CN114958938B

CN114958938B - Preparation method of fused bicyclic proline methyl ester hydrochloride

Info

Publication number: CN114958938B
Application number: CN202210523681.4A
Authority: CN
Inventors: 祝俊; 李二军; 李丹; 李斌; 陈剑; 余长泉
Original assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Nanjing Huaguan Biotechnology Co ltd; Jindawei Biotechnology Jiangsu Co ltd
Current assignee: INNER MONGOLIA KINGDOMWAY PHARMACEUTICAL CO Ltd; Nanjing Huaguan Biotechnology Co ltd; Jindawei Biotechnology Jiangsu Co ltd
Priority date: 2022-05-13
Filing date: 2022-05-13
Publication date: 2023-12-08
Anticipated expiration: 2042-05-13
Also published as: CN114958938A

Abstract

The invention provides a preparation method of fused bicyclic proline methyl ester hydrochloride, which comprises the following steps: (1) Taking a compound SM as a raw material, reacting in the presence of catalase and monoamine oxidase, and introducing gas generated by the reaction into methyl tertiary butyl ether to obtain an intermediate compound 1; (2) Reacting the compound 1 with NaCN in the presence of concentrated hydrochloric acid to obtain a compound 2; (3) Compound 2 was reacted in methanol hydrochloride solution to give methyl (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylate, followed by extraction with MTBE, and the resulting MTBE solution was added to isopropanol hydrochloride solution to give the product. The preparation method disclosed by the invention has the advantages of lower production cost, high product yield, simple post-treatment and environmental friendliness.

Description

Preparation method of fused bicyclic proline methyl ester hydrochloride

Technical Field

The invention belongs to the technical field of medicine preparation, relates to a preparation method of fused bicyclic proline methyl ester hydrochloride, and particularly relates to a preparation method of (1R, 2S, 5S) -6, 6-dimethyl-3-aza-bicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride.

Background

The best (Pfizer) published mid-term clinical data for phase 2/3 clinical studies of the new coronal oral drug Paxlovid (PF-07321332 + ritonavir) in EPIC-HR, which showed a 89% reduction in risk of new coronal pneumonia-related hospitalization or death in patients receiving Paxlovid treatment three days after symptoms compared to placebo, whereas the key intermediate needed to treat the PF-07321332 component of the new coronal drug Paxlovid was (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylate hydrochloride, which is of significant medical value.

(1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride

At present, the preparation of (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride mainly comprises the following process routes:

WO2007075790 discloses a process route as described above, in which SM is used as a starting material, oxidation is carried out with an oxidizing agent, CN is added, the racemic compound 3 is obtained after esterification, then the compound is resolved by salt formation with D-DTTA, and the target compound is obtained by salt formation purification in HCl/IPA/MTBE, which employs a large number of chemical reagents (K ₂ SO ₈ ，AgNO ₃ D-DTTA), the cost is high, the total yield is only about 23%, and heavy metal silver ions are easy to remain in the product.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a preparation method of fused bicyclic proline methyl ester hydrochloride, in particular to a preparation method of (1R, 2S, 5S) -6, 6-dimethyl-3-aza-bicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride.

To achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the present invention provides a method for preparing (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride, the method comprising the steps of:

(1) Taking a compound SM as a raw material, reacting in the presence of catalase and monoamine oxidase, and introducing gas generated by the reaction into methyl tertiary butyl ether to obtain an intermediate compound 1, wherein the reaction formula is as follows:

(2) Reacting compound 1 with NaCN in the presence of concentrated hydrochloric acid to obtain compound 2, wherein the reaction formula is as follows:

(3) Compound 2 was reacted in methanol hydrochloride to give methyl (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylate, which was then extracted with MTBE, and the resulting MTBE solution was added to isopropanol hydrochloride to give methyl (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylate hydrochloride of the following formula:

In the invention, the specific monoamine oxidase is utilized, so that the enzyme activity of the monoamine oxidase mutant is obviously improved, and the reaction yield is high. In the invention, the high volatility of the imine product is utilized to achieve the aim of separation and purification, the separation and purification can be completed after the reaction is completed, the enzyme removal process is not needed, the process is simple, the operation is easy, and the cost is lower.

The fused bicyclic proline methyl ester hydrochloride refers to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride.

In the present invention, the monoamine oxidase of step (1) is a monoamine oxidase having an amino acid mutation;

the monoamine oxidase comprises an amino acid sequence shown in SEQ ID No. 1;

the types of amino acid mutations include any one or a combination of at least two of V239I, N240D, H241C, V243M, N S, D344S, R345P, H394A, I396K, A397M or Q400E.

