CN113151187B - Monoclonal antibody hybridoma cell of African swine fever virus and application thereof - Google Patents
Monoclonal antibody hybridoma cell of African swine fever virus and application thereof Download PDFInfo
- Publication number
- CN113151187B CN113151187B CN202110327732.1A CN202110327732A CN113151187B CN 113151187 B CN113151187 B CN 113151187B CN 202110327732 A CN202110327732 A CN 202110327732A CN 113151187 B CN113151187 B CN 113151187B
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- swine fever
- elisa
- asfv
- african swine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/081—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from DNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/12011—Asfarviridae
- C12N2710/12022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a monoclonal antibody hybridoma cell of African swine fever virus and application thereof, wherein the hybridoma cell strain is named as mouse SP2/0 hybridoma cell and is preserved in the China general microbiological culture Collection center, and the preservation addresses are as follows: the preservation date of No. 3 Xilu Hospital No. 1 of Chaozhou Chaoyang district, beijing, is: 2021, 1, 8 days, with the deposition number: CGMCC NO:21489. the invention successfully prepares and screens 1 monoclonal antibody of anti-ASFV p72 protein, which is used for establishing an ASFV blocking ELISA antibody detection method. The method has high sensitivity and specificity, good repeatability and important application value.
Description
Technical Field
The invention belongs to the technical field of immunological detection methods, and particularly discloses an African swine fever virus monoclonal antibody hybridoma cell and application thereof.
Background
African Swine Fever (ASF) is seriously harming the development of the swine industry in China. At present, no safe and effective vaccine exists internationally. The virus research is slow, and an effective antibody detection reagent is lacking clinically. The research successfully prepares and screens 1 monoclonal antibody of ASFV p72 protein, establishes a blocking ELISA antibody detection method, has sensitivity and specificity reaching the level of international like products, and has important application value.
Disclosure of Invention
The invention aims to provide an African swine fever virus monoclonal antibody hybridoma cell strain and a monoclonal antibody secreted by the same.
The invention also aims to provide an African swine fever virus antibody detection blocking ELISA kit.
The invention also aims to provide application of the African swine fever virus antibody detection blocking ELISA kit.
The purpose of the invention can be realized by the following technical scheme:
a hybridoma cell strain secreting monoclonal antibodies of African swine fever viruses is named as mouse SP2/0 hybridoma and is preserved in the China general microbiological culture Collection center (CGMCC), wherein the preservation addresses are as follows: xilu No. 1 Hospital No. 3, beijing, chaoyang, on the day of deposit: 2021, 1, 8 days, with the deposition number: CGMCC NO:21489.
An African swine fever virus monoclonal antibody is secreted and produced by the hybridoma cell strain.
The African swine fever virus monoclonal antibody is applied to preparation of an African swine fever virus blocking ELISA antibody detection kit.
The African swine fever virus monoclonal antibody is applied to detection of African swine fever virus by a non-diagnosis and treatment blocking ELISA antibody.
An African swine fever virus blocking ELISA antibody detection kit comprises an ELISA plate coated by recombinant ASFV p72 protein serving as an antigen, ELISA standard positive serum, ELISA negative serum, a horseradish peroxidase-labeled monoclonal antibody and TMB substrate solution, wherein the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell strain of claim 1.
As a preferred technical scheme, the kit also comprises antigen diluent, confining liquid, sample diluent and stop solution; more preferably, the antigen dilution is a carbonate buffer solution with pH 9.6 (0.17 g anhydrous Na is weighed) 2 CO 3 、0.28g NaHCO 3 BSA in double distilled water and constant volume of 100 mL), 1% of blocking solution, PBST as sample diluent, and 2mol/L sulfuric acid as stop solution.
Further preferably, the preparation method of the recombinant ASFV p72 protein comprises the following steps: specific primers were designed by referring to the B646L (p 72) gene sequence of the ASFV Pig/HLJ/2018 (GenBank MK 333180) strain in GenBank database: :
P72-EcoR I-F：CCGGAATTCATGGCATCAGGAGGAG
P72-Xho I-R：CGCCTCGAGGAGCGCAAGAGGGGGC
amplifying the 1-329aa region of the B646L gene, cloning the amplified gene fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid pET-28a-His-p72t, transforming the recombinant plasmid into BL21 (DE 3) for induced expression, collecting precipitates for purification, and obtaining the purified recombinant protein His-p72t.
The blocking ELISA antibody detection kit is applied to the detection of African swine fever virus antibodies, and the application does not aim at the diagnosis and treatment of diseases.
A non-diagnosis and treatment purpose African swine fever virus blocking ELISA antibody detection method comprises the following steps:
(1) Coating an ELISA plate; using His-p72t as antigen, diluting the purified His-p72t with antigen diluent to coat an ELISA plate;
(2) Blocking the ELISA plate with blocking solution;
(3) Adding diluted serum to be detected for incubation;
(4) Adding diluted enzyme-labeled monoclonal antibody, wherein the monoclonal antibody is the monoclonal antibody of claim 2;
(5) Color development, termination, and OD reading on microplate reader 450nm A value;
(6) The blocking rate (percent inhibition/PI) = [ (negative serum OD) 450nm value-Positive serum OD 450nm Value)/negative serum OD 450nm Value of]X is 100%; judging the PI to be positive when the PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious.
The invention mainly has the following key points:
(1) 12 monoclonal antibodies are developed, and the epitope thereof is defined. 12 hybridoma cell strains which stably secrete the ASFV p72 protein-resistant monoclonal antibody are developed. Western blot results show that all the monoclonal antibodies can perform specific reaction with ASFV. IFA results indicated that only the 6C6 and 6G5 monoclonal antibodies were able to recognize ASFV. 6 different linear B-cell epitopes of the p72 protein were identified. The result of bioinformatics analysis shows that, 51 QIEETHL 57 , 63 HFKPYVPV 70 , 83 TPTLGNKL 90 , 147 QTPLEGAV-YTL 157 and 208 TTLVRKFCI 216 the antigenic epitopes are highly conserved among different strains of ASFV. However, 243 CNIHDLHK 250 the antigenic epitopes are poorly conserved among different strains of ASFV. 51 QIEETHL 57 The epitope has high antigenicity and hydrophilicity, and is completely exposed on the surface of the p72 protein. Thus, it is possible to provide 51 QIEETHL 57 The antigenic epitope is likely to be an important linear B cell epitope in the p72 protein.
(2) Screening out a good monoclonal antibody for blocking ELISA, and having high specificity. The 12 monoclonal antibodies are respectively used for blocking an ELISA antibody detection method and detecting ASFV negative and positive serum antibodies, and the 6E5 monoclonal antibody detection effect is the best.
