ratio of 1: 20-1: 1280, wherein N: indicating a negative quality control hole, and only adding a sample diluent; t1: indicating the addition of each sample to be tested.

5) And (3) incubation: shaking and mixing evenly, placing in an incubator at 37 ℃ and reacting for 30 min.

6) Washing the plate: discarding the reaction solution, adding 300 μ l of diluted washing buffer solution into each well, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.

7) Adding an enzyme: add 100. mu.l of enzyme-labeled antibody to each well.

8) And (3) incubation: the reaction mixture was placed in an incubator at 37 ℃ and reacted for 30 min.

9) Washing the plate: discarding the reaction solution, adding 300 mu l of diluted washing buffer solution into each hole, soaking for 15s, throwing away the washing solution, continuously washing the plate for 4 times, and then drying by beating.

10) Adding 100 μ l of substrate working solution (substrate working solution is obtained by mixing substrate solution A and substrate solution B in equal amount, and is prepared at present), shaking, mixing, placing in 37 deg.C incubator, and reacting for 15min in dark.

11) 50. mu.l of chromogenic stop solution was added to each well, and the reaction was stopped by shaking and mixing.

12) Determination of OD per well _450nm Value (reaction plate with stop solution should read OD within 15min _450nm A value).

13) And (4) analyzing results: antigen Standard (200ng/ml) well OD _450nm The value should be more than or equal to 1.0, otherwise, the value is invalid; negative quality control hole OD _450nm The value should be less than or equal to 0.15, otherwise invalid; and (3) calculating the concentration: OD of each well according to antigen standard _450nm And drawing a standard curve according to the values, and calculating the content of the African swine fever virus in each sample to be detected.

The result analysis method in step 13) may be: detecting each dilution OD of the well by using antigen standard _450nm Value and negative quality control well OD _450nm The values were taken as the X-axis, the protein concentration was taken as the Y-axis, and an EXCEL program was used, → "insert" → "scatter plot", and "scatter plot with smooth line and data mark" → "trend line" → selection of "polynomial" → "display formula" and "display R square value". In general R ² A value of 0.98 or more indicates that the standard curve is authentic (where points with too high or too low an OD should be discarded). Each 96-well plate should be set with a set of standards and plotted with the corresponding standard curve. Sample well OD according to polynomial equation _450nm And carrying out value substitution calculation to obtain the antigen concentration in the sample.

The invention has the positive effects that: the invention provides an enzyme-linked immunoassay kit for an African swine fever virus antigen, which has high sensitivity, good specificity and convenient operation and can stably detect the content of the African swine fever virus antigen. The kit is a double-antibody sandwich enzyme-linked immunoassay kit prepared by two specific monoclonal antibodies of African swine fever virus, can detect the content of African swine fever virus antigen in a sample by detecting signal change generated by an enzyme catalytic substrate, and does not have cross reaction with other inactivated viruses such as foot-and-mouth disease virus O type, foot-and-mouth disease virus A type, swine fever virus, porcine circovirus 2 type and porcine pseudorabies virus.

In conclusion, the kit adopts the double-antibody sandwich enzyme-linked immunoassay kit prepared from two specific monoclonal antibodies of the African swine fever virus, has high sensitivity and strong specificity, and can effectively detect the content of the African swine fever virus antigen in a sample. Meanwhile, the operation method can complete the detection of at most 88 samples except the antigen standard substance and the negative quality control hole within 1.5 hours, thereby greatly shortening the detection period.

Drawings

FIG. 1 is a schematic view of the loading of an enzyme-linked immunosorbent assay plate of the kit of the invention.

FIG. 2 shows the results of ASFV-4F5 indirect immunofluorescence assay.

FIG. 3 shows the results of ASFV-4G12 indirect immunofluorescence assay.

FIG. 4 shows the result of detection of inactivated African swine fever antigen.

Detailed Description

The methods in the following examples are conventional methods unless otherwise specified.

The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biomaterials used are wide and any biomaterials available without violating laws and ethical ethics can be used instead as suggested in the examples.

The embodiments are provided in order to provide detailed embodiments and specific procedures, which will help understanding of the present invention, but the scope of the present invention is not limited to the following embodiments.

Example 1 screening of hybridoma cell lines specific to monoclonal antibody against African Swine fever Virus

The method comprises the following steps:

1) expression and identification of African swine fever virus p30 protein: according to a GenBank report p30 gene sequence (GenBank number MK238347.1), synthesizing after codon optimization, cloning and constructing to a pET-28a (+) prokaryotic expression vector, transforming BL21(DE3) competent cells, screening positive clones, obtaining purified African swine fever virus p30 protein (GenBank number QAU54739.1) through induced expression, and using as immunogen;

2) the immune animal is BALB/c mouse (purchased from Beijing Wittingle laboratory animal technology Co., Ltd.), the continuous immunization is carried out for 4 times, each time is 14 days, the multipoint subcutaneous immunization mode is adopted for the first 3 times, the intraperitoneal injection immunization mode is adopted for the 4 th time, and each mouse is injected with 10 mug antigen;

3) 7 days after the last immunization, separating serum from tail blood of the mouse, detecting by indirect ELISA (enzyme-linked immunosorbent assay), when the titer is more than 1:50000, separating splenocytes of the immunized animal, fusing the splenocytes with myeloma cells SP2/0 with good growth state, and screening by using HAT selective culture medium to obtain hybridoma cells;

4) hybridoma cell supernatants were screened for specific positive clones using an indirect ELISA method and an indirect immunofluorescence assay (IFA) performed at the national african swine fever zone laboratory south china agricultural university.