SEQ ID No.1：

MASKDGFSWTKAHGLKTGVPCIGAIEPPSNLKGTDSRFDVIVVGAGYCGLTAARDASLSGLKVLLLEARDRIGGRSWSSNIDGYPYEMGGTWVYWGQANVWREIARYGMQDELEISYDFSRGINQYLLANAQGTQHFSHDEEDDMMESSLSKLVNVDESFGRKVVPFPHSGVLSPEARRYDHMSIADRLAEIKNDLTLNERLCVEAFVLLCSGGTLETTSFYEFLHWWALSGYSYEGCVNHLVKYKFRGGQSSFAIRFFQEALATGNFTYAFSRPVASIKDRGGTVQVTTRDGQTFEAAKMISAIPLNVLSDVTFDPPFTAGRRTAASIGHVNQTVKVHAEISDRDLRSFTGISYPHNGLIYGFGDGETPVGNTHVVAFGGQHNHFHPEDNIDHTIAAFQGFTPMNVERLVFHNWSRDEFAKGAWFFPAPGLLSTYLKDMRARQGNIIFACSDWALGWRSFIDGAIEEGARAAAAVQADLTGRAKL。

In the invention, by introducing the mutation into monoamine oxidase (MAON), the activity of the enzyme is obviously improved, and compared with the original monoamine oxidase, the relative enzyme activity of the monoamine oxidase mutant can reach more than 125 percent and even up to 850 percent, so that the reaction yield of the (1R, 2S, 5S) -6, 6-dimethyl-3-aza-bicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride preparation is higher.

Preferably, the coding sequence of the monoamine oxidase comprises the nucleotide sequence shown in SEQ ID No. 2.

SEQ ID No.2：

ATGGCCAGTAAAGATGGCTTTAGCTGGACCAAAGCCCATGGCCTGAAAACCGGCGTTCCGTGCATTGGTGCAATTGAACCGCCGAGCAATCTGAAAGGTACCGATAGCCGCTTTGATGTGATTGTTGTGGGCGCCGGCTATTGCGGTCTGACCGCAGCCCGCGATGCCAGTCTGAGTGGTCTGAAAGTGCTGCTGCTGGAAGCACGTGATCGCATTGGTGGTCGCAGTTGGAGTAGCAATATTGATGGCTATCCGTATGAAATGGGCGGCACCTGGGTTTATTGGGGTCAGGCCAATGTTTGGCGCGAAATTGCCCGTTATGGTATGCAGGATGAACTGGAAATTAGTTATGATTTTAGCCGTGGTATTAACCAGTATCTGCTGGCAAATGCCCAGGGCACCCAGCATTTTAGTCATGATGAAGAAGATGATATGATGGAAAGCAGTCTGAGTAAACTGGTGAATGTGGATGAAAGTTTTGGTCGTAAAGTGGTGCCGTTTCCGCATAGCGGTGTTCTGAGTCCGGAAGCCCGTCGCTATGATCACATGAGCATTGCAGATCGCCTGGCCGAAATTAAAAATGATCTGACCCTGAATGAACGCCTGTGTGTTGAAGCCTTTGTGCTGCTGTGTAGCGGTGGTACCCTGGAAACCACCAGCTTTTATGAATTTCTGCATTGGTGGGCACTGAGCGGTTATAGCTATGAAGGCTGCGTGAATCATCTGGTTAAATATAAATTCCGTGGTGGTCAGAGTAGCTTTGCAATTCGTTTTTTTCAGGAAGCCCTGGCAACCGGTAATTTTACCTATGCCTTTAGTCGCCCGGTGGCAAGCATTAAAGATCGTGGCGGTACCGTTCAGGTTACCACCCGCGATGGCCAGACCTTTGAAGCCGCAAAAATGATTAGTGCCATTCCGCTGAATGTTCTGAGTGATGTGACCTTTGATCCGCCGTTTACCGCCGGCCGTCGTACCGCTGCCAGCATTGGTCATGTTAATCAGACCGTTAAAGTTCATGCAGAAATTAGCGATCGTGATCTGCGCAGTTTTACCGGTATTAGCTATCCGCATAATGGCCTGATTTATGGCTTTGGTGATGGTGAAACCCCGGTTGGTAATACCCATGTGGTTGCCTTTGGTGGTCAGCATAATCATTTTCATCCGGAAGATAATATCGATCATACCATTGCCGCCTTTCAGGGTTTTACCCCGATGAATGTTGAACGTCTGGTTTTTCATAATTGGAGTCGTGATGAATTTGCCAAAGGTGCCTGGTTTTTTCCGGCCCCGGGTCTGCTGAGTACCTATCTGAAAGATATGCGTGCACGTCAGGGCAATATTATTTTTGCATGTAGTGATTGGGCACTGGGTTGGCGCAGTTTTATTGATGGTGCAATTGAGGAAGGCGCACGTGCAGCCGCCGCCGTTCAGGCAGATCTGACCGGTCGTGCAAAACTGTAA。

Preferably, the homology between the monoamine oxidase mutant and the monoamine oxidase is more than 80%, for example, 80%, 85%, 90% or 95%, etc., and other specific values within the numerical range can be selected, which will not be described in detail herein.

