CN113151187A - Monoclonal antibody hybridoma cell of African swine fever virus and application thereof - Google Patents

Abstract

The invention discloses a monoclonal antibody hybridoma cell of African swine fever virus and application thereof, wherein the hybridoma cell strain is named as mouse SP2/0 hybridoma cell, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation addresses as follows: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, on the day of deposit: 2021, 1, 8 days, with the deposition number: CGMCC NO: 21489. the invention successfully prepares and screens 1 monoclonal antibody of anti-ASFV p72 protein, which is used for establishing an ASFV blocking ELISA antibody detection method. The method has high sensitivity and specificity, good repeatability and important application value.

Description

Monoclonal antibody hybridoma cell of African swine fever virus and application thereof

Technical Field

The invention belongs to the technical field of immunological detection methods, and particularly discloses an African swine fever virus monoclonal antibody hybridoma cell and application thereof.

Background

African Swine Fever (ASF) is seriously harming the development of the swine industry in China. At present, no safe and effective vaccine exists internationally. The virus research is slow, and an effective antibody detection reagent is lacking clinically. The research successfully prepares and screens 1 monoclonal antibody of ASFV p72 protein, establishes a method for detecting blocking ELISA antibody, has sensitivity and specificity reaching the level of international like products, and has important application value.

Disclosure of Invention

The invention aims to provide an African swine fever virus monoclonal antibody hybridoma cell strain and a monoclonal antibody secreted by the same.

The invention also aims to provide an African swine fever virus antibody detection blocking ELISA kit.

The invention also aims to provide application of the African swine fever virus antibody detection blocking ELISA kit.

The purpose of the invention can be realized by the following technical scheme:

a hybridoma cell strain for secreting monoclonal antibodies of African swine fever viruses is named as mouse SP2/0 hybridoma cell, and is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation addresses as follows: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, on the day of deposit: 2021, 1, 8 days, with the deposition number: CGMCC NO: 21489.

An African swine fever virus monoclonal antibody is secreted and produced by the hybridoma cell strain.

The African swine fever virus monoclonal antibody is applied to preparation of an African swine fever virus blocking ELISA antibody detection kit.

The African swine fever virus monoclonal antibody is applied to detection of African swine fever virus by a non-diagnosis and treatment blocking ELISA antibody.

An African swine fever virus blocking ELISA antibody detection kit comprises an ELISA plate coated by recombinant ASFV p72 protein serving as an antigen, ELISA standard positive serum, ELISA negative serum, a horseradish peroxidase-labeled monoclonal antibody and a TMB substrate solution, wherein the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell strain of claim 1.

As a preferred technical scheme, the kit also comprises antigen diluent, confining liquid, sample diluent and stop solution; more preferably, the antigen dilution is a carbonate buffer solution with pH 9.6 (0.17 g anhydrous Na is weighed)₂CO₃、0.28g NaHCO₃In double distilled water and making the volume to 100mL), the blocking solution is 1% BSA, the sample diluent is PBST, and the stop solution is 2mol/L sulfuric acid.

Further preferably, the preparation method of the recombinant ASFV p72 protein comprises the following steps: specific primers were designed by referring to the B646L (p72) gene sequence of the ASFV Pig/HLJ/2018(GenBank MK333180) strain in GenBank database: :

P72-EcoR I-F：CCGGAATTCATGGCATCAGGAGGAG

P72-Xho I-R：CGCCTCGAGGAGCGCAAGAGGGGGC

amplifying a 1-329aa region of a B646L gene, cloning the amplified gene fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid pET-28a-His-p72t, transforming the recombinant plasmid into BL21(DE3) for induced expression, collecting precipitates, and purifying to obtain a purified recombinant protein His-p72 t.

The blocking ELISA antibody detection kit is applied to the detection of African swine fever virus antibodies, and the application does not aim at the diagnosis and treatment of diseases.

A non-diagnosis and treatment purpose African swine fever virus blocking ELISA antibody detection method comprises the following steps:

(1) coating an ELISA plate; using His-p72t as antigen, diluting purified His-p72t with antigen diluent to coat an ELISA plate;

(2) blocking the ELISA plate with blocking solution;

(3) adding diluted serum to be detected for incubation;

(4) adding diluted enzyme-labeled monoclonal antibody, wherein the monoclonal antibody is the monoclonal antibody of claim 2;

(5) color development, termination, and OD reading on microplate reader_450nmA value;

(6) the blocking rate (percent inhibition/PI) was calculated according to the following formula, and the blocking rate was [ ("negative serum OD)_450nmvalue-Positive serum OD_450nmValue)/negative serum OD_450nmValue of]X is 100%; judging the PI to be positive when the PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious.

The invention mainly has the following key points:

(1) 12 monoclonal antibodies are developed, and the epitope thereof is defined. 12 hybridoma cell strains which stably secrete the ASFV p72 protein monoclonal antibody are developed. Western blot results show that all monoclonal antibodies can perform specific reaction with ASFV. IFA results indicated that only the 6C6 and 6G5 monoclonal antibodies were able to recognize ASFV. 6 different linear B-cell epitopes of p72 protein were identified. The result of bioinformatics analysis shows that,⁵¹QIEETHL⁵⁷,⁶³HFKPYVPV⁷⁰, ⁸³TPTLGNKL⁹⁰,¹⁴⁷QTPLEGAV-YTL¹⁵⁷and²⁰⁸TTLVRKFCI²¹⁶the antigenic epitopes are highly conserved among different strains of ASFV. However,²⁴³CNIHDLHK²⁵⁰the antigenic epitopes are poorly conserved among different strains of ASFV.⁵¹QIEETHL⁵⁷The epitope has high antigenicity and hydrophilicity, and is completely exposed on the surface of the p72 protein. Thus, it is possible to provide⁵¹QIEETHL⁵⁷The antigenic epitope is probably an important linear B cell epitope in the p72 protein.

(2) Screening out a good monoclonal antibody for blocking ELISA, and having high specificity. The 12 monoclonal antibodies are respectively used for blocking an ELISA antibody detection method and detecting ASFV negative and positive serum antibodies, and the 6E5 monoclonal antibody has the best detection effect.