The indirect ELISA method comprises the following specific operation steps: properly diluting the recombinant p30 protein by using a carbonate solution with pH of 9.6, coating the protein on a 96-hole polystyrene enzyme-linked reaction plate, placing the protein at 2-8 ℃ for 8-12 hours by using 100 mu l of each hole, then adding PBS (phosphate buffer solution) containing 10mg/ml bovine serum albumin and pH of 7.4 into the protein according to 300 mu l of each hole, sealing the protein at 37 ℃ for 2-3 hours, drying the protein, sealing the protein by using aluminum foil after the enzyme-linked reaction plate is dried, and storing the protein at 2-8 ℃ for later use. Other inactivated viruses such as foot and mouth disease virus type O, foot and mouth disease virus type A, hog cholera virus, porcine circovirus type 2, and porcine pseudorabies virus antigens are also coated according to the above method.

Adding cell culture supernatant into an enzyme label plate coated with recombinant p30 protein, 3After a reaction at 7 ℃ for 30 minutes, the plate was washed 4 times with a washing solution (0.01M phosphate buffer solution containing Tween-20 at a concentration of 0.8 to 1.2% (ml/ml) and having a pH of 7.4, which was diluted 20-fold with double distilled water when used), and after patting dried, 1:5000 dilution of a rabbit anti-mouse IgG-HRP label (purchased from Sigma, USA) was added to each well, and after a reaction at 37 ℃ for 30 minutes, the washing solution was used 4 times, and after patting dried, 50. mu.l each of substrate solution A (citrate phosphate buffer solution containing 0.6mg/ml urea hydrogen peroxide) and substrate solution B (tetramethylbenzidine solution at 0.2 mg/ml) was added to each well, and then the reaction was carried out at 37 ℃ for 15 minutes in the absence of light. Mu.l of stop solution (2mol/L sulfuric acid solution) was added to each well, and the reaction was terminated by shaking and mixing. OD was measured per well within 15min _450nm The value is obtained. And (3) determining the titer of the specific monoclonal antibody in the cell culture supernatant by taking the absorbance value of more than negative control (namely plate washing culture solution) multiplied by 2.1 as a positive determination standard, and simultaneously determining whether the plate washing strain of the monoclonal antibody has cross reaction with other viruses or not to obtain specific cell clone. The screened monoclonal cell strain has strong signal reaction with an ELISA plate coated with recombinant p30 protein, then is subjected to specific screening with strains of foot-and-mouth disease virus O type, foot-and-mouth disease virus A type, classical swine fever virus, porcine circovirus 2 type, porcine pseudorabies virus and the like, and finally a plurality of monoclonal cell strains which have strong signal reaction with the recombinant p30 protein and do not react with the foot-and-mouth disease virus O type, the foot-and-mouth disease virus A type, the classical swine fever virus, the porcine circovirus 2 type and the porcine pseudorabies virus are screened.

The specific operation steps of the indirect immunofluorescence assay (IFA) are as follows: (1) preparing and fixing an ASFV infected PAM cell slide; (2) adding a monoclonal antibody: on a cell climbing sheet, respectively dripping the monoclonal antibody to be detected, a negative control and a positive control on a cover glass sheet, and incubating for 60min at 37 ℃ in a wet box; (3) and (3) secondary antibody incubation: removing reaction liquid on the cover glass, washing for 5 times by using PBS, respectively dripping the goat anti-pig IgG fluorescent antibody diluted to the working concentration on the cover glass, and incubating for 60min at 37 ℃ in a wet box; (4) removing the secondary antibody on the cover glass, washing with PBS, taking the glass slide, dropwise adding a drop of anti-fluorescence quenching sealing tablet, overturning the cover glass to cover the sealing tablet, and observing the result under a fluorescence microscope; (5) the test is satisfied under the conditions: the positive control should have specific green fluorescence, and the negative control should have no specific green fluorescence, so that the test result is effective; otherwise, the test should be carried out again; (6) and (4) judging a result: and on the premise that the test is established, if the specific green fluorescence appears in the sample to be detected, the sample to be detected is judged to be ASFV antibody positive. And if the sample to be detected has no specific green fluorescence, judging that the sample to be detected is ASFV antibody negative. And judging that the sample to be detected is ASFV antibody suspicious if the sample to be detected has nonspecific green fluorescence or the fluorescence signal is weaker, and suggesting to detect again. The results showed that ASF-4F5 and ASF-3C12 have specific and strong fluorescence responses to African swine fever virus (see FIGS. 2 and 3).