Preferably, the monoamine oxidase is derived from pseudonymnascus.

In the invention, the preparation method of the monoamine oxidase mutant comprises the following steps:

constructing an expression vector, transforming the expression vector into a receptor cell, and constructing a monoamine oxidase mutant transformant;

culturing the monoamine oxidase mutant transformant, and collecting a culture to obtain the monoamine oxidase mutant.

As a preferred technical scheme, the preparation method of the monoamine oxidase mutant comprises the following steps:

the nucleic acid molecule of the coded monoamine oxidase mutant is recombined into an expression vector pET28a (+) through enzyme digestion connection, and then transferred into a receptor cell BL21 (DE 3), positive clones are screened, and a monoamine oxidase mutant transformant is obtained;

and (3) placing the monoamine oxidase mutant transformant in an LB liquid culture medium for activation, then carrying out fermentation culture, collecting cells, crushing and centrifuging to obtain a digestion solution containing the monoamine oxidase mutant.

Preferably, the solvent of the reaction of step (1) is water, which is used in an amount of 3-8 times, for example 3-4-5-6-7-or 8-times the mass of compound SM.

Preferably, compound SM is dissolved in water before the reaction of step (1), and the pH is adjusted with an acid to obtain an aqueous solution of SM; preferably, the acid is concentrated hydrochloric acid, concentrated sulfuric acid or concentrated phosphoric acid. Concentrated hydrochloric acid or concentrated phosphoric acid is preferable, and concentrated hydrochloric acid is further preferable from the viewpoint of environmental protection.

Preferably, the pH is 6.0-8.0, e.g. 6.0, 6.2, 6.4, 6.8, 7.0, 7.4, 7.8 or 8.0, preferably 7.0-7.5.

Preferably, the catalase of step (1) is used in an amount of 0.1-0.5 times, e.g. 0.1-fold, 0.2-fold, 0.3-fold, 0.4-fold, 0.5-fold, preferably 0.2-0.3-fold, the mass of compound SM;

preferably, the monoamine oxidase is used in an amount of 0.1 to 0.5 times, e.g. 0.1 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, preferably 0.2 to 0.3 times the mass of compound SM.

Preferably, air is introduced during the reaction in step (1), and the flow rate of the air introduced is 10-100mL/min, for example, 10mL/min, 30mL/min, 50mL/min, 70mL/min, 80mL/min, 90mL/min or 100mL/min, preferably 30-40mL/min, so that the reaction is slow, and the flow speed is fast, and unreacted raw material SM is entrained to a product receiving device, thereby causing the product to be impure.

Preferably, the pH of the reaction solution of the reaction of step (1) is in the range of 6.0 to 8.0, for example 6.0, 6.2, 6.4, 6.8, 7.0, 7.4, 7.8 or 8.0, preferably 7.0 to 7.5. Too high and too low a pH will result in a slow reaction.

In the invention, the pH value of the reaction liquid of the reaction in the step (1) is controlled by using an alkaline solution, wherein the alkaline solution is an organic base or an inorganic base, the organic base comprises any one or a combination of at least two of triethylamine, diisopropylethylamine, diethylamine and DBU, and the inorganic base comprises any one or a combination of at least two of potassium hydroxide, sodium hydroxide, lithium hydroxide, potassium carbonate, sodium carbonate, cesium carbonate and ammonia water. Preferably an aqueous sodium hydroxide solution.

Preferably, the temperature of the reaction in step (1) is 5-35 ℃ (e.g. 5 ℃, 10 ℃, 15 ℃, 18 ℃, 20 ℃, 25 ℃, 30 ℃ or 35 ℃), and the time of the reaction is 5-48 hours (e.g. 5 hours, 10 hours, 15 hours, 20 hours, 25 hours, 28 hours, 30 hours, 35 hours, 38 hours, 40 hours or 48 hours).

Preferably, the temperature is controlled in step (1) at-5 to 5 ℃, for example-5 ℃, -4 ℃, -3 ℃, -2 ℃, 0 ℃, 1 ℃, 2 ℃, 3 ℃, 4 ℃ or 5 ℃ when introducing the gas produced by the reaction into methyl tert-butyl ether.

Preferably, the methyl tert-butyl ether of step (1) is used in an amount of 3 to 10 times, for example 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times or 10 times, preferably 5 to 8 times, the mass of compound SM.