(3) Successfully establishes a monoclonal antibody blocking ELISA antibody detection method. The optimal antigen coating concentration and the optimal dilution multiple of serum are determined by a chessboard method by using the purified recombinant p72 protein as a coating antigen. And optimizing other conditions (sealing liquid, sealing time, serum reaction time, enzyme-labeled antibody dilution, enzyme-labeled antibody reaction time and the like) for blocking ELISA, and the result shows that: the optimal antigen coating concentration is 0.5 mug/mL; the best blocking agent is 1% BSA, 200 μ L of the blocking agent is used in each hole, and the blocking is carried out for 2h at 37 ℃; the optimal dilution of the serum to be detected is 1:1, and the action time is 1h at 37 ℃; the optimal dilution of the enzyme-labeled monoclonal antibody is 1:4000, and the optimal reaction condition is 1h at 37 ℃; the optimal reaction time of the substrate is 10min at 37 ℃. The judgment criteria for the ELISA results were: the serum sample is judged to be positive if the blocking rate PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious. The method has no cross-reactivity with PRV, PRRSV, CSFV, PCV2, SVA and FMDV positive sera. ELISA repeatability tests show that the coefficient of variation between batches and within batches is less than 10%. The comparative experiment results show that the relative sensitivity and specificity of the ELISA are 93.5% and 94.0%, respectively, and the coincidence rate of the ELISA kit with IDvet ASFV p30 blocking ELISA kit is 93.8%. The method has high sensitivity, strong specificity and high repetition rate, and can be used for African swine fever virus antibody detection and serum epidemiology investigation.

The invention has the beneficial effects that:

the invention successfully prepares and screens 1 monoclonal antibody of ASFV p72 protein, establishes a method for detecting the blocking ELISA antibody, has sensitivity and specificity reaching the level of international like products, and has important application value.

Drawings

FIG. 1 PCR-amplified fragment ASFV B646L (1-329 aa).

FIG. 2 is the prokaryotic expression identification of His-p72t recombinant protein;

wherein, A, SDS-PAGE analyzes the prokaryotic expression of His-p72t recombinant protein; m: protein molecular weight standards; 1: inducing the supernatant; 2: inducing precipitation; 3: inducing the whole bacteria; 4: whole bacteria are not induced; 5: inducing empty carrier whole bacteria; 6: purifying the His-p72t recombinant protein; western blot analysis of the antigenicity of the His-p72t recombinant protein; m: protein molecular weight standards; 1: inducing precipitation; 2: inducing empty carrier whole bacteria.

FIG. 3 determination of serum titers in immunized mice.

FIG. 4 is a diagram for identifying the reactivity of the monoclonal antibody Western blot.

FIG. 5 reactivity identification of monoclonal antibody IFA.

FIG. 6 monoclonal antibody epitope identification;

the results showed that the 6C6 and 6G5 monoclonal antibodies were able to react with F1, F11, F12, F13 and F14 fragments, and were unable to react with F2, F3, F4, F7 and F10 fragments, demonstrating that the epitopes recognized by 6C6 and 6G5 are located at the same site⁵¹QIEETHL⁵⁷(FIG. 6A); the 6F7 and 8G4 monoclonal antibodies can react with F1, F9, F10 and F13 fragments and cannot react with F2, F3, F4, F7 and F8 fragments, and the epitope recognized by 6F7 and 8G4 is proved to be positioned in⁶³HFKPYVPV⁷⁰(FIG. 6B); the 8B8 and 9H11 monoclonal antibodies can react with F1, F6, F7, F8 and F13 fragments and cannot react with F2, F3, F4 and F5 fragments, and the fact that the epitope of the monoclonal antibodies recognized by 8B8 and 9H11 is located on⁸³TPTLGNKL⁹⁰(FIG. 6C); the 6E1 and 10B7 monoclonal antibodies were able to react with F1, F2 and F17 fragments, but not with F15 and F16 fragments, demonstrating that the epitopes of 6E1 and 10B7 are located in¹⁴⁷QTPLEGAVYTL¹⁵⁷(FIG. 6D); the 6C1, 6E5 and 10D2 monoclonal antibodies can react with F2, F19, F20 and F23 fragments and cannot react with F1, F18, F25 and F26 fragments, and the epitope recognized by 6C1, 6E5 and 10D2 is proved to be positioned at²⁰⁸TTLVRKFCI²¹⁶(FIG. 6E); the 5H11 monoclonal antibody can be matched with F2 and F22. F23 and F24 fragment reacted and could not react with F1, F18, F19, F20 and F21 fragments, and the epitope of 5H11 was proved to be located²⁴³CNIHDLHK²⁵⁰(FIG. 6F).

FIG. 7 epitope conservation analysis;

wherein, A: comparing the amino acid sequences of different ASFV strains p 72; b: his-p72t (L)⁵⁷M) identifying the reactivity of the mutant; 1: his-p72 t; 2: his-p72t (L)⁵⁷M)；C：His-p72t(V⁷⁰I) Identifying the reactivity of the mutant; 1: his-p72 t; 2: his-p72t (V)⁷⁰I)；D：His-p72t(V²¹¹A) Identifying the reactivity of the mutant; 1: his-p72 t; 2: his-p72t (V)²¹¹A)；E：His-p72t(I²⁴⁵V,H²⁴⁶Q,L²⁴⁸M) identifying the reactivity of the mutant; 1: his-p72 t; 2: his-p72t (I)²⁴⁵V,H²⁴⁶Q,L²⁴⁸M)。

FIG. 8 epitope spatial structure analysis;

wherein, A: p72 protein secondary structure; b: surface structure of P72 protein.

FIG. 9 analysis of hydrophilicity and antigenicity of p72 protein;

wherein, A: p72 protein hydrophilicity analysis; b: p72 protein antigenicity analysis.

FIG. 10 SDS-PAGE analysis of monoclonal antibody purification;

wherein, M: protein molecular mass standard; 1: ascites of 6E5 monoclonal antibody; 2: purified 6E5 mab sample.

Detailed Description

The following examples are for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods used in the following examples are all conventional experimental methods unless otherwise specified. The test materials and the like used in the following examples are available from conventional biochemicals, unless otherwise specified.