(3) Successfully establishes a monoclonal antibody blocking ELISA antibody detection method. The optimal antigen coating concentration and the optimal serum dilution factor are determined by a checkerboard method by using the purified recombinant p72 protein as a coating antigen. And optimizing other conditions (sealing liquid, sealing time, serum reaction time, enzyme-labeled antibody dilution, enzyme-labeled antibody reaction time and the like) for blocking ELISA, and the result shows that: the optimal antigen coating concentration is 0.5 mu g/mL; the optimal blocking agent was BSA at 1% at 200. Mu.L/well, blocking at 37 ℃ for 2h; the optimal dilution of the serum to be detected is 1, and the action time is 1h at 37 ℃; the optimal dilution of the enzyme-labeled monoclonal antibody is 1; the optimal reaction time of the substrate is 10min at 37 ℃. The judgment criteria for the ELISA results were: the serum sample is judged to be positive if the blocking rate PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious. The method has no cross-reactivity with PRV, PRRSV, CSFV, PCV2, SVA and FMDV positive sera. ELISA repeatability tests show that the coefficient of variation between batches and within batches is less than 10%. The comparative experiment result shows that the relative sensitivity and specificity of the ELISA are 93.5% and 94.0% respectively, and the coincidence rate of the ELISA kit with IDvet ASFV p30 blocking ELISA kit is 93.8%. The method has high sensitivity, strong specificity and high repetition rate, and can be used for African swine fever virus antibody detection and serum epidemiology investigation.
The invention has the beneficial effects that:
the invention successfully prepares and screens 1 strain of monoclonal antibody resisting ASFV p72 protein, establishes a blocking ELISA antibody detection method, has sensitivity and specificity reaching the level of international like products, and has important application value.
Drawings
FIG. 1 PCR-amplified ASFV B646L (1-329 aa) fragment.
FIG. 2 is the prokaryotic expression identification of His-p72t recombinant protein;
wherein, A, the prokaryotic expression of His-p72t recombinant protein is analyzed by SDS-PAGE; m: protein molecular weight standards; 1: inducing the supernatant; 2: inducing precipitation; 3: inducing the whole bacteria; 4: whole bacteria are not induced; 5: inducing empty carrier whole bacteria; 6: purifying the His-p72t recombinant protein; western blot analysis of the antigenicity of His-p72t recombinant protein; m: protein molecular weight standards; 1: inducing precipitation; 2: inducing empty carrier whole bacteria.
FIG. 3 determination of serum titers in immunized mice.
And (3) identifying the Western blot reactivity of the monoclonal antibody in the figure 4.
FIG. 5 reactivity identification of monoclonal antibody IFA.
FIG. 6 monoclonal antibody epitope identification;
the results showed that the 6C6 and 6G5 monoclonal antibodies were able to react with the F1, F11, F12, F13 and F14 fragments and not with the F2, F3, F4, F7 and F10 fragments, demonstrating that the epitope recognized by 6C6 and 6G5 is located on the epitope 51 QIEETHL 57 (FIG. 6A); the 6F7 and 8G4 monoclonal antibodies were able to react with the F1, F9, F10 and F13 fragments and not with the F2, F3, F4, F7 and F8 fragments, demonstrating that the epitope recognized by the 6F7 and 8G4 is located on the antigen 63 HFKPYVPV 70 (FIG. 6B); the 8B8 and 9H11 monoclonal antibodies can react with F1, F6, F7, F8 and F13 fragments and can not react with F2, F3, F4 and F5 fragments, and the 8B8 and 9H11 monoclonal antibody epitope is positioned on the monoclonal antibody epitope recognized by the 8B8 and 9H11 monoclonal antibodies 83 TPTLGNKL 90 (FIG. 6C); the 6E1 and 10B7 monoclonal antibodies were able to react with the F1, F2 and F17 fragments and not with the F15 and F16 fragments, demonstrating that the epitopes of 6E1 and 10B7 are located in 147 QTPLEGAVYTL 157 (FIG. 6D); the 6C1, 6E5 and 10D2 monoclonal antibodies were able to react with the F2, F19, F20 and F23 fragments and not with the F1, F18, F25 and F26 fragments, demonstrating that the epitope recognized by the 6C1, 6E5 and 10D2 is located on 208 TTLVRKFCI 216 (FIG. 6E); the 5H11 monoclonal antibody can react with F2, F22, F23 and F24 fragments and can not react with F1, F18, F19, F20 and F21 fragments, and the epitope of the 5H11 antigen is proved to be positioned 243 CNIHDLHK 250 (FIG. 6F).
FIG. 7 epitope conservation analysis;
wherein, A: comparing the p72 amino acid sequences of different ASFV strains; b: his-p72t (L) 57 M) identifying the reactivity of the mutant; 1: his-p72t;2: his-p72t (L) 57 M)；C：His-p72t(V 70 I) Identifying the reactivity of the mutant; 1: his-p72t;2: his-p72t (V) 70 I)；D：His-p72t(V 211 A) Identifying the reactivity of the mutant; 1: his-p72t;2: his-p72t (V) 211 A)；E：His-p72t(I 245 V,H 246 Q,L 248 M) identifying the reactivity of the mutant; 1: his-p72t;2: his-p72t (I) 245 V,H 246 Q,L 248 M)。
FIG. 8 epitope spatial structure analysis;
wherein, A: p72 protein secondary structure; b: surface structure of P72 protein.
FIG. 9 p72 protein hydrophilicity and antigenicity analysis;
wherein, A: performing hydrophilicity analysis on the P72 protein; b: and (3) carrying out antigenic analysis on the P72 protein.
FIG. 10 SDS-PAGE analysis of monoclonal antibody purification;
wherein, M: protein molecular mass standard; 1: ascites of 6E5 monoclonal antibody; 2: purified 6E5 mab samples.
Detailed Description
The following examples are for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods used in the following examples are all conventional experimental methods unless otherwise specified. The test materials and the like used in the following examples were purchased from conventional biochemicals, unless otherwise specified.
Test I, development of ASFV monoclonal antibody
1. Materials and methods
1.1 cells, viruses and laboratory animals
The ASFV Pig/HLJ/2018 (GenBank MK 333180) virulent strain was preserved by the Harbin veterinary institute and tested for viral infection in the Biosafety level 3 laboratory (BSL-3). Mouse myeloma cells (SP 2/0) were stored in this laboratory. Primary PAM cell reference [1] The protocol was taken from 4-week old normal piglets that were ASFV negative. SPF grade 6-8 week old female BALB/c mice and ICR mice were purchased from the center of Yangzhou university laboratory animals.
1.2 vectors, strains and Primary Agents
Prokaryotic expression vectors pET-28a (+), pET-32a (+), and E.coli DH5 alpha and BL21 (DE 3) were stored in the laboratory. Restriction endonucleases EcoRI, xho I and T4 DNA ligase were purchased from Thermo Fisher; IPTG, freund's complete adjuvant, freund's incomplete adjuvant, HAT, HT, PEG4000 were all purchased from Sigma; RPMI-1640 medium, fetal bovine serum were purchased from Gibco, USA; TMB developing solution and goat anti-mouse IgG (H + L) -HRP were purchased from Shanghai Bin Yuntian biotechnology limited; FITC-labeled goat anti-mouse IgG was purchased from proteintech; the mouse monoclonal antibody subtype identification kit is purchased from Proteitech Biotech limited; the Tanon TM High-sig ECL Western blotting substrate kit is purchased from Shanghai Tianneng science and technology Limited; other reagents are all domestic analytical purifiers.