Preferably, in the step (1), the gas generated by the reaction is introduced into methyl tertiary butyl ether, and tail gas generated after absorption is introduced into dilute acid for absorption, wherein the dilute acid is inorganic acid or organic acid;

preferably, the inorganic acid is dilute hydrochloric acid or dilute sulfuric acid;

preferably, the organic acid is benzenesulfonic acid, methanesulfonic acid, or tartaric acid.

Preferably, the molar ratio of NaCN in step (2) to compound SM in step (1) is between 1.0 and 1.5:1, for example 1:1,1.1:1, 1.2:1, 1.3:1, 1.4:1 or 1.5:1, preferably 1.0-1.2:1.

preferably, the molar ratio of the concentrated hydrochloric acid of step (2) to the compound SM of step (1) is between 1.0 and 1.5:1, for example 1:1,1.1:1, 1.2:1, 1.3:1, 1.4:1 or 1.5:1, preferably 1.0-1.2:1.

Preferably, the temperature of the reaction of step (2) is from 0 to 10 ℃, for example 0 ℃, 2 ℃, 4 ℃, 5 ℃, 7 ℃, 9 ℃ or 10 ℃.

Preferably, the time of the reaction of step (2) is 1-10 hours, for example 1 hour, 2 hours, 3 hours, 5 hours, 7 hours, 9 hours or 10 hours.

Preferably, the concentration of HCl in the methanolic hydrochloric acid solution of step (3) is 1N-5N, such as 1N, 2N, 3N, 4N or 5N, preferably 4N.

Preferably, the amount of the methanolic hydrochloride solution of step (3) is 3-8 times, e.g. 3-4-5-6-7-8-fold, preferably 5-6-fold, the mass of compound 2.

Preferably, the compound 2 of step (3) is reacted in methanol hydrochloride at a temperature of from 5 to 10 ℃ (e.g. 5 ℃, 6 ℃, 7 ℃, 8 ℃, 9 ℃ or 10 ℃) for 1 to 3 hours (e.g. 1 hour, 2 hours or 3 hours) followed by a temperature increase to 20 to 25 ℃ (e.g. 20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃ or 25 ℃) for 5 to 12 hours (e.g. 5 hours, 7 hours, 9 hours, 10 hours or 12 hours).

Preferably, the compound 2 in the step (3) is reacted in a methanol solution of hydrochloric acid, after the reaction is finished, the solution is concentrated under reduced pressure until no drop is generated, a proper amount of water is added, the pH is adjusted to be alkaline by alkali, liquid separation is carried out, and the aqueous phase is extracted by MTBE.

Preferably, the reduced pressure concentration is at a temperature of 20-60 ℃, e.g., 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, or 60 ℃, preferably 30-40 ℃.

In the present invention, the base used when the pH is adjusted to be alkaline with a base as described above is an organic base or an inorganic base, and the organic base includes any one or a combination of at least two of triethylamine, diisopropylethylamine, diethylamine, DBU; the inorganic base comprises any one or a combination of at least two of potassium hydroxide, sodium hydroxide, lithium hydroxide, potassium carbonate, sodium carbonate, cesium carbonate or ammonia water. Preferably an aqueous sodium hydroxide solution, more preferably an aqueous sodium hydroxide solution having a concentration of 1N to 4N.

Preferably, the pH adjustment with a base to alkaline means that the pH is adjusted to 9.0-11.0, e.g. 9.0, 9.3, 9.5, 9.8, 10, 10.5, 11, preferably 9.0-9.5.

Preferably, the HCl concentration in the isopropanol hydrochloric acid solution of step (3) is 1N-5N, for example 1N, 2N, 3N, 4N or 5N, preferably 1N.

Preferably, the MTBE solution of step (3) is used in an amount of 4 to 8 times, for example 4 times, 5 times, 6 times, 7 times or 8 times, preferably 5 to 6 times the mass of compound 2.

Preferably, the resulting MTBE solution is added to the isopropanol hydrochloride solution in step (3) and stirred at-10 to 0 ℃ (e.g., -10 ℃, -8 ℃, -5 ℃, -3 ℃, -2 ℃, -1 ℃ or 0 ℃) for 1-8 hours (e.g., 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours or 8 hours).

Preferably, the MTBE solution obtained in the step (3) is added into isopropanol hydrochloride solution, after the reaction is finished, the solution is filtered, and the filter cake is rinsed by MTBE to obtain a wet product, and then the wet product is dried in vacuum for 8-24 hours to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride.

Preferably, the vacuum drying temperature is 20-60 ℃, e.g. 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃ or 60 ℃, preferably 35-45 ℃.