Test I, development of ASFV monoclonal antibody

1. Materials and methods

1.1 cells, viruses and laboratory animals

Virulent ASFV Pig/HLJ/2018(GenBank MK333180) strains were deposited by the Harbin veterinary institute and maintained in biologiesViral infection experiments were performed in the safety class 3 laboratory (BSL-3). Mouse myeloma cells (SP2/0) were stored in this laboratory. Primary PAM cell reference^[1]The protocol was taken from 4-week old normal piglets that were ASFV negative. SPF-grade 6-8 week-old female BALB/c mice and ICR mice were purchased from the center of Yangzhou university laboratory animals.

1.2 vectors, strains and Primary Agents

Prokaryotic expression vectors pET-28a (+), pET-32a (+), and E.coli DH5 alpha and BL21(DE3) were stored in the laboratory. Restriction endonucleases EcoRI, Xho I and T4 DNA ligase were purchased from Thermo Fisher; IPTG, Freund's complete adjuvant, Freund's incomplete adjuvant, HAT, HT, PEG4000 were all purchased from Sigma; RPMI-1640 medium, fetal bovine serum, was purchased from Gibco, USA; TMB developing solution and goat anti-mouse IgG (H + L) -HRP were purchased from Shanghai Bin Yuntian biotechnology limited; FITC-labeled goat anti-mouse IgG was purchased from proteintech; the mouse monoclonal antibody subtype identification kit is purchased from Proteitech Biotech limited; the Tanon TM High-sig ECL Western blotting substrate kit is purchased from Shanghai Tianneng science and technology Limited; other reagents are all domestic analytical purifiers.

1.3 Gene sequence Synthesis and recombinant plasmid construction

A B646L gene sequence of an ASFV Pig/HLJ/2018(GenBank MK333180) strain in a GenBank database is referred to, PCR primers containing an enzyme cutting site are designed and synthesized (the specific primer sequences are shown in a table 1) to amplify a 1-329aa region of a B646L gene. The primers contained EcoR I and Xho I cleavage sites to allow cloning of the amplified sequence into the pET-28a (+) expression vector. PCR amplification procedure: 2min at 95 ℃; 35 cycles of 95 ℃ for 10s, 53 ℃ for 30s and 72 ℃ for 30 s; extension at 72 ℃ for 5 min. The PCR product was analyzed by electrophoresis through a 1% agarose gel and recovered. The pET-28a (+) vector and the fragment of interest were treated with EcoR I and Xho I restriction endonucleases and recovered. The cleaved target fragment and the vector were ligated with T4 DNA ligase at 22 ℃ for 2 h. And transforming the ligation product into DH5a, carrying out PCR identification and double-restriction enzyme identification on the obtained product, sending the obtained product to a general biological system company for sequencing, and naming the plasmid with correct sequencing as pET-28a-p72 and storing the plasmid at-20 ℃ for later use.

TABLE 1 primer sequences for amplification of amino acid fragments 1-329 of the B646L gene

1.4 inducible expression and purification of p72 recombinant protein

Respectively transforming recombinant plasmids pET-28a-His-p72t and pET-28a (+) into BL21(DE3) in no-load mode, picking out single colonies, carrying out shake culture at 37 ℃ and 200 Xg for 16h, inoculating bacterial liquid in a ratio of 1:100 into 500mL of liquid LB culture medium (containing 100 mu g/mL of kanamycin) and carrying out shake culture at 37 ℃ and 200 Xg until bacterial liquid OD is reached_{450 nm}The concentration was about 0.6 to 0.8, IPTG was added to the cells at a final concentration of 1mM/L, the cells were cultured at 37 ℃ and 200 Xg with shaking for 6 hours, the cells were centrifuged at 8,000Xg for 10 minutes, the cells were washed 3 times with PBS (0.1mM/L), and the cells were resuspended in 20mL of PBS (0.1 mM/L). Then using an ultrasonicator to crack thalli, centrifuging at 4 ℃ for 10min at 12,000 Xg, collecting precipitates and carrying out SDS-PAGE and Western blot analysis on the supernatant so as to identify the expression form and immunogenicity of the thalli. Purification of His-p72t recombinant protein by Urea dialysis^[2,3]. The concentration of the recombinant p72 protein was determined by BCA method, and the purified His-p72t was stored at-80 ℃ for a long period of time.

1.5 preparation of monoclonal antibody against ASFV p72 protein

1.5.1 animal immunization

The animal protocol was approved by the animal protection and ethics committee of the university of Nanjing agriculture. Animal experiments were performed according to the guidelines for biomedical research in animals. Mouse immunization program reference documentation^[4]. The purified His-p72t recombinant protein is mixed with Freund's complete adjuvant 1:1 evenly and emulsified, and the mice are immunized by subcutaneous multi-point injection, and the immunization dose is 50 mu g/mouse. Emulsifying the second and third immunizations with Freund incomplete adjuvant, separating each immunization by two weeks, collecting blood from the tail of the mouse one week after the 3 rd immunization, and measuring the titer of serum antibody by using an indirect ELISA method; and 3 days before fusion, selecting a mouse with the highest antibody titer for impact immunization, and injecting 100 mu g of recombinant protein into the abdominal cavity.

1.5.2 monoclonal antibody preparation

P72 monoclonalReference to antibody preparation^[4-6]A method is described. Balb/c mice were euthanized three days after the ballistic immunization and splenocytes isolated and cell fused with SP2/0 cells in log phase at a 7:1 ratio under the action of PEG 4000. The fused cells were plated in 96-well plates and cultured in HAT selection medium. After 7 days of cell fusion, 100. mu.L of culture supernatant was aspirated for detection.

Screening positive hybridoma cells by adopting an indirect ELISA method, coating the purified His-p72t recombinant protein serving as an antigen-coated enzyme label plate (the antigen coating concentration is 1 mu g/mL) at 4 ℃ overnight and sealing the antigen-coated enzyme label plate with 5% skim milk at 37 ℃ for 2 h. Taking multi-antiserum of an immune group mouse as positive serum and serum of a control group mouse as negative serum, respectively diluting the serum at a ratio of 1:500, and reacting the serum with a coating antigen at 37 ℃ for 1 h; PBST washing plate 3 times, adding 100 u L goat anti mouse IgG (H + L) -HRP (1:1000 dilution) at 37 ℃ reaction for 45 min; PBST washing the strips for 3 times, adding 100 μ L of TMB color developing solution, developing at 37 deg.C in dark for 10min, adding 50 μ L of 2M H₂SO₄The reaction was terminated. OD reading with microplate reader_450nmAbsorbance. And selecting the cell hole with the P/N value larger than 2.1 for subcloning.