1.3 Gene sequence Synthesis and recombinant plasmid construction
B646L gene sequence of ASFV Pig/HLJ/2018 (GenBank MK 333180) strain in reference GenBank database is designed and synthesized into PCR primer (the specific primer sequence is shown in Table 1) containing enzyme cutting site to amplify the 1-329aa region of the B646L gene. The primers contained EcoR I and Xho I cleavage sites to allow cloning of the amplified sequence into the pET-28a (+) expression vector. PCR amplification procedure: 2min at 95 ℃; 35 cycles of 95 ℃ for 10s,53 ℃ for 30s and 72 ℃ for 30 s; extension at 72 ℃ for 5min. The PCR product was analyzed by electrophoresis through a 1% agarose gel and recovered. The pET-28a (+) vector and the fragment of interest were treated with EcoR I and Xho I restriction endonucleases and recovered. The cleaved target fragment and the vector were ligated with T4 DNA ligase at 22 ℃ for 2h. And transforming the ligation product into DH5a, carrying out PCR identification on a bacterial solution and double enzyme digestion identification, sending the bacterial solution to a general biological system company for sequencing, and naming the plasmid with correct sequencing as pET-28a-p72 and storing the plasmid at the temperature of-20 ℃ for later use.
TABLE 1 primer sequences for amplification of amino acid fragments 1-329 of the B646L Gene
Induced expression and purification of 1.4p72 recombinant protein
Recombinant plasmids pET-28a-His-p72t and pET-28a (+) are respectively transformed into BL21 (DE 3) in no-load mode, a single colony is picked up and cultured in a shaking mode in 200 Xg at 37 ℃ for 16h, and then bacterial liquid is inoculated into 500mL of liquid LB culture medium (containing 100 mu g/mL of kanamycin) according to the proportion of 1 450 nm The concentration was about 0.6 to 0.8, IPTG was added to the cells at a final concentration of 1mM/L, the cells were cultured at 37 ℃ and 200 Xg with shaking for 6 hours, the cells were centrifuged at 8,000Xg for 10 minutes, the cells were washed 3 times with PBS (0.1 mM/L), and the cells were resuspended in 20mL of PBS (0.1 mM/L). Then using an ultrasonicator to crack thalli, centrifuging at 4 ℃ for 10min at 12,000 Xg, collecting precipitates and carrying out SDS-PAGE and Western blot analysis on the supernatant so as to identify the expression form and immunogenicity of the thalli. Purification of His-p72t recombinant protein by Urea dialysis [2,3] . The concentration of the recombinant p72 protein is determined by a BCA method, and the purified His-p72t is stored at-80 ℃ for a long time.
1.5 preparation of anti-ASFV p72 protein monoclonal antibody
1.5.1 animal immunization
The animal protocol was approved by the animal protection and ethics committee of the university of agriculture of Nanjing. Animal experiments were performed according to the guidelines for biomedical research in animals. Mouse immunization program reference documentation [4] . The purified His-p72t recombinant protein is mixed with Freund's complete adjuvant 1 uniformly and emulsified, and the mice are immunized by subcutaneous multi-point injection, wherein the immunization dose is 50 mu g/mouse. Emulsifying the second and third immunizations with Freund incomplete adjuvant, separating each immunization by two weeks, collecting blood from the tail of the mouse one week after the 3 rd immunization, and measuring the titer of serum antibody by using an indirect ELISA method; and 3 days before fusion, selecting a mouse with the highest antibody titer for impact immunization, and injecting 100 mu g of recombinant protein into the abdominal cavity.
1.5.2 monoclonal antibody preparation
Reference is made to the preparation of P72 monoclonal antibody [4-6] A method is described. Balb/c mice were euthanized three days after the shock immunization and splenocytes isolated and cell fused with SP2/0 cells in logarithmic growth phase under the action of PEG4000 in the ratio of 7. The fused cells were plated in 96-well plates and cultured in HAT selection medium. 7 days after cell fusion, 100. Mu.L of culture supernatant was aspirated and assayed.
Positive hybridoma cells were screened by indirect ELISA, and the purified His-p72t recombinant protein was used as an antigen-coated ELISA plate (antigen coating concentration 1. Mu.g/mL) and coated overnight at 4 ℃ and blocked with 5% skim milk at 37 ℃ for 2h. The multiple antiserum of the immunized mice is taken as positive serum,serum of control mice was used as negative serum, and 1; PBST washing plate after 3 times adding 100 u L sheep anti mouse IgG (H + L) -HRP (1 1000 dilution) at 37 degrees C reaction for 45min; PBST washing the strips for 3 times, adding 100. Mu.L of TMB color development liquid, developing for 10min at 37 ℃ in a dark place, and adding 50. Mu.L of 2M H 2 SO 4 The reaction was terminated. OD reading with microplate reader 450nm Absorbance. And selecting the cell hole with the P/N value larger than 2.1 for subcloning.
Positive hybridoma cells were subcloned 2-3 times by limiting dilution method until the antibody positivity reached 100%. And (3) carrying out expanded culture on the hybridoma cell strain capable of stably secreting the antibody, and freezing and storing the cells in liquid nitrogen for a long time. Selecting a 12-week-old BALB/c mouse to prepare monoclonal antibody ascites, collecting the ascites when the abdomen of the mouse is enlarged and the mouse has fluctuation, centrifuging for 10min at 8,000xg, collecting supernatant, and measuring the antibody titer of the monoclonal antibody by an indirect ELISA method. Taking the culture supernatant of the hybridoma cells, and carrying out subtype identification on the monoclonal antibody according to the specification of the mouse monoclonal antibody subtype identification kit.
1.6 identification of immunoblots (Western blot)
PAMs were plated in 12-well cell plates (2.0X 10) 6 One/well), cells were inoculated with the ASFV Pig/HLJ/2018 strain at MOI =1, and cell samples were collected 24h after infection, subjected to SDS-PAGE electrophoresis according to a conventional method, and transferred onto a nitrocellulose membrane (NC membrane) by wet transfer. The NC membranes were blocked with 5% skim milk PBST block solution at room temperature for 2h, followed by 3 washes with PBST for 10min each. The NC membrane was then placed into either ASFV standard positive serum (1 diluted 200) or monoclonal antibody (1 diluted 1000) and incubated for 1h at room temperature. The NC membranes were placed in staphylococcal protein a-HRP (1 diluted 10000) or goat anti-mouse IgG (H + L) -HRP (1 diluted 1000) and incubated for 45min at room temperature, as above. And carrying out exposure development identification by using a Tanon TM High-sig ECL Western blotting substrate kit.