Compared with the prior art, the invention has the following beneficial effects:

in the invention, the specific monoamine oxidase is utilized, so that the enzyme activity of the monoamine oxidase mutant is obviously improved, and the reaction yield is high. The preparation method disclosed by the invention is environment-friendly in reaction process, and less in inorganic salt in wastewater during post-treatment. The high volatility of the generated imine product is fully utilized in the reaction process, the purpose of separation and purification is achieved, the separation and purification can be completed after the reaction is completed, the enzyme removal process is not needed, the process is simple, the operation is easy, and the cost is lower. The synthesis process has high yield, total yield not lower than 11.9%, total yield not lower than 75% and production cost far lower than that of available technological process.

Detailed Description

The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Preparation example 1 preparation of monoamine oxidase and Activity measurement

(1) Construction of wild monoamine oxidase expression Strain

The nucleotide sequence of the whole gene synthesis coding monoamine oxidase (the sequence is shown as SEQ ID No.2 and is synthesized by Changzhou-based biotechnology Co., ltd.) is recombined into a vector pET28a (+) after being subjected to enzyme digestion by restriction enzymes NdeI and XhoI (purchased from New England Biolabs company and operated according to the specification), and then transformed into Tran5 alpha competence (purchased from full gold company).

E.coli tran5α was placed in LB liquid medium and cultured overnight at 37℃with shaking at 160 rpm. The recombinant plasmid MAON-pET28a (+) is extracted and transformed into a chemically competent cell (full-formula gold company) of an expression host escherichia coli BL21 (DE 3) to obtain the recombinant escherichia coli for expressing the wild monoamine oxidase.

SEQ ID No.2：

(2) Construction of MAON random mutant library by random mutant PCR

A random mutation library is constructed by using the sequence SEQ ID No.2 as a template and Agilent GeneMorph II Random Mutagenesis Kit, the sequence of a forward primer MAON-NdeI-F is shown as SEQ ID No.3, and the sequence of a reverse primer MAON-XhoI-R is shown as SEQ ID No. 4.

SEQ ID No.3：5’-GAATTCCATATGGCCAGTAAAGATGGCTTT-3’；

SEQ ID No.4：5’-CCGCTCGAGTTACAGTTTTGCACGACCGGTCAG-3’。

The PCR reaction system is as follows:

the PCR procedure was as follows:

95℃2min；

95 ℃ for 30s,55 ℃ for 30s,72 ℃ for 90s,30 cycles;

72℃10min。

After amplification, gel electrophoresis detection is carried out, random mutation fragments at 1.5kb are recovered, restriction enzymes NdeI and XhoI (purchased from New England Biolabs company and operated according to the specification) are subjected to enzyme digestion and recombined into a vector pET 28a (+) and then transformed into chemically competent cells (full gold company) of escherichia coli BL21 (DE 3) to obtain a random mutation library.

(3) High throughput screening of mutant libraries and enzyme activity assays

Selecting transformants in a mutation library, inoculating the transformants into a 96-well deep-hole culture plate containing 700 mu L of self-induction medium, culturing the transformants in the medium containing 50mg/L kanamycin sulfate at 37 ℃ for 6 hours, cooling the transformants to 25 ℃, culturing the transformants overnight, removing the supernatant, and freezing the transformants at-70 ℃ for 1 hour.

After thawing at room temperature, 200. Mu.L of 50mM PBNa buffer (pH 7.5) was added, the cells were resuspended, and the chromogenic solution was added: 100mM phosphate buffer (pH 7.4), 1mM 4-AAP (4-aminoantipyrine), 2.5mM vanillic acid, 4U/mL horseradish peroxidase, and 10mM 6, 6-dimethyl-3-azabicyclo [3.1.0] hexane, sealed, and placed in an incubator at 37℃for 20min. Screening recombinant strains with dark red color in the holes, and sequencing and analyzing nucleotide and amino acid sequences of mutation sites of corresponding plasmids.

In this reaction system, 4-AAP is used as a hydrogen donor, hydrogen peroxide generated during monoamine oxidase reaction is reduced to water molecules under the action of horseradish peroxidase, and 4-APP exists in its oxidized state and forms red substance quinone imine with vanillic acid. And judging the vigor according to the shade of the red. From a random mutant library, about 10 mutant clones with higher reactive enzyme activities were sequenced, and it was found that the mutation sites included V239I, N240D, H241C, V243M, N333S, D344S, R345P, H394A, I396K, A397M and Q400E, and amino acid substitutions at these sites resulted in significant changes in the enzyme activity of the mutants. By mutating the amino acid positions, mutant strains as shown in Table 1 were obtained.

TABLE 1

(4) Enzyme activity determination of recombinant MAON and mutant thereof

E.coli BL21 (DE 3) containing MAON-pET28a and its mutant recombinant plasmid was inoculated into LB medium containing 50mg/L kanamycin sulfate and cultured overnight in a constant temperature shaker at 37℃and 200 rpm. Inoculating 1% of the culture solution into fresh LB medium containing 50mg/L kanamycin sulfate, and culturing at 37deg.C in a constant temperature shaker at 200rpm until OD ₆₀₀ The value is 0.6-0.8, IPTG with the final concentration of 0.1mmol is added, and the culture is continued for 16h at 25 ℃ to induce MAON and mutant expression thereof.