Positive hybridoma cells are subcloned for 2-3 times by limiting dilution method until the antibody positive rate reaches 100%. And (3) carrying out expanded culture on the hybridoma cell strain capable of stably secreting the antibody, and freezing and storing the cells in liquid nitrogen for a long time. Selecting a 12-week-old BALB/c mouse to prepare monoclonal antibody ascites, collecting the ascites when the abdomen of the mouse is enlarged and the mouse has fluctuation, centrifuging for 10min at 8,000Xg, collecting supernatant, and measuring the antibody titer of the monoclonal antibody by an indirect ELISA method. Taking hybridoma cell culture supernatant, and carrying out subtype identification on the monoclonal antibody according to the specification of the mouse monoclonal antibody subtype identification kit.

1.6 identification of immunoblots (Western blot)

PAMs were plated in 12-well plates (2.0X 10)⁶One/well), cells were inoculated with the ASFV Pig/HLJ/2018 strain at MOI ═ 1, and cell samples were collected 24 hours after infection, subjected to SDS-PAGE electrophoresis according to a conventional method, and transferred onto a nitrocellulose membrane (NC membrane) by wet transfer. The NC membranes were blocked with 5% skim milk PBST block solution at room temperature for 2h, followed by 3 washes with PBST for 10min each. Then the NC film is coatedPlacing into ASFV standard positive serum (1:200 dilution) or monoclonal antibody (1:1000 dilution), and incubating for 1h at room temperature. The NC membrane was placed in staphylococcal protein A-HRP (1:10000 dilution) or goat anti-mouse IgG (H + L) -HRP (1:1000 dilution) and incubated at room temperature for 45min, as above. And carrying out exposure development identification by using a Tanon TM High-sig ECL Western blotting substrate kit.

1.7 Indirect immunofluorescence assay (IFA)

Reference to indirect immunofluorescence experiments^[7]The method was described with some modifications. PAM cells were plated at 1X 10⁶The density of each well is paved on a 48-well plate, cells are inoculated by ASFV Pig/HLJ/2018 strain according to MOI-1, and meanwhile, normal cells are set as a blank control. 24h after infection, cells were washed 3 times with PBS and then fixed for 30 min at-20 ℃ with pre-chilled absolute ethanol. Cells were washed 3 times with PBS and 2% BSA was added and blocked at 37 ℃ for 2 h. Subsequently, 100. mu.L of supernatant of positive hybridoma cells was added to each well and reacted at 37 ℃ for 1 hour while setting up SP2/0 cell supernatant as a negative control for primary antibody. After washing, FITC-labeled goat anti-mouse IgG (1:200 dilution) was added, reacted at 37 ℃ for 1 hour, and then observed under a fluorescence microscope.

1.8 preliminary identification of epitopes

To preliminarily identify the epitope of the monoclonal antibody, a series of overlapping truncated B646L genes (see table 2 for specific primer sequences) were amplified by PCR and cloned into pET-32a (+). Expressing the recombinant protein by using an escherichia coli prokaryotic expression system, and carrying out Western blot identification by using hybridoma cell supernatant as a primary antibody and using goat anti-mouse IgG (H + L) -HRP as a secondary antibody.

TABLE 2 primer sequences for amplifying overlapping fragments of the B646L gene

1.9 bioinformatics analysis

The conservation of the ASFV strains is analyzed by comparing the sequences of the same epitope of different ASFV strains through BioEdit V7.0 software. Meanwhile, the spatial distribution of different epitopes in the crystal structure of the p72 protein is shown by PyMol software by obtaining the crystal structure data (PDB:6L2T) of the p72 protein from an RCSB website (http:// www1.RCSB. org /). In addition, the antigenicity and hydrophilicity of the different epitopes were analyzed by the IEDB website (http:// tools. immune-epitope. org/main /).

2 results

2.1 construction of prokaryotic expression vector of B646L Gene

A B646L (1-329aa) gene fragment was amplified by PCR (FIG. 1, the ASFV B646L (1-329aa) fragment was amplified by PCR). The target fragment and pET-28a (+) are respectively cut by EcoR I and Xho I restriction endonucleases in no-load and then are connected and transformed, and the recombinant plasmid is named as pET-28a-His-p72t after being cut by enzyme, identified and sequenced.

2.2His-p72t recombinant protein prokaryotic expression identification

The expression bacteria are subjected to ultrasonic disruption treatment and then subjected to SDS-PAGE electrophoretic analysis. The results show that: at the concentration of IPTG of 1mM/L, after 6 hours of induction at 37 ℃, compared with an unloaded control group, the pET-28a-His-p72t transformed bacteria have a distinct difference band at 40KDa, and the size is consistent with the expected size. The recombinant protein was expressed in the pellet of bacterial lysate mainly as inclusion bodies (FIG. 2A, lane 2). The His-p72t recombinant protein was purified by inclusion body purification, and the purity of the target protein was high (FIG. 2A, lane 6). Western Blot results showed that His-p72t recombinant protein was able to specifically react with ASFV-positive serum, and a specific reaction band was visible at 40kDa (FIG. 2B, lane 1).

2.3 mouse serum titer assay

The serum titer of mice immunized with His-p72t recombinant protein was determined by indirect ELISA. As shown in FIG. 3, all mice in the immunized group exhibited higher levels of p72 protein antibody titers (titer range: 1:12,800 to 1:25,600) after three boosts compared to the negative mice.

2.4 preparation and characterization of P72 monoclonal antibody

In this study, 12 monoclonal antibodies were screened by indirect ELISA. The reactivity of the monoclonal antibody is further verified by Western blot experiment and IFA experiment. The antibody subtype identification showed that the heavy chain of the 12-strain monoclonal antibody was of the IgG1 type and the light chain was of the Kappa chain (Table 3). The p72 indirect ELISA method is used for measuring the ascites titer of the monoclonal antibody, and the result shows that the ascites has higher level of p72 protein antibody titer (Table 3).

TABLE 3 results of ascites titer and subtype identification of monoclonal antibodies

2.5Western blot reactivity identification

Westernblot results show that the monoclonal antibodies can specifically react with ASFV and have obvious target bands at 73.2KDa (figure 4)

2.6IFA reactivity identification

The IFA results showed that only the 6C6 and 6G5 monoclonal antibodies reacted specifically with ASFV to show a clear green fluorescence (fig. 5).