1.7 Indirect immunofluorescence assay (IFA)
Reference to indirect immunofluorescence experiments [7] The method was described with some modifications. PAM cells were plated at 1X 10 6 The density of each well is paved on a 48-well plate, and the ASFV Pig/HLJ/2018 strain is inoculated with fine strain according to MOI =1Cells, while normal cells were set as blank. 24h after infection, cells were washed 3 times with PBS and then pre-chilled absolute ethanol was added and fixed at-20 ℃ for 30 min. After washing the cells 3 times with PBS, 2% BSA was added and blocked at 37 ℃ for 2h. Subsequently, 100. Mu.L of supernatant of positive hybridoma cells was added to each well and reacted at 37 ℃ for 1 hour, while SP2/0 cell supernatant was set as a negative control for primary antibody. After washing, FITC-labeled goat anti-mouse IgG (1 diluted at 200) was added, reacted at 37 ℃ for 1 hour, and then observed under a fluorescence microscope.
1.8 preliminary identification of epitopes
To preliminarily identify the epitope of the monoclonal antibody, a series of overlapping truncated B646L genes (specific primer sequences are shown in table 2) were amplified by PCR and cloned into pET-32a (+). Expressing the recombinant protein by using an escherichia coli prokaryotic expression system, and carrying out Western blot identification by using hybridoma cell supernatant as a primary antibody and using goat anti-mouse IgG (H + L) -HRP as a secondary antibody.
TABLE 2 primer sequences for amplification of overlapping fragments of the B646L gene
1.9 bioinformatics analysis
The conservation of the ASFV strains is analyzed by comparing the sequences of the same epitope of different ASFV strains through BioEdit V7.0 software. Meanwhile, the spatial distribution of different epitopes in the crystal structure of the p72 protein is shown by PyMol software by obtaining the crystal structure data (PDB: 6L 2T) of the p72 protein from the RCSB website (http:// www1.RCSB. Org /). In addition, the antigenicity and hydrophilicity of the different epitopes were analyzed by the IEDB website (http:// tools. Immune-epitope. Org/main /).
2 results of
2.1B646L gene prokaryotic expression vector construction
A B646L (1-329 aa) gene fragment was amplified by PCR (FIG. 1, the ASFV B646L (1-329 aa) fragment was amplified by PCR). And respectively carrying out enzyme digestion on the target fragment and pET-28a (+) in no load by using EcoR I and Xho I restriction endonucleases, then carrying out connection and transformation, and carrying out enzyme digestion identification and sequencing identification on the recombinant plasmid, thereby obtaining the recombinant plasmid named as pET-28a-His-p72t.
2.2His-p72t recombinant protein prokaryotic expression identification
The expression bacteria are treated by ultrasonic disruption and then subjected to SDS-PAGE electrophoretic analysis. The results show that: when the IPTG concentration is 1mM/L and the induction is carried out for 6 hours at 37 ℃, compared with a no-load control group, the pET-28a-His-p72t transformation bacteria have obvious difference bands at 40KDa and are consistent with the expected size. The recombinant protein was expressed in the pellet of bacterial lysate mainly as inclusion bodies (FIG. 2A, lane 2). The His-p72t recombinant protein was purified by inclusion body purification, and the purity of the target protein was high (FIG. 2A, lane 6). Western Blot results showed that His-p72t recombinant protein was able to specifically react with ASFV-positive serum, and a specific reaction band was visible at 40kDa (FIG. 2B, lane 1).
2.3 mouse serum titer assay
The serum titer of mice immunized with His-p72t recombinant protein was determined by indirect ELISA method. As shown in fig. 3, all mice within the immunization group showed higher levels of p72 protein antibody titers after three boosts compared to negative mice (titer range: 1, 12,800 to 1.
Preparation and identification of 2.4P72 monoclonal antibody
In this study, 12 monoclonal antibodies were screened by indirect ELISA. Western blot experiments and IFA experiments are adopted to further verify the reactivity of the monoclonal antibody. The antibody subtype identification showed that the heavy chain of the 12-strain monoclonal antibody was of the IgG1 type and the light chain was of the Kappa chain (Table 3). The ascites titer of the monoclonal antibody was measured by p72 indirect ELISA method, and the results showed that the ascites had higher p72 protein antibody titer (Table 3).
Results of ascites titer and subtype identification of monoclonal antibodies of Table 3
2.5Western blot reactivity identification
Westernblot results show that the monoclonal antibodies can specifically react with ASFV and have obvious target bands at 73.2KDa (figure 4)
2.6IFA reactivity identification
The IFA results showed that only the 6C6 and 6G5 monoclonal antibodies reacted specifically with ASFV with a clear green fluorescence (fig. 5).
2.7 epitope identification of monoclonal antibodies
A series of p72 protein truncation antibodies (table 2) are expressed by a prokaryotic expression system, and the antigen epitope of the monoclonal antibody is preliminarily identified by using a Western blot experiment. The results showed that the 6C6 and 6G5 monoclonal antibodies were able to react with the F1, F11, F12, F13 and F14 fragments and not with the F2, F3, F4, F7 and F10 fragments, demonstrating that the epitope recognized by 6C6 and 6G5 is located on the epitope 51 QIEETHL 57 (FIG. 6A). The 6F7 and 8G4 monoclonal antibodies were able to react with the F1, F9, F10 and F13 fragments and not with the F2, F3, F4, F7 and F8 fragments, demonstrating that the epitope recognized by the 6F7 and 8G4 is located on the antigen 63 HFKPYVPV 70 (FIG. 6B). The 8B8 and 9H11 monoclonal antibodies can react with F1, F6, F7, F8 and F13 fragments and can not react with F2, F3, F4 and F5 fragments, and the 8B8 and 9H11 monoclonal antibody epitope is positioned on the monoclonal antibody epitope recognized by the 8B8 and 9H11 monoclonal antibodies 83 TPTLGNKL 90 (FIG. 6C). The 6E1 and 10B7 monoclonal antibodies were able to react with the F1, F2 and F17 fragments and were unable to react with the F15 and F16 fragments, demonstrating that the epitopes of 6E1 and 10B7 are located in 147 QTPLEGAVYTL 157 (FIG. 6D). The 6C1, 6E5 and 10D2 monoclonal antibodies were able to react with the F2, F19, F20 and F23 fragments and not with the F1, F18, F25 and F26 fragments, demonstrating that the epitope recognized by the 6C1, 6E5 and 10D2 is located on 208 TTLVRKFCI 216 (FIG. 6E). The 5H11 monoclonal antibody can react with F2, F22, F23 and F24 fragments, but not with F1, F18, F19, F20 and F21 fragments, and the epitope of the 5H11 antigen is proved to be positioned 243 CNIHDLHK 250 (FIG. 6F).