5) Double antibody sandwich method for screening paired antibodies paired tests are carried out on the screened monoclonal antibodies by using a double antibody sandwich ELISA method. Coating a capture antibody (ASF-3C12 or ASF-4F5) serving as a coating antibody on a 96-well polystyrene enzyme-linked reaction plate, placing the plate at 2-8 ℃ for 8-12 hours in a manner of 100 mul per well, then adding PBS buffer containing 10mg/ml bovine serum albumin (pH7.4) into the plate according to 300 mul per well, sealing the plate for 2-3 hours at 37 ℃, recombining p30 antigen to serve as an antigen to be detected, setting PBS as a negative control, reacting the plate for 30 minutes at 37 ℃ in 100 mul per well, washing the plate for 4 times by PBST, after drying, adding a detection antibody (ASF-3C12 or ASF-4F5) marked by HRP into each well, reacting the plate for 30 minutes at 37 ℃ and 4 times by PBST, adding TMB developing solution, reacting the plate for 100 mul per well at 37 ℃ for 15 minutes, adding 50 mul/well of terminating solution to terminate the reaction, and detecting OD (OD) by an enzyme-labeling instrument _450nm The value is obtained. According to the detection result, the ASF-3C12 is preferably used as a capture antibody, and the ASF-4F5 is preferably used as a detection antibody, so that the detection sensitivity of the antibody on the African swine fever antigen is optimal.

Example 2 Gene sequencing of specific hybridoma cell line of monoclonal antibody against African Swine fever Virus and establishment of monoclonal antibody recombinant expression System

The method comprises the following steps:

1) extracting total RNA of a specific positive clone hybridoma cell strain, performing reverse transcription, performing PCR (polymerase chain reaction) and performing sequence determination:

extracting total RNA: taking 250 ul of hybridoma cell suspension, adding 750 ul of Trizol, turning upside down and mixing, adding 200 ul of chloroform, mixing, and centrifuging at 12000rpm at 4 ℃ for 15 min. The supernatant was pipetted into a new 1.5ml EP tube, 600. mu.l of isopropanol was added, mixed well and centrifuged for 10 min. The isopropanol was discarded, washed with 75% DEPC ethanol and centrifuged. The ethanol was discarded, oven dried and the RNA was dissolved in 20. mu.l of RNase-free water.

Reverse transcription: reverse transcription was performed using the Invitrogen reverse transcription kit as per the instructions to obtain cDNA for hybridoma cells.

PCR reaction and cloning and sequencing of products thereof: universal primers were designed for the heavy and light chain variable regions with the following sequence information:

TABLE 1 Universal primers for heavy and light chain variable regions

Name (R)	Sequence of
		V _H -F	GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG
V _H -R	ATGTCGACTGAGGAGACGGTGACCAGGGTGCC
		V _L -F	GTGAATTCATGGACATTGTGATGACCCAGTCTCC
V _L -R	CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC

And amplifying the target fragment by using an amplification primer, recovering the fragment after amplification, and then connecting a vector for sequence determination to obtain sequence information of heavy chain and light chain variable regions of the monoclonal antibody.

Monoclonal antibody ASF-3C12 contains the heavy chain variable region (ASF-3C 12-V) _H ) Light chain variable region (ASF-3C 12-V) _L ) ASF-3C12-V thereof _H The amino acid sequence of (A) is shown as 1 st to 137 th sites of SEQ ID No.1 in a sequence table; its ASF-3C12-V _L The amino acid sequence of (A) is shown as 1 st to 128 th sites of SEQ ID No.2 in the sequence table.

The ASF-3C12-V _H And ASF-3C12-V _L Both consist of a determinant complementary region and a framework region; the ASF-3C12-V _H And said ASF-3C12-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-3C12-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-84 of SEQ ID No. 1; the ASF-3C12-V _H The amino acid sequence of the CDR3 is shown as amino acids 117-126 of SEQ ID No. 1; the ASF-3C12-V _L The amino acid sequence of the CDR1 is shown as amino acids 46-55 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of the CDR2 is shown as amino acids 71-77 of SEQ ID No. 2; the ASF-3C12-V _L The amino acid sequence of CDR3 is shown as amino acids 110-118 of SEQ ID No. 2.

Monoclonal antibody ASF-4F5 contains the heavy chain variable region (ASF-4F 5-V) _H ) Light chain variable region (ASF-4F 5-V) _L ) ASF-4F5-V thereof _H The amino acid sequence of (A) is shown as 1 st to 136 th sites of SEQ ID No.3 in a sequence table; its ASF-4F5-V _L The amino acid sequence of (A) is shown as 1 st to 133 th sites of SEQ ID No.4 in the sequence table.