2.7 epitope identification of monoclonal antibodies

A series of p72 protein truncations are expressed by a prokaryotic expression system (table 2), and the epitope of the monoclonal antibody is preliminarily identified by using a Western blot experiment. The results showed that the 6C6 and 6G5 monoclonal antibodies were able to react with F1, F11, F12, F13 and F14 fragments, and were unable to react with F2, F3, F4, F7 and F10 fragments, demonstrating that the epitopes recognized by 6C6 and 6G5 are located at the same site⁵¹QIEETHL⁵⁷(FIG. 6A). The 6F7 and 8G4 monoclonal antibodies can react with F1, F9, F10 and F13 fragments and cannot react with F2, F3, F4, F7 and F8 fragments, and the epitope recognized by 6F7 and 8G4 is proved to be positioned in⁶³HFKPYVPV⁷⁰(FIG. 6B). The 8B8 and 9H11 monoclonal antibodies can react with F1, F6, F7, F8 and F13 fragments and cannot react with F2, F3, F4 and F5 fragments, and the fact that the epitope of the monoclonal antibodies recognized by 8B8 and 9H11 is located on⁸³TPTLGNKL⁹⁰(FIG. 6C). The 6E1 and 10B7 monoclonal antibodies were able to react with F1, F2 and F17 fragments, but not with F15 and F17 fragmentsF16 fragment reaction, and proves that the epitopes of 6E1 and 10B7 are positioned in¹⁴⁷QTPLEGAVYTL¹⁵⁷(FIG. 6D). The 6C1, 6E5 and 10D2 monoclonal antibodies can react with F2, F19, F20 and F23 fragments and cannot react with F1, F18, F25 and F26 fragments, and the epitope recognized by 6C1, 6E5 and 10D2 is proved to be positioned at²⁰⁸TTLVRKFCI²¹⁶(FIG. 6E). The 5H11 monoclonal antibody can react with F2, F22, F23 and F24 fragments and cannot react with F1, F18, F19, F20 and F21 fragments, and the epitope of the 5H11 is proved to be positioned in²⁴³CNIHDLHK²⁵⁰(FIG. 6F).

2.8 conservative analysis of epitopes

The conservation of the epitopes in different strains was analyzed by aligning the p72 amino acid sequences of the 18 ASFV reference strain (Table 4) using the BioEidt V7.0 software. The amino acid alignment results are shown in FIG. 7A, 6 different epitopes are labeled with different colors,⁸³TPTLGNKL⁹⁰and¹⁴⁷QTPLEGAVYTL¹⁵⁷the epitope is highly conserved among 9 ASFV genotypes.⁵¹QIEETHL⁵⁷And⁶³HFKPYVPV⁷⁰epitopes are conserved in genotypes I, II, III, IV, Va and XXa, but "L" appears in genotypes VIII, Xb and XXI⁵⁷M”,“V⁷⁰I "mutation.²⁰⁸TTLVRKFCI²¹⁶Antigenic epitopes present "V" only in the ETH/1a (KT795359) strain²¹¹Mutation of A'. However, p72 (L) was expressed using a prokaryotic system⁵⁷M)、 p72(V⁷⁰I)、p72(V²¹¹A) The protein is subjected to Western blot reactivity identification, and the result shows that the mutated protein can still be recognized by a corresponding monoclonal antibody (FIGS. 7B, C and D), which indicates that the epitopes are conserved among ASFV strains.²⁴³CNIH- DLHK²⁵⁰Epitopes are highly conserved in genotypes I, II, III, IV, Va, VIII and XXa, but appear as "I" in genotypes Xb and XXII²⁴⁵V”、“H²⁴⁶Q 'and' L²⁴⁸M ", and these mutations resulted in the inability of the 5H11 monoclonal antibody to recognize the p72 protein.

TABLE 4 case of 18 ASFV reference strains cited herein

2.9 analysis of spatial structural features of epitope

The spatial conformation of the p72 protein (PDB:6L2T) was displayed using PyMol software. The results of the spatial distribution of epitopes are shown in FIG. 8, 6 different epitopes are labeled with different colors,²⁰⁸TTLVRKFCI²¹⁶the epitope was helical and partially exposed on the surface of p72 protein (fig. 8A and B, purple).⁶³HFKPYVPV⁷⁰And²⁴³CNIHDLHK²⁵⁰the epitope was randomly coiled and partially exposed on the surface of p72 protein (fig. 8A and B, green and brown).⁵¹QIEETHL⁵⁷、¹⁴⁷QTPLEGAVYTL¹⁵⁷And⁸³TPTLGNKL⁹⁰the epitope was randomly coiled and completely exposed on the surface of p72 protein (fig. 8A and B, red, brilliant blue and yellow). Meanwhile, antigenicity and hydrophilicity indexes of 6 antigen epitopes are predicted through an IEDB online website, and analysis results show that⁵¹QIEETHL⁵⁷The antigenicity and hydrophilicity of the epitope were high (fig. 9). From the above results, we speculate that⁵¹QIEETHL⁵⁷The antigenic epitope is probably an important linear B cell epitope in the p72 protein.

Test II, screening of monoclonal antibody blocking ELISA method

1 materials and methods

1.1 cells and Primary reagents

His-p72t recombinant protein, African swine fever virus p72 monoclonal antibody 5H11, 6C1, 6C6, 6E1, 6E5, 6F7, 6G5, 8B8, 8G4, 9H11, 10B7 and 10D2 are prepared, identified and preserved by the laboratory. African Swine Fever Virus (ASFV) standard positive and negative sera were provided by the Shimad high investigator of the Harbin veterinary institute, Chinese academy of agricultural sciences. Goat anti-mouse IgG (H + L) -HRP, Tetramethylbenzidine (TMB) were purchased from Shanghai Bintian Biotech Ltd.