Bacterial sludge was collected by centrifugation at 10000rpm for 10min at 4℃and resuspended in sodium phosphate buffer (50 mM, pH 7.5), cells were sonicated in ice bath (working 4s, intermittent 4s, sonication 10 min), supernatant enzyme solution was collected by centrifugation at 10000rpm for 10min at 4℃and MAON and its mutants were purified by Ni-NTA affinity chromatography (Shanghai Ing) to obtain pure enzyme solution.

Enzyme activity determination: to a 50mL reaction system, 5mL of phosphate buffer (1M, pH 7.5), 500. Mu.L of TBHBA (2, 4, 6-Tribromoo-3-hydroxybenzoic acid) (2% dissolved in DMSO), 37.5. Mu.L of 4-AAP (1.5M), 50. Mu.L of horseradish peroxidase (final concentration 4U/mL) and 20. Mu.L of 6, 6-dimethyl-3-azabicyclo [3.1.0] hexane (final concentration 10 mM) were added, 1mL of an enzyme solution was added to the 3mL reaction solution, and the mixture was mixed and placed in a spectrophotometer to measure the difference in absorbance at 37℃and 510nm for 5 minutes.

The enzyme activity unit is defined as: the amount of enzyme required to catalyze the production of 1. Mu. Mol of hydrogen peroxide per minute at 37℃is one enzyme activity unit.

The measurement results are shown in Table 2. As can be seen from Table 2, compared with the original monoamine oxidase, the mutant has significantly improved enzyme activity, and the relative enzyme activity is more than 125%, even as high as 850%. The results show that the mutation is introduced into monoamine oxidase to successfully improve the reaction activity of the enzyme, and the method has important practical application value.

TABLE 2

(5) Fermentation of monoamine oxidase

1. Shake flask culture

The shake flask seed culture medium comprises the following components: yeast extract 5g/L, peptone 10g/L, naCl g/L and kanamycin (Canada for short) 50. Mu.g/mL.

The preparation method of the shake flask seed culture medium comprises the following steps: 5g of yeast powder extract, 10g of peptone and 10g of NaCl are taken and dissolved in 800mL of distilled water, the pH is adjusted to 7, the distilled water is used for fixing the volume to 1000mL, the temperature of 121 ℃ is kept for 15min, the solution is cooled to below 60 ℃, and kanamycin is added to a final concentration of 50 mug/mL.

The culturing steps are as follows:

the stock strain is streaked on an LB plate and cultured upside down at 37 ℃ overnight. On the plate, single clone was picked up and inoculated in 3mL seed culture medium (using 10mL test tube), and shake-cultured at 37℃and 200rpm for 16-20 h to OD ₆₀₀ The numerical value is between 1 and 2. Inoculating into 300mL seed culture medium (1L triangular flask) with 1% inoculum size, shake culturing at 37deg.C and 200rpm for 4-8 hr to OD ₆₀₀ The numerical value is between 1 and 2.

2. Fermentation culture

The culture medium is divided into a fermentation culture medium and a fed-batch culture medium.

The fermentation medium is an M9 medium, and comprises the following components: na (Na) ₂ HPO ₄ 6g/L、KH ₂ PO ₄ 3g/L、MgSO ₄ ·7H ₂ O 0.246g/L、(NH ₄ ) ₂ SO ₄ 2.24g/L, naCl g/L and glucose 20g/L.

The preparation method of the fermentation medium comprises the following steps: na is mixed with ₂ HPO ₄ 、KH ₂ PO ₄ 、MgSO ₄ ·7H ₂ O、(NH ₄ ) ₂ SO ₄ Stirring and dissolving NaCl and glucose, maintaining at 121deg.C for 30min, and cooling; kanamycin was sterilized by filtration using a sterile membrane, and the sterilized kanamycin was added to the fermentation medium to a final concentration of 50. Mu.g/mL.

The components of the fed-batch culture medium are as follows: glucose solution at a concentration of 600 g/L.

The preparation method of the fed-batch culture medium comprises the following steps: dissolving glucose in water, maintaining at 115deg.C for 30min, and cooling.

The culturing steps are as follows:

DO is controlled to be more than 20% in the whole process, the ventilation ratio is 1 (1-4) (VVM), the fermentation culture temperature is controlled to be 37 ℃, and the pH is 7.0. Culturing for 8 hr to mutate dissolved oxygen, adding fed-batch culture medium, and OD ₆₀₀ The induction is started with the value of about 30, the final concentration of IPTG is 1mM, the induction temperature is controlled at 25 ℃, and the culture is carried out for 21 hours and the pot is put.