The ASF-4F5-V _H And ASF-4F5-V _L Both consist of a determinant complementary region and a framework region; the ASF-4F5-V _H And said ASF-4F5-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3; the ASF-4F5-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 1; the ASF-4F5-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-85 of SEQ ID No. 3; the ASF-4F5-V _H The amino acid sequence of CDR3 is as shown in SEQ ID No.3Amino acids at positions 118-125; the ASF-4F5-V _L The amino acid sequence of the CDR1 is shown as amino acids 44-60 of SEQ ID No. 4; the ASF-4F5-V _L The amino acid sequence of the CDR2 is shown as amino acids 76-82 of SEQ ID No. 4; the ASF-4F5-V _L The amino acid sequence of CDR3 is shown as amino acids 115-123 of SEQ ID No. 4.

2) Synthesis of gene sequence of specific monoclonal antibody and establishment of recombinant expression system

Synthesis of gene sequence: according to the sequences of the variable regions of the heavy chains and the light chains of the monoclonal antibodies ASF-3C12 and ASF-4F5, the sequences of the constant regions of the heavy chains and the light chains of the murine antibodies are supplemented in the variable region part, then the gene sequences are synthesized, and the codon optimization of insect cells is carried out, wherein the nucleotide sequence of the ASF-3C12 heavy chain is shown as SEQ ID No.5 in the sequence table, and the nucleotide sequence of the ASF-3C12 light chain is shown as SEQ ID No.6 in the sequence table; the nucleotide sequence of the ASF-4F5 heavy chain is shown as SEQ ID No.7 in the sequence table, and the nucleotide sequence of the ASF-4F5 light chain is shown as SEQ ID No.8 in the sequence table;

constructing a shuttle vector: based on the sequence information of the heavy chain and the light chain and the sequence information of a pFastBactual (purchased from Thermo Fisher company, Cat. 10712024) vector, corresponding primers (sequences are shown in the following table) are designed, fragments of the full length of the heavy chain and the light chain are amplified, and the fragments are connected into the pFastBacual vector through a homologous recombination method after recovery of glue, wherein the pFastBacual vector contains two promoters, namely a PH promoter and a P10 promoter, and sequence determination is carried out after the fragments are connected into the vector to ensure the accuracy of the sequences.

TABLE 2 expression vector construction primer sequence information

Screening and extracting recombined Bacmid: transforming DH10Bac competence by the constructed shuttle vector, coating a three-resistance plate (kanamycin, gentamicin and tetracycline), culturing for 48h at 37 ℃ in an incubator, picking out white spots, identifying by using an M13 primer, selecting clone shake bacteria completely without 300bp bands, extracting Bacmid by using an isopropanol precipitation method after 12h, and then determining the concentration by using Nanodrop.

Rescue of recombinant baculovirus: density 2X 10 before transfection ⁶ And (2) spreading SF9 cells on a six-hole plate, transfecting recombinant Bacmid according to the amount of 5 mu g and 2.5 mu g, wherein the using amount of a transfection reagent is 8 mu l, changing the liquid after 4-6 h of transfection, culturing at 28 ℃, harvesting and amplifying P2 generation virus after 72h, and amplifying the P3 generation virus by adopting the same method. The amplification of the P4 generation virus adopts shake flask amplification, and the inoculation ratio of the virus is 1: 100.

3) expression and purification of specific monoclonal antibodies: inoculating the P4 generation virus at a ratio of 1:5 with a density of 2 × 10 ⁶ Hi5 cells, cultured at 28 ℃, harvested after 48h, centrifuged at 8000r/min for 1h to obtain the supernatant, and then filtered through a 0.22 μm filter for later use. With Na ₃ PO ₄ And (3) balancing the ProteinA prepacked column by using a solution with the pH value of 7.0, balancing the volume of 3-5 columns, then combining the cell supernatant with the ProteinA prepacked column, and eluting with an eluent with the pH value of 3.0 of Glycine-HCL after the sample is combined, thereby obtaining the purified African swine fever virus specific monoclonal antibodies ASF-3C12 and ASF-4F 5. OD measurement with UV spectrophotometer _280nm Value using the OD _280nm The value divided by an empirical factor of 1.48 is the concentration of the monoclonal antibody in mg/ml. The results showed that the concentration of monoclonal antibody secreted by purified ASF-3C12 was 2.08mg/ml and the concentration of monoclonal antibody secreted by purified ASF-4F5 was 1.83 mg/ml.

Example 3 preparation of African swine fever virus antigen enzyme-linked immunosorbent assay kit

1) Enzyme-linked reaction plate coated with capture antibody prepared from African swine fever virus specific monoclonal antibody

Diluting the purified specific monoclonal antibody into 0.5 mu g/ml coating working solution by using a carbonate solution with pH of 9.6, adding the coating working solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the solution at 100 mu l/hole for 8-12 hours at 2-8 ℃ to ensure that the specific monoclonal antibody is fully combined with the enzyme-linked reaction plate, adding PBS buffer solution containing 10mg/ml bovine serum albumin (pH7.4) into the solution according to 300 mu l/hole, sealing the solution at 37 ℃ for 2-3 hours, drying the solution, and sealing and storing the solution at 2-8 ℃ after the enzyme-linked reaction plate is dried.