2.8 conservative analysis of epitopes
Alignment of p72 amino acids of 18 ASFV reference strains (Table 4) using BioEidt V7.0 softwareAnd (3) analyzing the conservation of the antigen epitope in different strains. The amino acid alignment results are shown in FIG. 7A, 6 different epitopes are labeled with different colors, 83 TPTLGNKL 90 and 147 QTPLEGAVYTL 157 the epitope is highly conserved among 9 ASFV genotypes. 51 QIEETHL 57 And 63 HFKPYVPV 70 epitopes are conserved in genotypes I, II, III, IV, va and XXa, but "L" appears in genotypes VIII, xb and XXI 57 M”,“V 70 I "mutation. 208 TTLVRKFCI 216 Antigenic epitopes present "V" only in the ETH/1a (KT 795359) strain 211 Mutation of A'. However, p72 (L) was expressed using a prokaryotic system 57 M)、 p72(V 70 I)、p72(V 211 A) Western blot reactivity identification is carried out on the protein, and the result shows that the mutated protein can still be recognized by corresponding monoclonal antibodies (figures 7B, C and D), which indicates that the epitopes are conserved among ASFV strains. 243 CNIH- DLHK 250 The epitope is highly conserved among the genotypes I, II, III, IV, va, VIII and XXa, but appears as "I" in the genotypes Xb and XXII 245 V”、“H 246 Q 'and' L 248 M ", and these mutations result in the inability of the 5H11 monoclonal antibody to recognize the p72 protein.
TABLE 4 case of 18 ASFV reference strains cited herein
2.9 analysis of spatial Structure characteristics of epitope
The spatial conformation of the p72 protein (PDB: 6L 2T) was displayed using PyMol software. The results of the spatial distribution of epitopes are shown in FIG. 8, 6 different epitopes are labeled with different colors, 208 TTLVRKFCI 216 the epitope was helical and partially exposed on the surface of the p72 protein (fig. 8A and B, purple). 63 HFKPYVPV 70 And 243 CNIHDLHK 250 the epitope was randomly coiled and partially exposed on the surface of p72 protein (fig. 8A and B, green and brown). 51 QIEETHL 57 、 147 QTPLEGAVYTL 157 And 83 TPTLGNKL 90 the epitope was randomly coiled and completely exposed on the surface of p72 protein (fig. 8A and B, red, brilliant blue and yellow). Meanwhile, antigenicity and hydrophilicity indexes of 6 antigen epitopes are predicted through an IEDB online website, and analysis results show that 51 QIEETHL 57 The antigenicity and hydrophilicity of the epitope were high (fig. 9). From the above results, we speculate that 51 QIEETHL 57 Antigenic epitopes are likely to be linear B-cell epitopes important in the p72 protein.
Test II, screening of monoclonal antibody blocking ELISA method
1 materials and methods
1.1 cells and Primary reagents
His-p72t recombinant protein, african swine fever virus p72 monoclonal antibody 5H11, 6C1, 6C6, 6E1, 6E5, 6F7, 6G5, 8B8, 8G4, 9H11, 10B7, 10D2 are prepared, identified and stored by the laboratory. Standard positive and negative sera for African Swine Fever Virus (ASFV) were provided by shigh researchers at the harbin veterinary institute, chinese academy of agricultural sciences. Goat anti-mouse IgG (H + L) -HRP, tetramethylbenzidine (TMB) were purchased from Shanghai Bintian Biotech Ltd.
1.2 blocking ELISA detection of hybridoma cell supernatants
And (3) carrying out a blocking ELISA test on the obtained hybridoma cell supernatant, and detecting whether the monoclonal antibody secreted by the hybridoma cell strain can be blocked by the antibody in the ASFV positive serum so as to judge whether the monoclonal antibody can be used for establishing a blocking ELISA detection method of ASFV. The ASFV blocking ELISA method is carried out according to a conventional method, and the specific test steps are as follows:
the purified His-p72t recombinant protein was diluted to 0.5. Mu.g/mL with carbonate buffer pH 9.6, coated on a 96-well ELISA plate at 100. Mu.L/well, incubated at 37 ℃ for 2h, and then washed 5.05 mol/L PBS containing 0.05% Tween 20 (PBST, pH7.2)Next, each time for 1min. PBST containing 5% skim milk was added as a blocking solution at 200. Mu.L/well, allowed to act at 37 ℃ for 2h, and washed as above. ASFV standard positive and negative sera diluted 1. After washing, hybridoma cell culture supernatant was added thereto at 100. Mu.L/well and allowed to act at 37 ℃ for 1 hour, and the washing was as described above. Further, goat anti-mouse IgG (H + L) -HRP diluted with PBST at 1:1000 was added at 100. Mu.L/well and acted at 37 ℃ for 1H. After washing, TMB substrate solution is added, 100 mu L/well is developed for 10min at 37 ℃ until the negative control develops blue, the positive control basically does not develop color, and 2mol/L sulfuric acid 50 mu L/well is added into each well to stop the reaction. Reading each well OD by enzyme-linked immunosorbent assay 450 nm The value is obtained. The blocking rate (percent inhibition/PI) = [ (negative serum OD) 450 nm value-Positive serum OD 450 nm Value)/negative serum OD 450 nm Value of]×100％。
2 results of
The 12 African swine fever virus p72 protein monoclonal antibodies are respectively subjected to blocking ELISA detection according to the blocking ELISA detection method in 1.2, and the results are shown in Table 5, the blocking rate of the supernatant of the 6E5 hybridoma cell strain is obviously higher than that of the supernatant of other 11 hybridoma cell strains, and the ASFV standard negative serum has no obvious blocking effect on the 12 monoclonal antibodies. Therefore, the monoclonal antibody secreted by the hybridoma cell line 6E5 can be used for establishing an ASFV blocking ELISA method.
TABLE 5 hybridoma cell supernatant blocking ELISA assay results
Test III, establishment and application of ASFV blocking ELISA antibody detection method
1 materials and methods
1.1 cells, strains and Primary reagents
Host bacteria BL21 (DE 3), pET-28a-His-p72t recombinant plasmid and African swine fever virus p72 protein monoclonal antibody 6E5 are prepared, identified and stored by the laboratory. African Swine Fever Virus (ASFV) positive and negative sera were provided by high-step researchers at the Harbin veterinary institute of Chinese academy of agricultural sciences. Porcine pseudorabies virus (PRV), porcine Reproductive and Respiratory Syndrome Virus (PRRSV), classical Swine Fever Virus (CSFV), porcine circovirus type 2 (PCV 2), A-type Seneca Virus (SVA) and porcine Foot and Mouth Disease Virus (FMDV) are collected and stored in the laboratory. Goat anti-mouse IgG (H + L) -HRP, tetramethylbenzidine (TMB) were purchased from Shanghai Binminba Biotech Ltd. The African swine fever virus p30 antibody blocking ELISA kit is purchased from IDvet company of France.