(6) Monoamine oxidase whole cell and enzyme preparation

After fermentation, cells expressing monoamine oxidase were collected by centrifugation at 5000g for 30 min. The fermentation centrifugal thalli are suspended in 50mmol PBNa (pH 7.5) buffer solution with 3 times volume, bacterial cells are lysed by using ultrasonic waves, supernatant fluid is collected by centrifugation, the centrifugation is carried out for 10min at 4 ℃ and 10000g, and the supernatant fluid is collected, namely monoamine oxidase liquid.

Example 1

Step one: preparation of intermediate 1

To the beaker was added raw material SM (50.0 g,0.449 mol), and after dissolving in water (150 mL), the mixture was adjusted to 7.0 with concentrated hydrochloric acid to obtain an aqueous solution of SM.

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration 0.2mg/mL,10.0 g), catalase solution (Norwechat catalase solution, 66555U/g,10.0 g), defoamer (3 drops), air (flow rate controlled at 30-40 mL/min), SM aqueous solution, naOH solution (concentration 2N) were used to control pH of the system at 7.0, reaction was carried out at 20℃for 24h while sealing the reaction system, gas in the reaction system was connected to an MTBE (300 mL) containing receiving device through a pipe, internal temperature was controlled at-5℃to 5℃and after the receiving device was discharged, the gas was introduced into dilute acid to be absorbed, thus obtaining MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing an intermediate 1MTBE solution, an aqueous solution (300 mL) of NaCN (1.1 eq,0.494mol,24.2 g) was added, the reaction solution was cooled to 0℃and dropwise concentrated HCl (concentration: 30%,1.1eq,0.494mol,60.1 g) was added to the reaction flask to react at this temperature for 5 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 more times with MTBE (150 mL), and the combined organic phase was concentrated to be non-dripping at 30℃under reduced pressure to give intermediate 2 (54.5 g), yield: 88.9% (overall yield of starting material SM to intermediate 2).

Step three: preparation of (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride

Intermediate 2 was added to HCl methanol solution (272.5 mL, [ HCl ] =4n) at 5 ℃ for 1 hour. Heating to 20 ℃ and stirring for 10 hours to complete conversion, concentrating under reduced pressure at 30 ℃ without dropping, adding water (272.5 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (109 mL), separating the liquid, extracting the aqueous phase 1 time with MTBE (109 mL), dripping the obtained MTBE solution into an HCl solution (109 mL, [ HCl ] = 1N) of isopropanol at 0 ℃, keeping the temperature at 0 ℃ for stirring for 1 hour after the dripping is completed, dripping MTBE (272.5 mL) again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (54.5 mL), and obtaining a wet product, and vacuum drying at 35 ℃ for 24 hours to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride solid (69.9 g), yield: 84.9% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 75.6%.

Example 2

Step one: preparation of intermediate 1

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration 0.2mg/mL,12.0 g), catalase solution (Norwechat catalase solution, 66555U/g,12.0 g), defoamer (3 drops), air (flow rate controlled at 30-40 mL/min), SM aqueous solution, naOH solution (2N) controlled system pH 7.5, thermal insulation reaction at 25 ℃ for 24h, sealing reaction system, gas in reaction system connected to MTBE (300 mL) containing receiving device through pipeline, controlling internal temperature at-5 ℃ and gas after receiving device is discharged and absorbed in dilute acid to obtain MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing intermediate 1, an aqueous solution (300 mL) of NaCN (1.1 eq,0.494mol,24.2 g) was added, the reaction solution was cooled to 10℃and dropwise concentrated HCl (concentration: 30%,1.1eq,0.494mol,60.1 g) was added to the reaction flask to react at this temperature for 5 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 time with MTBE (150 mL), and the combined organic phases were concentrated to no drop at 40℃under reduced pressure to give intermediate 2 (56.3 g), yield: 91.9% (yield of starting material SM to intermediate 2).

Intermediate 2 was added to HCl methanol solution (281.5 mL, [ HCl ] =4n) at 10 ℃ for 1 hour. Heating to 25 ℃ and stirring for 10 hours to complete conversion, concentrating under reduced pressure at 30-40 ℃ without dropping, adding water (281.5 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (112.6 mL), separating the liquid, extracting the aqueous phase with MTBE (112.6 mL) 1 time, dropping the obtained MTBE solution into an HCl solution of isopropanol (112.6 mL, [ HCl ] = 1N) at-10 ℃ for 1 hour at-10 ℃ after the dropping, adding MTBE (281.5 mL) dropwise again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (56.3 mL) to obtain a wet product, and vacuum drying 24H at 40 ℃ to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride solid (73.9 g), yield: 86.9% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 79.9%.