2) Preparation of horse radish peroxidase-labeled African swine fever virus specific monoclonal antibody

Coupling the specific monoclonal antibody of African swine fever virus with Horse Radish Peroxidase (HRP) by glutaraldehyde oxidation, dialyzing with PBS buffer solution of pH7.4, adding equal amount of high-quality glycerol, and storing at-20 deg.C or below. The method comprises the following specific steps:

dissolving 5mg of HRP in 0.2ml of PBS (phosphate buffer solution) containing 1.25% of glutaraldehyde and having the pH value of 6.8 of 0.1mol/L, placing the solution at room temperature for coupling for 18 hours, and fully dialyzing to remove redundant glutaraldehyde;

adding physiological saline to 1ml, adding 2.5mg of a purified African swine fever virus specific monoclonal antibody and 0.1ml of 1mol/L carbonate buffer solution with the pH value of 9.6, and placing for 24 hours at the temperature of 2-8 ℃;

③ adding 0.1ml of 0.3mol/L lysine solution, and standing for 2 hours at room temperature;

and fourthly, fully dialyzing by using PBS buffer solution with the pH value of 7.4, and removing the precipitate through centrifugation to obtain the supernatant which is the enzyme conjugate. Diluting the solution with an enzyme marker diluent according to a certain proportion to obtain the working solution of the enzyme marker.

3) Preparation of African swine fever virus antigen standard substance

The kit also comprises an African swine fever virus antigen standard, and specifically comprises a pET-28a (+) prokaryotic expression vector constructed by cloning according to a GenBank report p30 gene sequence (GenBank number MK238347.1) after codon optimization, BL21(DE3) competent cells are transformed, positive clones are screened, and purified African swine fever virus p30 protein (GenBank number QAU54739.1) is obtained by induced expression. Diluting the content of p30 purified protein to 4 μ g/ml, subpackaging to 1.0 ml/tube, diluting with sample diluent (1: 20-1: 1280) times when in use, labeling, and storing at-20 deg.C for use.

4) The sample dilutions were prepared as 1 vial (24 ml/vial) of 0.01M, pH value 7.4 phosphate buffer containing 5mg/ml casein.

5) Substrate solution A was prepared as citrate phosphate buffer containing 0.6mg/ml urea hydrogen peroxide (1 vial, 12 ml/vial)

6) Substrate solution B was prepared as a 0.2mg/ml solution of Tetramethylbenzidine (TMB) (1 vial, 12 ml/vial).

7) The 20-fold concentrated washing solution was prepared as 0.01M phosphate buffer (50 ml/vial, 2 vials) containing Tween-20 at a concentration of 0.8% to 1.2% (ml/ml) and a pH of 7.4.

8) Preparation of stop solution A2 mol/L sulfuric acid solution (1 vial, 12 ml/vial) was prepared.

9) If necessary, the kit may also contain a sample dilution plate (2, 96 wells/block) for sample dilution.

Example 4 application method of African swine fever virus antigen detection enzyme linked immunosorbent assay kit

4) Sample adding: and taking out the required laths, filling the rest laths into an aluminum foil bag, sealing, and storing at 2-8 ℃ for later use. And adding the diluted sample to be detected and the serially diluted antigen standard into a coated plate, setting 1 hole as negative quality control at 100 mu l/hole, and only adding the sample diluent. The time span of the sample application process should be as short as possible. As shown in fig. 1, the sample application: S1-S7: diluting an antigen standard substance at a ratio of 1: 20-1: 1280, wherein N: indicating a negative quality control hole, and only adding a sample diluent; t1: indicating the addition of each sample to be tested.

7) Adding an enzyme: add 100. mu.l of enzyme-labeled antibody to each well.

12) Determination of OD per well _450nm Value (reaction plate with stop solution should read OD within 15min _450nm Value).

The detection process takes about 1.5 hours, and up to 88 samples can be detected in one experiment.

Example 5 sensitivity test

3 batches of the kit are selected, 100 mu l/hole of sample diluent is used, 8 holes are repeated, the kit of the embodiment 3 and the detection method of the embodiment 4 are used for detection, the average value (X) +3 multiplied by the Standard Deviation (SD) is calculated to be the detection sensitivity of the kit, and the maximum value is taken as the sensitivity of the kit.

TABLE 3 sensitivity test

Kit lot	Mean value (X)	Standard Deviation (SD)	X+3SD
				1	1.99	0.93	4.780
2	2.33	0.98	5.27
				3	2.57	1.02	5.63

The results of 3 replicates (Table 3) showed that the sensitivity of the kit was 5.63ng/ml, but less than this sensitivity could be detected with the kit.

Example 6 repeatability test

The recombinant p30 protein standard substance diluted by multiple times is used as a detection sample, the antibody coating plate prepared in the same batch is used, the enzyme-labeled antibody prepared in the same batch is used as a secondary antibody, 3 repeats are set for each protein dilution, double-antibody sandwich ELISA detection is carried out, and the variation coefficient of the in-batch repeatability test of the method is calculated. And (3) carrying out double-antibody sandwich ELISA detection on the diluted protein standard substance by using antibody coated plates prepared in different batches and enzyme-labeled antibodies prepared in different batches as secondary antibodies, and calculating the batch-to-batch repeatability test variation coefficient of the method. The result shows that the intra-batch variation coefficient of the kit is 1.30-9.81%, and the inter-batch variation coefficient is 2.98-11.04%, which indicates that the method has good repeatability.