1.2 expression and purification of His-p72t recombinant protein
The pET-28a-His-p72t recombinant plasmid is transformed into BL21 (DE 3), after IPTG induction, recombinant protein purification is carried out according to an inclusion body purification method [2,3] . The purified target protein is subjected to SDS-PAGE electrophoretic identification and BCA method concentration determination, and then stored at-80 ℃ for later use.
1.3 purification of monoclonal antibodies and Horse Radish Peroxidase (HRP) labeling
In the research, the hybridoma cell 6E5 secreting the ASFV p72 protein monoclonal antibody is used for preparing ascites, the ascites is sent to Nanjing King sry Biotech limited for antibody purification and HRP labeling, the purified antibody is subjected to SDS-PAGE analysis, and the enzyme-labeled antibody is titrated by direct ELISA.
1.4 blocking the basic steps of ELISA procedure
The purified His-p72t recombinant protein was diluted in carbonate buffer pH 9.6, coated in 96-well ELISA plates at 100. Mu.L/well, exposed to 37 ℃ for 2h, and then washed 5 times for 1min with 0.05mol/L PBS containing 0.05% Tween 20 (PBST, pH7.2). Adding the confining liquid, 200 mu L/hole, acting for 1-3 h at 37 ℃, and washing as above. Adding the serum to be detected diluted by PBST, performing action for 0.5-2.5 h at 37 ℃, adding the enzyme-labeled monoclonal antibody HRP-6E5 diluted by PBST after washing, performing action for 0.5-1 h at 37 ℃, adding the TMB substrate solution after washing, performing color development for 5-15 min at 37 ℃ at 100 muL/hole until the negative control is blue, performing no color development basically at the positive control, and adding 2mol/L sulfuric acid 50 muL/hole into each hole to terminate the reaction. Reading each well OD by enzyme-linked immunosorbent assay 450nm The value is obtained. Calculating the blocking rate according to the following formulaRate (percent inhibition/PI) = [ (negative serum OD) 450nm Value-measured serum OD 450nm Value)/negative serum OD 450nm Value of]×100％。
1.5 selection of optimal reaction conditions for blocking ELISA
1.5.1 selection of optimal coating concentration for antigen and optimal dilution of serum
The method was performed by a square matrix titration method, and the antigen proteins were diluted to a final concentration of 2.0, 1.0,0.5,0.25, 0.10. Mu.g/mL in a carbonate buffer of pH 9.6, respectively, and the ELISA plates were coated at 37 ℃ for 2 hours. After washing, ASFV-positive serum and negative serum diluted with PBST at 1, 4, 1, 8, 1.
1.5.2 selection of antigen coating conditions
Coating with the above determined optimal antigen coating concentration using the following conditions, respectively: (1) acting for 2 hours at 37 ℃; (2) acting for 12 hours at 4 ℃; (3) after 2 hours of action at 37 ℃,12 hours of action at 4 ℃; after the serum is diluted according to the optimal proportion, blocking ELISA is carried out according to 1.4 basic steps, the blocking rate of each group is calculated, and the optimal antigen coating condition is selected according to the blocking effect.
1.5.3 selection of optimal blocking solution and blocking time
ELISA plates were coated under optimal antigen coating conditions, washed, and then subjected to blocking ELISA assay using a blocking solution containing 5% skim milk, 1% BSA, 0.1% BSA, and 2% gelatin, respectively, to calculate the blocking rate of positive serum and select the optimal blocking solution. After the blocking solution is selected, blocking is carried out for 1h, 2h and 3h at 37 ℃ respectively, and the optimal blocking time is selected.
1.5.4 selection of the duration of action of the serum to be examined
After the ELISA plate is coated and sealed by using the optimal conditions, the serum to be detected with the optimal dilution is added, the ELISA plate is acted for 0.5h, 1.0h, 1.5h, 2.0h and 2.5h at 37 ℃, the blocking ELISA assay is carried out by using the optimal conditions, and the blocking rates of the positive sera of all groups are compared to select the proper serum acting time.
1.5.5 selection of working concentration of enzyme-labeled monoclonal antibody
After the serum to be detected acts according to the optimal conditions, washing the ELISA plate, diluting the enzyme-labeled monoclonal antibody with PBST according to the following ratio of 1.
1.5.6 selection of duration of action of enzyme-labeled monoclonal antibody
Adding the enzyme-labeled monoclonal antibody into an ELISA plate according to the optimal dilution times, respectively acting for 0.5h, 1h and 1.5h at 37 ℃, performing blocking ELISA determination on the positive serum and the negative serum, and comparing the blocking rates of the positive sera in each group to select the proper action time of the enzyme-labeled monoclonal antibody.
1.5.7 selection of optimal development time for the substrate
After the enzyme-labeled antibody acts according to the optimal condition, washing an ELISA plate, adding an enzyme action substrate, acting for 5min, 10min, 15min and 20min at 37 ℃, respectively, and using 2mol/L H 2 SO 4 Reading after 50 μ L/well is stopped, and calculating the positive serum blocking rate of each group to determine the optimal substrate action time.
1.6 determination of blocking ELISA cut-off values
In the research, ASFV negative pig blood samples are used, 119 negative pig serum samples are detected by an African swine fever virus p30 antibody detection kit produced by IDvet company, the cut-off value is detected by the blocking ELISA established in the test paper, and the average blocking rate is calculated
And Standard Deviation (SD) to determine the cut-off value for the determination of blocking ELISA results.
1.7 repeatability test
3 batches of p72 protein coating blocking ELISA plates expressed and purified at different times are used, 3 ASFV positive serums and 2 healthy pig serums are selected, 3 ELISA plates in the same batch and different batches are used for carrying out in-batch and inter-batch repeatability tests, and the coefficient of variation is calculated to verify the repeatability of the method.
1.8 Cross-reactivity test
Porcine PRV, PRRSV, CSFV, PCV2, SVA and FMDV reference positive sera were detected by the blocking ELISA established herein, and ASFV standard negative and positive controls were established. And analyzing whether the method has cross reactivity with other common swine disease antibodies.
1.9 sensitivity, specificity and coincidence analysis
138 known ASFV positive sera with different antibody levels (IDvet African swine fever virus p30 antibody blocking ELISA kit detection) were selected, and blocking ELISA determination was performed under the optimal conditions, and a negative-positive control was set. And judging the sensitivity of the method according to the detection result. In addition, 217 swine serum samples which are identified as negative by the IDvet African swine fever virus p30 antibody blocking ELISA kit are detected by a blocking ELISA method to judge the specificity of the method. Calculated according to the following formula: relative sensitivity (%) = [ number of positives/(number of positives + number of false negatives) ] × 100%; relative specificity (%) = [ number of negatives/(number of negatives + number of false positives) ] × 100%; total percent of agreement (%) = [ (number of positives + number of negatives)/total number of detections ] × 100%.