1.2 blocking ELISA detection of hybridoma cell supernatants

And (3) carrying out a blocking ELISA test on the obtained hybridoma cell supernatant, and detecting whether the monoclonal antibody secreted by the hybridoma cell strain can be blocked by the antibody in the ASFV positive serum so as to judge whether the monoclonal antibody can be used for establishing a blocking ELISA detection method of ASFV. The ASFV blocking ELISA method is carried out according to a conventional method, and the specific test steps are as follows:

the purified His-p72t recombinant protein was diluted to 0.5. mu.g/mL with carbonate buffer pH 9.6, coated in a 96-well ELISA plate at 100. mu.L/well, incubated at 37 ℃ for 2h, and then washed 5 times for 1min each with 0.05mol/L PBS containing 0.05% Tween 20 (PBST, pH 7.2). PBST containing 5% skim milk was added as a blocking solution, 200. mu.L/well, allowed to react at 37 ℃ for 2h, and washed as above. ASFV standard positive serum and negative serum diluted 1:1 with PBST were added at 100. mu.L/well and exposed at 37 ℃ for 1h, triplicate were set for each group, and the results were averaged. After washing, hybridoma cell culture supernatant was added thereto at 100. mu.L/well and allowed to act at 37 ℃ for 1 hour, and the washing was as described above. Further, goat anti-mouse IgG (H + L) -HRP diluted 1:1000 in PBST was added at 100. mu.L/well and allowed to act at 37 ℃ for 1H. After washing, TMB substrate solution is added, 100 mu L/well is developed for 10min at 37 ℃ until negative control develops blue, positive control basically does not develop color, and 2mol/L sulfuric acid 50 mu L/well is added into each well to stop reaction. Reading each well OD by enzyme-linked immunosorbent assay_{450 nm}The value is obtained. The blocking rate (percent inhibition/PI) was calculated according to the following formula, and the blocking rate was [ ("negative serum OD)_{450 nm}value-Positive serum OD_{450 nm}Value)/negative serum OD_{450 nm}Value of]×100％。

2 results

The 12 African swine fever virus p72 protein monoclonal antibodies are respectively subjected to blocking ELISA detection according to the blocking ELISA detection method in 1.2, and the results are shown in Table 5, the blocking rate of the supernatant of the 6E5 hybridoma cell line is obviously higher than that of the supernatant of other 11 hybridoma cell lines, and the ASFV standard negative serum has no obvious blocking effect on the 12 monoclonal antibodies. Therefore, the monoclonal antibody secreted by the hybridoma cell line 6E5 can be used for establishing an ASFV blocking ELISA method.

TABLE 5 hybridoma cell supernatant blocking ELISA assay results

Test III, establishment and application of ASFV blocking ELISA antibody detection method

1 materials and methods

1.1 cells, strains and Primary reagents

Host bacteria BL21(DE3), pET-28a-His-p72t recombinant plasmid and African swine fever virus p72 protein monoclonal antibody 6E5 are prepared, identified and preserved by the laboratory. African Swine Fever Virus (ASFV) positive and negative sera were provided by high-step researchers at the Harbin veterinary institute of Chinese agricultural academy of sciences. Porcine pseudorabies virus (PRV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Classical Swine Fever Virus (CSFV), porcine circovirus type 2 (PCV2), type A Seneca Virus (SVA) and porcine Foot and Mouth Disease Virus (FMDV) are collected and stored in the laboratory. Goat anti-mouse IgG (H + L) -HRP, Tetramethylbenzidine (TMB) were purchased from Shanghai Bintian Biotech Ltd. The African swine fever virus p30 antibody blocking ELISA kit was purchased from IDvet, France.

1.2 expression and purification of His-p72t recombinant protein

The pET-28a-His-p72t recombinant plasmid is transformed into BL21(DE3), and after IPTG induction, recombinant protein is purified according to an inclusion body purification method^[2,3]. The purified target protein is stored at-80 ℃ for later use after SDS-PAGE electrophoretic identification and BCA method determination of concentration.

1.3 purification of monoclonal antibodies and Horse Radish Peroxidase (HRP) labeling

In the research, the hybridoma cell 6E5 secreting the ASFV p72 protein monoclonal antibody is used for preparing ascites, the ascites is sent to Nanjing Kingsry Biotech limited for antibody purification and HRP labeling, the purified antibody is subjected to SDS-PAGE analysis, and the enzyme-labeled antibody is titrated by direct ELISA.

1.4 blocking basic steps of ELISA procedure

The purified His-p72t recombinant protein was diluted with carbonate buffer pH 9.6, coated in 96-well ELISA plates at 100. mu.L/well, incubated at 37 ℃ for 2h, and then washed 5 times for 1min each with 0.05mol/L PBS containing 0.05% Tween 20 (PBST, pH7.2). Adding confining liquid, reacting at 200 mu L/hole for 1-3 h at 37 ℃, and washing as above. Adding PBST diluted serum to be detected, performing action for 0.5-2.5 h at 37 ℃, adding PBST diluted enzyme-labeled monoclonal antibody HRP-6E5 after washing, performing action for 0.5-1 h at 37 ℃, adding TMB substrate solution after washing, performing color development for 5-15 min at 37 ℃ at 100 muL/hole until negative control develops blue, performing no color development basically at positive control, and adding 2mol/L sulfuric acid 50 muL/hole into each hole to terminate the reaction. Reading each well OD by enzyme-linked immunosorbent assay_450nmThe value is obtained. The blocking rate (percent inhibition/PI) was calculated according to the following formula, and the blocking rate was [ ("negative serum OD)_450nmValue-measured serum OD_450nmValue)/negative serum OD_450nmValue of]×100％。

1.5 selection of optimal reaction conditions for blocking ELISA

1.5.1 selection of optimal coating concentration for antigen and optimal dilution of serum

The method is carried out according to a matrix titration method, antigen proteins are respectively diluted by carbonate buffer solution with pH 9.6 to the final concentration of 2.0, 1.0, 0.5, 0.25 and 0.10 mu g/mL to coat an ELISA plate, and the plate is acted for 2 hours at 37 ℃. After washing, adding ASFV positive serum and negative serum diluted by PBST at 1:1, 1:4, 1:8 and 1:16, carrying out blocking ELISA detection according to 1.4 basic steps, repeating each dilution 3 times, taking the average value, calculating the blocking rate of each group of positive serum, and selecting the reaction condition with the highest blocking rate as the optimal blocking ELISA reaction condition.