TABLE 4 results of the repeatability tests

Example 7 detection of African Swine fever inactivation antigen

Selecting 3 batches of kits, carrying out multiple dilution on African swine fever inactivated antigen (genotype II ASFV/China/GZ201801, provided by southern China agriculture university of laboratories in the region of African swine fever), carrying out detection at 100 mu l/hole according to the kit of the embodiment 3 and the detection method of the embodiment 4. The result shows that the kit detects the OD of the African swine fever inactivated antigen with different dilution multiples _450nm The values were positively correlated with inactivated antigen content (FIG. 4).

Example 8 specificity test

BHK21 cell host protein, foot and mouth disease virus O-type antigen, foot and mouth disease virus A-type antigen, classical swine fever virus, porcine circovirus 2 and porcine pseudorabies virus antigen are selected, a sample diluent in the kit is used for dilution to 2 mu g/ml, detection is carried out according to the kit in the embodiment 3 and the detection method in the embodiment 4, meanwhile, a negative quality control hole is arranged (only the sample diluent is added), and the detection result shows that the kit does not have cross reaction with the BHK21 cell host protein, the foot and mouth disease virus O-type antigen, the foot and mouth disease virus A-type antigen, the classical swine fever virus antigen, the porcine circovirus 2-type antigen and the porcine pseudorabies virus antigen, and the specificity is 100%.

<110> Zhongmu industries GmbH

<120> enzyme linked immunosorbent assay kit for detecting African swine fever virus antigen and application thereof

<130> WHOI220030

<160> 8

<170> Patent-In 3.5

<210> 1

<211> 137

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Val Leu Gly Leu Leu Phe Cys Leu Val Thr Phe Pro Ser Cys

1 5 10 15

Val Leu Ser Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln

20 25 30

Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu

35 40 45

Thr Lys Asn Thr Val His Trp Val Arg Gln Ser Pro Gly Arg Gly Leu

50 55 60

Glu Trp Leu Gly Val Ile Leu Ser Gly Ala Ser Thr Ala Tyr Asp Ala

65 70 75 80

Ala Phe Ile Thr Arg Leu Ser Ile Ser Lys Asp Asn Ser Lys Ser Gln

85 90 95

Val Phe Phe Lys Met Asn Ser Leu Gln Ala Asn Asp Thr Ala Ile Tyr

100 105 110

Tyr Cys Ala Arg Asn Thr Ser Arg Leu Ala Trp Ser Ala Lys Trp Gly

115 120 125

Gln Gly Thr Leu Val Thr Val Ser Ala

130 135

<210> 2

<211> 128

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser

1 5 10 15

Val Ile Met Ser Arg Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Ile

20 25 30

Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Asn Ala Ser

35 40 45

Thr Ser Val Ser Tyr Met Leu Trp Tyr Gln Gln Lys Pro Gly Ser Ser

50 55 60

Pro Lys Pro Trp Ile Tyr Tyr Thr Ser Ser Leu Ala Thr Gly Val Pro

65 70 75 80

Pro Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Phe Ser Leu Thr Ile

85 90 95

Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Ser Ser Trp

100 105 110

Leu Thr Lys Pro Gly Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

115 120 125

<210> 3

<211> 136

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Cys Ser Trp Val Ile Phe Phe Leu Met Ala Val Val Thr Gly

1 5 10 15

Val Asn Ser Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys

20 25 30

Pro Gly Ala Ser Val Lys Leu Ser Cys Thr Ala Ser Ala Phe Asn Ile

35 40 45

Glu Asp Ser Tyr Met Leu Trp Val Lys Gln Arg Pro Glu Gln Gly Leu

50 55 60

Glu Trp Ile Gly Tyr Ile Asp Lys Ala Asn Gly Asn Thr Lys Tyr Asp

65 70 75 80

Lys Asn Phe Gln Ser Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn

85 90 95

Thr Ala Tyr Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Ser Tyr Leu Tyr Cys Tyr Asp Val Tyr Trp Gly Gln

115 120 125

Gly Thr Thr Leu Thr Val Ser Ser

130 135

<210> 4

<211> 133

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Glu Ser Gln Thr Gln Val Leu Met Ser Leu Leu Phe Trp Val Ser