2 results
2.1 purification of monoclonal antibodies and HRP labeling
The results of SDS-PAGE of 6E5 mouse ascites mAb purification (see FIG. 10) clearly show the antibody light and heavy chains. The mass concentration of the protein is 3.125mg/mL. The purified monoclonal antibody was HRP labeled, and the working concentration of the labeled antibody was 1.
2.2 determination of optimal reaction conditions for blocking ELISA
By screening the concentrations of the various reagents used and optimizing the reaction conditions, the final determination: the optimal antigen coating concentration is 0.5 mug/mL; the optimal blocking reagent was 1% BSA, 200. Mu.L per well, blocking for 2h at 37 ℃; the optimal dilution of the serum to be detected is 1, and the action time is 1h at 37 ℃; the optimal dilution of the enzyme-labeled monoclonal antibody is 1; the optimal reaction time of the substrate is 10min at 37 ℃.
2.3 determination of the cut-off value
119 known negative serums are detected by a blocking ELISA method established in the research,the average blocking rate of the negative serum sample is calculated by statistical analysis of the result
18.78%, a standard deviation of 10.50%, is selected>
Judging the PI to be positive when the PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the result is judged to be suspicious. The test was repeated 1 time, and if the concentration of the antibody was still less than 40%, the antibody was judged to be serum antibody negative.
2.4 repeatability test
The result of the repeatability test shows that the coefficient of variation of 5 parts of serum in the batch and batch-to-batch (see table 6) tests is less than 10%, and the blocking ELISA detection method is proved to have good repeatability.
TABLE 6 blocking ELISA reproducibility test
2.5 Cross-reactivity test
The blocking ELISA method established by the research is utilized to simultaneously detect ASFV, PRV, PRRSV, CSFV, PCV2, SVA and FMDV positive sera. The detection result shows that the reference positive serum of other porcine viruses is negative except the ASFV, which proves that the blocking ELISA method can specifically detect the ASFV antibody and has no cross reaction with other porcine pathogen positive serum (see Table 7).
TABLE 7 specificity test for blocking ELISA
2.6 compliance test
355 swine sera were detected by IDvet ASFV p30 antibody blocking ELISA detection kit and p72 antibody blocking ELISA method established in this study, respectively. The detection result of the kit is 138 positive parts and 217 negative parts. The detection result of the blocking ELISA method established in the research is 142 positive parts and 213 negative parts. It can be seen that the relative sensitivity, relative specificity and total compliance of the blocking ELISA established in this study were 93.5%, 94.0% and 93.8%, respectively (see table 8).
TABLE 8 compliance test for blocking ELISA
Reference to the literature
[1]Wensvoort G,Terpstra C,Pol J M A,Ter Laak E A,Bloemraad M,De Kluyver E P,Kragten C,Van Buiten L,Den Besten A,Wagenaar F J V Q.Mystery swine disease in The Netherlands:the isolation of Lelystad virus[J].1991,13(3):121-130.
[2]Arun,K.,Upadhyay,Anupam,Singh,K.,J.,Mukherjee,Amulya,Microbiology K J F I.Refolding and purification of recombinant L-asparaginase from inclusion bodies of E.coli into active tetrameric protein[J].2014.
[3]Eggenreich B,Willim M,Wurm D J,Herwig C,Spadiut O J B R.Production strategies for active heme-containing peroxidases from E.coli inclusion bodies–a review[J].2016,10(C).
[4]Heimerman M E,Murgia M V,Wu P,Lowe A D,Rowland R R J J O V D I O P O T a a O V L D,Inc.Linear epitopes in African swine fever virus p72 recognized by monoclonal antibodies prepared against baculovirus-expressed antigen[J].2018,30(3):104063871775396.
[5]Juan,Bai,Xinhui,Chen,Kangfu,Jiang,Basit,Zeshan,Ping,Journal J J V.Identification of VP1 peptides diagnostic of encephalomyocarditis virus from swine[J].2014.
[6]Zhang P,Lv L,Sun H,Li S,Fan H,Wang X,Bai J,Jiang P J V M.Identification of linear B cell epitope on gB,gC,and gE proteins of porcine pseudorabies virus using monoclonal antibodies[J].2019,234:83.
[7]Murgia M V,Mogler M,Certoma A,Green D,Monaghan P,Williams D T,Rowland R R R,Gaudreault N N.Evaluation of an African swine fever(ASF)vaccine strategy incorporating priming with an alphavirus-expressed antigen followed by boosting with attenuated ASF virus[J].Arch Virol,2019,164(2):359-370。
Claims (6)
1. A hybridoma cell strain for secreting monoclonal antibodies of African swine fever viruses is named as mouse SP2/0 hybridoma cells 6E5-P72, and is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation addresses as follows: xilu No. 1 Hospital No. 3, beijing, chaoyang, on the day of deposit: 2021, 1, 8 days, with the deposition number: CGMCC NO:21489.
2. an African swine fever virus monoclonal antibody secreted by the hybridoma cell line of claim 1.
3. The use of the African swine fever virus monoclonal antibody of claim 2 in the preparation of an African swine fever virus blocking ELISA antibody detection kit.
4. An African swine fever virus blocking ELISA antibody detection kit is characterized by comprising an ELISA plate coated by recombinant ASFV p72 protein serving as an antigen, ELISA standard positive serum, ELISA negative serum, a monoclonal antibody marked by horseradish peroxidase and TMB substrate solution, wherein the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell strain of claim 1.
5. The African swine fever virus blocking ELISA antibody detection kit of claim 4, wherein the kit further comprises an antigen diluent, a blocking solution, a sample diluent and a stop solution; the antigen diluent is a carbonate buffer solution with pH of 9.6, the blocking solution is 1% BSA, the sample diluent is PBST, and the stop solution is 2mol/L sulfuric acid.