1.5.2 selection of antigen coating conditions

Coating with the above determined optimal antigen coating concentration using the following conditions, respectively: (1) acting at 37 ℃ for 2 h; (2) acting for 12 hours at 4 ℃; (3) after the reaction is carried out for 2 hours at 37 ℃, the reaction is carried out for 12 hours at 4 ℃; after the serum is diluted according to the optimal proportion, blocking ELISA is carried out according to 1.4 basic steps, the blocking rate of each group is calculated, and the optimal antigen coating condition is selected according to the blocking effect.

1.5.3 selection of optimal blocking solution and blocking time

The ELISA plate was coated with optimal antigen coating conditions, after washing, blocking ELISA assays were performed with 5% skim milk, 1% BSA, 0.1% BSA, and 2% gelatin solutions as blocking solutions, respectively, and the blocking rate of positive sera was calculated and the optimal blocking solution was selected. After the blocking solution is selected, blocking is carried out for 1h, 2h and 3h at 37 ℃ respectively, and the optimal blocking time is selected.

1.5.4 selection of duration of action of serum to be tested

After the ELISA plate is coated and sealed by using the optimal conditions, the serum to be detected with the optimal dilution is added, the ELISA plate is acted for 0.5h, 1.0h, 1.5h, 2.0h and 2.5h at 37 ℃, the blocking ELISA assay is carried out by using the optimal conditions, and the blocking rates of the positive sera of all groups are compared to select the proper serum acting time.

1.5.5 selection of working concentration of enzyme-labeled monoclonal antibody

After the serum to be detected acts according to the optimal conditions, washing an ELISA plate, diluting the enzyme-labeled monoclonal antibody by PBST according to the ratio of 1:2000, 1:2500, 1:3000, 1:3500, 1:4000, 1:4500 and 1:5000 respectively, carrying out blocking ELISA determination on standard negative and positive serum by 100 mu L/hole, comparing the blocking rate of each group of positive serum, and selecting the proper working concentration of the enzyme-labeled monoclonal antibody.

1.5.6 selection of action time of enzyme labeled monoclonal antibody

Adding the enzyme-labeled monoclonal antibody into an ELISA plate according to the optimal dilution times, respectively acting for 0.5h, 1h and 1.5h at 37 ℃, performing blocking ELISA determination on the positive serum and the negative serum, and comparing the blocking rates of the positive sera in each group to select the proper action time of the enzyme-labeled monoclonal antibody.

1.5.7 selection of optimal color development time of substrate

After the enzyme-labeled antibody acts according to the optimal condition, washing an ELISA plate, adding an enzyme action substrate, acting for 5min, 10min, 15min and 20min at 37 ℃, respectively, and using 2mol/L H₂SO₄The 50. mu.L/well reading after termination, positive serum blocking rates were calculated for each group to determine the optimal substrate action time.

1.6 determination of blocking ELISA cut-off values

ASFV negative pig blood samples for this study were obtained from IDvet119 pig serum samples which are negative to the detection kit of the African swine fever virus p30 antibody are detected, the cut-off value is detected by the blocking ELISA established in the method, and the average blocking rate is calculated

And Standard Deviation (SD) to determine the cut-off value for the determination of blocking ELISA results.

1.7 repeatability test

3 batches of p72 protein coated blocking ELISA plates expressed and purified at different times are used, 3 ASFV positive serums and 2 healthy pig serums are selected, 3 ELISA plates in the same batch and different batches are used for carrying out batch-to-batch repeatability tests, and the coefficient of variation is calculated to verify the repeatability of the method.

1.8 Cross-reactivity test

Porcine PRV, PRRSV, CSFV, PCV2, SVA and FMDV reference positive sera were detected by the blocking ELISA established herein, and ASFV standard negative and positive controls were established. And analyzing whether the method has cross reactivity with other common swine disease antibodies.

1.9 sensitivity, specificity and coincidence analysis

138 known ASFV positive sera with different antibody levels (IDvet African swine fever virus p30 antibody blocking ELISA kit detection) were selected, and blocking ELISA determination was performed under the optimal condition, and a negative-positive control was set. And judging the sensitivity of the method according to the detection result. In addition, 217 swine serum samples identified as negative by the IDvet African swine fever virus p30 antibody blocking ELISA kit are detected by a blocking ELISA method to judge the specificity of the method. Calculated according to the following formula: relative sensitivity (%) × 100% for positive number/(positive number + false negative number) ]; relative specificity (%) × 100% for negative number/(negative number + false positive number); the total coincidence rate (%) (number of positives + number of negatives)/total number of detections) x 100%.

2 results

2.1 purification of monoclonal antibodies and HRP labeling

The results of SDS-PAGE of 6E5 mouse ascites mab purification (see FIG. 10) were clearly visible for the antibody light and heavy chains. The mass concentration of the protein is 3.125 mg/mL. And (3) carrying out HRP (horse radish peroxidase) labeling on the purified monoclonal antibody, and diluting the labeled antibody by 1:4000 times.

2.2 determination of optimal reaction conditions for blocking ELISA

The final determination was made by screening the concentrations of the various reagents used and optimization of the reaction conditions: the optimal antigen coating concentration is 0.5 mug/mL; the best blocking agent is 1% BSA, 200 μ L of the blocking agent is used in each hole, and the blocking is carried out for 2h at 37 ℃; the optimal dilution of the serum to be detected is 1:1, and the action time is 1h at 37 ℃; the optimal dilution of the enzyme-labeled monoclonal antibody is 1:4000, and the optimal reaction condition is 1h at 37 ℃; the optimal reaction time of the substrate is 10min at 37 ℃.

2.3 determination of the cut-off value

119 known negative serum samples are detected by using the blocking ELISA method established in the research, and the average blocking rate of the negative serum samples is calculated through statistical analysis of results

18.78%, standard deviation 10.50%,

judging the PI to be positive when the PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious. The test was repeated 1 time, and if the concentration of the antibody was still less than 40%, the antibody was judged to be negative.

2.4 repeatability test

The result of the repeatability test shows that the coefficient of variation of 5 parts of serum in the batch and batch-to-batch (see table 6) tests is less than 10%, and the blocking ELISA detection method is proved to have good repeatability.

TABLE 6 blocking ELISA reproducibility test

2.5 Cross-reactivity test

The blocking ELISA method established by the research is utilized to simultaneously detect ASFV, PRV, PRRSV, CSFV, PCV2, SVA and FMDV positive serum. The detection result shows that the reference positive serum of other porcine viruses is negative except the ASFV, which proves that the blocking ELISA method can specifically detect the ASFV antibody and has no cross reaction with other porcine pathogen positive serum (see Table 7).