1 5 10 15

Gly Thr Cys Gly Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr

20 25 30

Val Thr Ala Gly Glu Lys Val Thr Met Ser Cys Leu Ser Thr Gln Ser

35 40 45

Leu Leu Asn Ser Gly Asn Gln Met Asn Lys Leu Ile Trp Tyr Gln Gln

50 55 60

Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Thr Asn

65 70 75 80

Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp

85 90 95

Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr

100 105 110

Tyr Cys Thr Asn Asp Leu Ser Tyr Pro Tyr Ser Phe Gly Gly Gly Thr

115 120 125

Lys Leu Glu Ile Lys

130

<210> 5

<211> 411

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggctgtct tggggctgct cttctgcctg gtgacattcc caagctgtgt cctatcccag 60

gtgcagctga agcagtcagg acctggccta gtgcagccct cacagagcct gtccatcacc 120

tgcacagtct ctggtttctc attaactaaa aatacggtac actgggttcg ccagtctcca 180

ggaaggggtc tggagtggct gggagtgata ctgagtggtg caagcacagc atatgatgca 240

gctttcataa cgagactgag catcagcaag gacaattcca agagccaagt tttctttaaa 300

atgaacagtc tgcaagctaa tgacacagcc atatattact gtgccagaaa cacttctcgg 360

ctggcctggt ctgctaaatg gggccaaggg actctggtca ctgtctctgc a 411

<210> 6

<211> 384

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt cataatgtcc 60

agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag 120

gtcacaatga cttgcaatgc cagcacgagt gtaagttaca tgctgtggta ccagcagaag 180

ccaggatcct cccccaaacc ctggatttat tacacatcct ccctggctac gggagtccct 240

cctcgcttca gtggcagtgg gtctgggacc tctttctctc tcacaatcag cagagtggag 300

gctgaagatg ctgccactta ttactgctct tcctggctga ctaagccagg aacgttcggt 360

gctgggacca agctggagct gaaa 384

<210> 7

<211> 408

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgaaatgca gctgggttat cttcttcctg atggcagtgg ttacaggggt caattcagag 60

gttcagctgc agcagtctgg ggcagagctt gtgaagccag gggcctcagt caagttgtcc 120

tgcacagctt ctgccttcaa cattgaagac tcttatatgc tgtgggtgaa gcagaggcct 180

gaacagggcc tggagtggat tggatacatt gataaagcga atggtaatac taaatatgac 240

aaaaacttcc agtctaaggc cactataaca gcagacacat cctccaacac agcctacctg 300

cagctcagca gcctgacatc tgaggacact gccgtctatt actgtgctag ttacctgtat 360

gcatacgacg tctactgggg ccaaggcacc actctcacag tctcctca 408

<210> 8

<211> 399

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggaatcac agactcaggt cctcatgtcc ctgctgttct gggtatctgg tacctgtggg 60

gacattgtga tgacacagtc tccatcctcc ctgactgtga cagcaggaga gaaggtcact 120

atgagctgcc tgtccacgca gagtctgtta aacagtggaa atcaaatgaa ctatttgatc 180

tggtaccagc agaaaccagg gcagcctcct aaactgttga tctacctggc atccactaat 240

gaatctgggg tccctgatcg cttctcaggc agtggatctg gaacagattt cactctcacc 300

atcagcagtg tgcaggctga agacctggca gtttattact gtacgaatga tctgagttat 360

ccgtactctt tcggaggggg gaccaagctg gaaataaaa 399

Claims

1. An enzyme linked immunosorbent assay kit for detecting African swine fever virus antigen comprises an enzyme linked immunosorbent assay plate and an enzyme labeled antibody, wherein the enzyme linked immunosorbent assay plate can be used as a capture antibody to coat a monoclonal antibody specifically combined with the African swine fever virus antigen.

2. The ELISA kit of claim 1, wherein: the enzyme-labeled antibody is an enzyme-labeled antibody which is prepared by taking a monoclonal antibody capable of being specifically combined with an antigen of the West African swine fever virus as a detection antibody.

3. The ELISA kit of claim 1 or 2, wherein: the capture antibody is ASF-3C12-V containing heavy chain variable region _H And light chain variable region ASF-3C12-V _L (ii) a The heavy chain variable region is ASF-3C12-V _H And light chain variable region ASF-3C12-V _L Both consist of a determinant complementary region and a framework region;

the ASF-3C12-V _H And said ASF-3C12-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3;

the ASF-3C12-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 1;

the ASF-3C12-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-84 of SEQ ID No. 1;

the ASF-3C12-V _H The amino acid sequence of the CDR3 is shown as amino acids 117-126 of SEQ ID No. 1;

the ASF-3C12-V _L The amino acid sequence of the CDR1 is shown as amino acids 46-55 of SEQ ID No. 2;

the ASF-3C12-V _L The amino acid sequence of the CDR2 is shown as amino acids 71-77 of SEQ ID No. 2;

the ASF-3C12-V _L The amino acid sequence of CDR3 is shown as amino acids 110-118 of SEQ ID No. 2.