6. The African swine fever virus blocking ELISA antibody detection kit of claim 4, wherein the recombinant ASFV p72 protein is prepared by the method comprising: reference to ASFV Pig/HLJ/2018 strain in GenBank databaseB646LDesigning a specific primer by using a gene sequence:
P72-EcoR I-F：CCG GAATTC ATGGCATCAGGAGGAG
P72-Xho I-R：CGC CTCGAG GAGCGCAAGAGGGGGC
amplifying a 1-329aa region of a B646L gene, cloning a gene fragment obtained by amplification to a pET-28a (+) expression vector to obtain a recombinant plasmid pET-28a-His-p72t, transforming the recombinant plasmid into BL21 (DE 3) for induction expression, collecting precipitates for purification, and obtaining a purified recombinant protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110327732.1A CN113151187B (en) | 2021-03-26 | 2021-03-26 | Monoclonal antibody hybridoma cell of African swine fever virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110327732.1A CN113151187B (en) | 2021-03-26 | 2021-03-26 | Monoclonal antibody hybridoma cell of African swine fever virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113151187A CN113151187A (en) | 2021-07-23 |
| CN113151187B true CN113151187B (en) | 2023-04-18 |
Family
ID=76885013
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110327732.1A Active CN113151187B (en) | 2021-03-26 | 2021-03-26 | Monoclonal antibody hybridoma cell of African swine fever virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113151187B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113717945B (en) * | 2021-08-02 | 2023-08-11 | 河南农业大学 | Hybridoma cell strain secreting monoclonal antibody against African swine fever virus E165R protein, antibody, epitope peptide and application |
| CN113801854B (en) * | 2021-08-27 | 2023-02-28 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Hybridoma cell line secreting European porcine reproductive and respiratory syndrome virus specific monoclonal antibody and application thereof |
| CN114167055B (en) * | 2021-10-21 | 2023-07-18 | 山东绿都生物科技有限公司 | Competitive enzyme-linked immunosorbent assay kit for detecting anti-African swine fever antibodies in serum |
| CN114656553A (en) * | 2022-03-17 | 2022-06-24 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Monoclonal antibody for identifying African swine fever virus p72 protein, kit containing monoclonal antibody and application of monoclonal antibody |
| CN116143888B (en) * | 2022-10-10 | 2024-05-14 | 沈阳农业大学 | African swine fever virus p30 protein antigen epitope polypeptide and application thereof |
| CN115925887B (en) * | 2022-10-27 | 2024-02-09 | 华中农业大学 | African swine fever virus pA104R protein immunodominant B cell epitope, monoclonal antibody thereof and application |
| CN116444652B (en) * | 2023-01-12 | 2023-08-29 | 中国农业科学院兰州兽医研究所 | Preparation method of anti-African swine fever virus specific single-chain antibody |
| CN116444653B (en) * | 2023-03-09 | 2024-03-15 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Preparation and application of blocking African swine fever virus monoclonal antibody hybridoma cell strain |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2024734A6 (en) * | 1989-12-20 | 1992-03-01 | Univ De Oviedo Representada Po | Method for obtaining a recombinant protein and its utilization in the assay for the african swine pest virus (aspv). |
| CN104962581B (en) * | 2015-04-07 | 2018-05-25 | 中国农业科学院兰州兽医研究所 | A kind of recombinant viral vaccine strain for expressing African swine fever virus p72 albumen |
| CN109781980A (en) * | 2019-01-30 | 2019-05-21 | 河南中泽生物工程有限公司 | African swine fever virus rapid detection card and its application |
| WO2020251284A1 (en) * | 2019-06-12 | 2020-12-17 | 연세대학교 원주산학협력단 | P72, p104, p205 protein fragments derived from african swine fever virus, and use thereof |
| CN110658339B (en) * | 2019-12-02 | 2020-03-31 | 北京纳百生物科技有限公司 | Test paper and kit for detecting African swine fever virus and preparation method thereof |
| CN110642926B (en) * | 2019-12-02 | 2020-04-17 | 北京纳百生物科技有限公司 | African swine fever virus p72 recombinant protein, monoclonal antibody and test paper |
-
2021
- 2021-03-26 CN CN202110327732.1A patent/CN113151187B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Linear epitopes in African swine fever virus p72 recognized by monoclonal antibodies prepared against baculovirus-expressed antigen;Heimerman M E等;《Journal of Veterinary Diagnostic Investigation》;20181231;第30卷(第3期);第406-412页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113151187A (en) | 2021-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113151187B (en) | Monoclonal antibody hybridoma cell of African swine fever virus and application thereof | |
| US8232048B2 (en) | Hybridoma cell line producing monoclonal antibody against foot-and-mouth disease virus, the monoclonal antibody therefrom, immunoassay reagent and kit, and immunoassay method | |
| CN108614121B (en) | Bovine viral diarrhea virus E2 protein antigen multi-epitope fusion peptide and preparation and application thereof | |
| CN112111005A (en) | Monoclonal antibody capable of competing with positive serum to bind African swine fever virus B646L antigen and application thereof | |
| CN114874995B (en) | Swine fever virus 2E rns Monoclonal antibody hybridoma cell strain of protein and application | |
| AU2020102599A4 (en) | Indirect ELISA Detection Method and Application of DHAV-3 Antibody Based on VP2 or VP4 Recombinant Protein Antigen | |
| Zhang et al. | Identification of linear B cell epitope on gB, gC, and gE proteins of porcine pseudorabies virus using monoclonal antibodies | |
| CN114236128A (en) | Blocking ELISA kit for detecting porcine acute diarrhea syndrome coronavirus N protein antibody | |
| CN113740536A (en) | African swine fever virus p30 blocking ELISA antibody detection kit and application thereof | |
| CN112980802B (en) | Hybridoma cell secreting novel duck reovirus sigma B protein monoclonal antibody, monoclonal antibody and application | |
| CN113677792A (en) | CSFV subunit vaccine | |
| CN111440228A (en) | Common epitope, antibody, identification method and application of HA2 protein of multiple subtypes of influenza viruses | |
| CN109239341B (en) | Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof | |
| CN108559754B (en) | Porcine reproductive and respiratory syndrome virus GP5 gene modified recombinant protein and application thereof | |
| KR102086089B1 (en) | Akabane viruses blocking ELISA using monoclonal antibodies against recombinant N protein | |
| US20230375548A1 (en) | Indirect enzyme-linked immunosorbent assay detection kit based on p30 protein and p22 protein of african swine fever virus | |
| CN113512098B (en) | Indirect ELISA (enzyme-Linked immuno sorbent assay) method for identifying swine fever virus and bovine viral diarrhea virus serum antibodies and application thereof | |
| CN116284352A (en) | Bovine leukemia virus antibody and detection kit | |
| KR101080071B1 (en) | Rift valley fever competition ELISA using monoclonal antibodies against recombinant N protein | |
| CN113687073A (en) | African swine fever virus p54 blocking ELISA antibody detection kit and application thereof | |
| CN109762052B (en) | Porcine circovirus type 3 Cap recombinant protein and coding gene and application thereof | |
| CN113884674A (en) | Mycoplasma bovis colloidal gold immunoassay test strip, preparation method and application thereof | |
| Jin et al. | Optimized expression, purification of herpes B virus gD protein in escherichia coli, and production of its monoclonal antibodies | |
| CN116333060B (en) | Porcine reproductive and respiratory syndrome virus GP5 protein, preparation method and application thereof, gene, kit and detection method | |
| Hu et al. | Production and characterization of monoclonal antibodies to poly100S1 protein of avian infectious bronchitis virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 210043 Nanjing Agricultural University, Baguazhou street, Qixia District, Nanjing City, Jiangsu Province Patentee after: NANJING AGRICULTURAL University Address before: 211225 Jiangsu Nanjing Lishui District Baima Town National Agricultural Science and Technology Park Nanjing Agricultural University base Patentee before: NANJING AGRICULTURAL University |