TABLE 7 specificity test for blocking ELISA

2.6 compliance test

355 pig sera were tested with the IDvet ASFV p30 antibody blocking ELISA test kit and the p72 antibody blocking ELISA method established in this study. The detection result of the kit is 138 positive parts and 217 negative parts. The detection result of the blocking ELISA method established in the research is 142 positive parts and 213 negative parts. It can be seen that the relative sensitivity, relative specificity and total compliance of the blocking ELISA established in this study were 93.5%, 94.0% and 93.8%, respectively (see table 8).

TABLE 8 compliance test for blocking ELISA

Reference to the literature

[1]Wensvoort G,Terpstra C,Pol J M A,Ter Laak E A,Bloemraad M,De Kluyver E P,Kragten C,Van Buiten L,Den Besten A,Wagenaar F J V Q.Mystery swine disease in The Netherlands:the isolation of Lelystad virus[J].1991,13(3): 121-130.

[2]Arun,K.,Upadhyay,Anupam,Singh,K.,J.,Mukherjee,Amulya,Microbiology K J F I.Refolding and purification of recombinant L-asparaginase from inclusion bodies of E.coli into active tetrameric protein[J].2014.

[3]Eggenreich B,Willim M,Wurm D J,Herwig C,Spadiut O J B R.Production strategies for active heme-containing peroxidases from E.coli inclusion bodies–a review[J].2016,10(C).

[4]Heimerman M E,Murgia M V,Wu P,Lowe A D,Rowland R R J J O V D I O P O T a a O V L D,Inc.Linear epitopes in African swine fever virus p72 recognized by monoclonal antibodies prepared against baculovirus-expressed antigen[J].2018,30(3):104063871775396.

[5]Juan,Bai,Xinhui,Chen,Kangfu,Jiang,Basit,Zeshan,Ping,Journal J J V.Identification of VP1 peptides diagnostic of encephalomyocarditis virus from swine[J].2014.

[6]Zhang P,Lv L,Sun H,Li S,Fan H,Wang X,Bai J,Jiang P J V M.Identification of linear B cell epitope on gB,gC, and gE proteins of porcine pseudorabies virus using monoclonal antibodies[J].2019,234:83.

[7]Murgia M V,Mogler M,Certoma A,Green D,Monaghan P,Williams D T,Rowland R R R,Gaudreault N N. Evaluation of an African swine fever(ASF)vaccine strategy incorporating priming with an alphavirus-expressed antigen followed by boosting with attenuated ASF virus[J].Arch Virol,2019,164(2):359-370。

Claims (9)

1. A hybridoma cell strain for secreting monoclonal antibodies of African swine fever viruses is named as mouse SP2/0 hybridoma cell, and is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms with the preservation addresses as follows: xilu No. 1 Hospital No. 3, Beijing, Chaoyang, on the day of deposit: 2021, 1, 8 days, with the deposition number: CGMCC NO: 21489.

2. an African swine fever virus monoclonal antibody secreted by the hybridoma cell line of claim 1.

3. The use of the African swine fever virus monoclonal antibody of claim 2 in the preparation of an African swine fever virus blocking ELISA antibody detection kit.

4. The African swine fever virus monoclonal antibody of claim 2, wherein the African swine fever virus monoclonal antibody is used for detecting African swine fever virus by using a non-diagnosis and treatment blocking ELISA antibody.

5. An African swine fever virus blocking ELISA antibody detection kit is characterized by comprising an ELISA plate coated by recombinant ASFV p72 protein serving as an antigen, ELISA standard positive serum, ELISA negative serum, a monoclonal antibody labeled by horseradish peroxidase and a TMB substrate solution, wherein the monoclonal antibody is the monoclonal antibody secreted by the hybridoma cell strain of claim 1.

6. The African swine fever virus blocking ELISA antibody detection kit of claim 5, wherein the kit further comprises an antigen diluent, a blocking solution, a sample diluent and a stop solution; as a preferred technical scheme, the antigen diluent is a carbonate buffer solution with pH 9.6, the blocking solution is 1% BSA, the sample diluent is PBST, and the stop solution is 2mol/L sulfuric acid.

7. The African swine fever virus blocking ELISA antibody detection kit of claim 5, wherein the recombinant ASFV p72 protein is prepared by the method comprising: specific primers were designed by referring to the B646L (p72) gene sequence of the ASFV Pig/HLJ/2018(GenBank MK333180) strain in GenBank database:

P72-EcoR I-F：CCGGAATTCATGGCATCAGGAGGAG

P72-Xho I-R：CGCCTCGAGGAGCGCAAGAGGGGGC

amplifying a 1-329aa region of a B646L gene, cloning the amplified gene fragment to a pET-28a (+) expression vector to obtain a recombinant plasmid pET-28a-His-p72t, transforming the recombinant plasmid into BL21(DE3) for induced expression, collecting precipitates, and purifying to obtain the purified recombinant protein.

8. Use of the blocking ELISA antibody detection kit of any one of claims 5-7 for African swine fever virus antibody detection not for the purpose of disease diagnosis and treatment.

9. A non-diagnosis and treatment purpose African swine fever virus blocking ELISA antibody detection method is characterized in that: the method comprises the following steps:

(1) coating an ELISA plate; the recombinant ASFV p72 protein is used as an antigen, and the antigen diluent is used for diluting the purified recombinant ASFV p72 protein to coat an ELISA plate;

(2) blocking the ELISA plate with blocking solution;

(3) adding diluted serum to be detected for incubation;

(4) adding diluted enzyme-labeled monoclonal antibody, wherein the monoclonal antibody is the monoclonal antibody of claim 2;

(5) color development, termination, and OD reading on microplate reader_450nmA value;

(6) the blocking rate (percent inhibition/PI) was calculated according to the following formula, and the blocking rate was [ ("negative serum OD)_450nmvalue-Positive serum OD_450nmValue)/negative serum OD_450nmValue of]X is 100%; judging the PI to be positive when the PI is more than or equal to 50 percent; when the PI is less than or equal to 40 percent, the result is judged to be negative; and when the PI is less than 40% < PI < 50%, the judgment is suspicious.

Images