And/or;

the detection antibody is ASF-4F5-V containing heavy chain variable region _H And light chain variable region ASF-4F5-V _L (ii) a The heavy chain variable region is ASF-4F5-V _H And light chain variable region ASF-4F5-V _L Both consist of a determinant complementary region and a framework region;

the ASF-4F5-V _H And said ASF-4F5-V _L Each of the determinant complementary regions of (a) consists of a CDR1, a CDR2 and a CDR 3;

the ASF-4F5-V _H The amino acid sequence of the CDR1 is shown as amino acids 50-54 of SEQ ID No. 3;

the ASF-4F5-V _H The amino acid sequence of CDR2 of (A) is as SAmino acids 69-85 of EQ ID No. 3;

the ASF-4F5-V _H The amino acid sequence of the CDR3 is shown as amino acids 118-125 of SEQ ID No. 3;

the ASF-4F5-V _L The amino acid sequence of the CDR1 is shown as amino acids 44-60 of SEQ ID No. 4;

the ASF-4F5-V _L The amino acid sequence of the CDR2 is shown as amino acids 76-82 of SEQ ID No. 4;

the ASF-4F5-V _L The amino acid sequence of CDR3 is shown as amino acids 115-123 of SEQ ID No. 4.

4. The ELISA kit of claim 3, wherein: the ASF-3C12-V _H The amino acid sequence of (A) is shown as 1 st to 137 th sites of SEQ ID No.1 in a sequence table; the ASF-3C12-V _L The amino acid sequence of (A) is shown as 1 st to 128 th sites of SEQ ID No.2 in a sequence table.

And/or; the ASF-4F5-V _H The amino acid sequence of (A) is shown as 1 st to 136 th sites of SEQ ID No.3 in a sequence table; the ASF-4F5-V _L The amino acid sequence of (A) is shown as 1 st to 133 th sites of SEQ ID No.4 in the sequence table.

5. The ELISA kit of any one of claims 1-4, wherein: the method for obtaining the enzyme-linked reaction plate comprises the steps of dissolving the capture antibody in 100 mu l of carbonate solution with pH of 9.6, adding the solution into a 96-hole polystyrene enzyme-linked reaction plate, placing the plate at the temperature of 2-8 ℃ for 8-12 hours with 100 ng-1000 ng of the capture antibody per hole to enable the capture antibody to be fully combined with the enzyme-linked reaction plate, adding PBS buffer solution containing 10mg/ml bovine serum albumin (pH7.4) into the plate according to 300 mu l/hole, sealing the plate at the temperature of 37 ℃ for 2-3 hours, drying the plate, and sealing and storing the plate at the temperature of 4 ℃ after the plate is dried.

6. The kit of claim 1, wherein: the kit also comprises a sample diluent and a 20-time concentrated washing solution; the sample diluent was phosphate buffer containing 5mg/ml casein with a value of 0.01M, pH of 7.4; the 20-fold concentrated washing solution is 0.01M phosphate buffer solution with pH value of 7.4 and contains 0.8-1.2% (ml/ml) of Tween-20.

7. The enzyme-linked immunoassay kit of claim 1, characterized in that: the kit also comprises a substrate solution A, a substrate solution B and a stop solution; the substrate solution A is a citrate phosphate buffer solution containing 0.6mg/ml of urea hydrogen peroxide, the substrate solution B is a tetramethylbenzidine solution containing 0.2mg/ml, and the substrate solution A and the substrate solution B are mixed in a ratio of 1:1 when in use; the stop solution is a 2mol/L sulfuric acid solution.

8. A monoclonal antibody which can be specifically combined with an African swine fever virus antigen is any one of the following monoclonal antibodies:

1) contains heavy chain variable region ASF-3C12-V _H And light chain variable region ASF-3C12-V _L (ii) a The heavy chain variable region is ASF-3C12-V _H And light chain variable region ASF-3C12-V _L Both consist of a determinant complementary region and a framework region;

the ASF-3C12-V _H The amino acid sequence of the CDR2 is shown as amino acid positions 69-84 of SEQ ID No. 1;

2) Containing heavy chain variable region ASF-4F5-V _H And variable region ASF-4F5-V _L (ii) a The heavy chain variable region is ASF-4F5-V _H And light chain variable region ASF-4F5-V _L Both consist of a determinant complementary region and a framework region;

the ASF-4F5-V _H The amino acid sequence of the CDR2 is shown as amino acids 69-85 of SEQ ID No. 3;

3) Contains heavy chain variable region ASF-3C12-V _H And light chain variable region ASF-3C12-V _L (ii) a The ASF-3C12-V _H The amino acid sequence of (A) is shown as 1 st to 137 th sites of SEQ ID No.1 in a sequence table; its ASF-3C12-V _L The amino acid sequence of (A) is shown as 1 st to 128 th sites of SEQ ID No.2 in the sequence table.

4) Containing heavy chain variable region ASF-4F5-V _H And light chain variable region ASF-4F5-V _L (ii) a The ASF-4F5-V _H The amino acid sequence of (A) is shown as 1 st to 136 th sites of SEQ ID No.3 in a sequence table; its ASF-4F5-V _L The amino acid sequence of (A) is shown as 1 st to 133 th sites of SEQ ID No.4 in a sequence table.

9. The use of the enzyme linked immunosorbent assay kit of claims 1-8 in the detection of African swine fever virus antigen, preferably, the sample to be detected includes but is not limited to serum or blood sample of suspected African swine fever infected pig, and African swine fever inactivated antigen.

10. Use of the monoclonal antibody of claim 8 in the preparation of a kit for detecting an African swine fever virus antigen.