Example 3

Step one: preparation of intermediate 1

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration: 0.2mg/mL,15.0 g), catalase solution (Norwechat catalase solution, 66555U/g,15.0 g), defoamer (3 drops), air (flow rate: 30-40 mL/min) was introduced, SM aqueous solution was added dropwise to the three-necked flask, at the same time, naOH solution (concentration: 2N) was used to control pH of the system to 7.0-7.5, the reaction was carried out at 20℃for 24 hours while sealing the reaction system, gas in the reaction system was introduced into an MTBE (300 mL) -containing receiving apparatus through a pipe, the internal temperature was controlled to-5℃and after the receiving apparatus was discharged, the gas was introduced into dilute acid for absorption, to obtain MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing intermediate 1, an aqueous solution (300 mL) of NaCN (1.1 eq,0.494mol,24.2 g) was added, the reaction solution was cooled to 5℃and dropwise concentrated HCl (concentration: 30%,1.1eq,0.494mol,60.1 g) was added to the reaction flask to react at this temperature for 5 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 time with MTBE (150 mL), and the combined organic phases were concentrated to no drop at 35℃under reduced pressure to give intermediate 2 (57.2 g), yield: 93.4% (yield of starting material SM to intermediate 2).

Intermediate 2 was added to HCl in methanol (286.0 mL, [ HCl ] =4n) at 8 ℃ for 1 hour. Heating to 25 ℃ and stirring for 10 hours to complete conversion, concentrating under reduced pressure at 35 ℃ without dropping, adding water (286.0 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (114.4 mL), separating the liquid, extracting the aqueous phase with MTBE (114.4 mL) 1 time, dripping the obtained MTBE solution into an HCl solution (114.4 mL, [ HCl ] = 1N) of isopropanol at-5 ℃, keeping the temperature at-5 ℃ for stirring for 1 hour after the dripping is finished, dripping MTBE (286.0 mL) again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (57.2 mL) to obtain a wet product, and vacuum drying at 40 ℃ for 24 hours to obtain methyl (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylate hydrochloride solid (72.6 g), yield: 84.0% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 78.5%.

Example 4

Step one: preparation of intermediate 1

To the beaker was added raw material SM (50.0 g,0.449 mol), and after dissolving in water (150 mL), the mixture was adjusted to 6.2 with concentrated hydrochloric acid to obtain an aqueous solution of SM.

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration: 0.2mg/mL,5.0 g), catalase solution (Norwechat catalase solution, 66555U/g,5.0 g), defoamer (3 drops), air (flow rate: 10-20 mL/min) was introduced, SM aqueous solution was added dropwise to the three-necked flask, at the same time, naOH solution (concentration: 2N) was used to control pH of the system to 6.0-6.5, the reaction was carried out at 20℃for 43 hours while sealing the reaction system, gas in the reaction system was introduced into an MTBE (300 mL) -containing receiving apparatus through a pipe, the internal temperature was controlled to-5℃and after the receiving apparatus was discharged, the gas was introduced into dilute acid for absorption, to obtain MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing intermediate 1, an aqueous solution (300 mL) of NaCN (1.1 eq,0.450mol,22.03 g) was added, the reaction solution was cooled to 5℃and dropwise added to the reaction flask to make concentrated HCl (concentration: 30%,1.0eq,0.450mol,54.7 g) react at this temperature for 9 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 time with MTBE (150 mL), and the combined organic phases were concentrated to be non-dripping at 35℃under reduced pressure to give intermediate 2 (55.7 g), yield: 90.9% (yield of starting material SM to intermediate 2).

Intermediate 2 was added to HCl in methanol (167.1 mL, [ HCl ] =4n) at 8 ℃ for 1 hour. Heating to 25 ℃ and stirring for 11 hours to complete conversion, concentrating under reduced pressure at 35 ℃ without dropping, adding water (167.1 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (111.4 mL), separating the liquid, extracting the aqueous phase 1 time with MTBE (111.4 mL), dropping the obtained MTBE solution into an HCl solution of isopropanol (111.4 mL, [ HCl ] = 1N) at-5 ℃, keeping the temperature at-5 ℃ for stirring for 1 hour after the dropping is finished, dropping MTBE (389.9 mL) again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (55.7 mL) to obtain a wet product, and vacuum drying at 40 ℃ for 24 hours to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride solid (73.2 g), yield: 87.0% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 79.1%.

Example 5

Step one: preparation of intermediate 1

To the beaker was added raw material SM (50.0 g,0.449 mol), and after dissolving in water (150 mL), the mixture was adjusted to 6.5 with concentrated hydrochloric acid to obtain an aqueous solution of SM.

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration 0.2mg/mL,25.0 g), catalase solution (Norwechat catalase solution, 66555U/g,25.0 g), defoamer (3 drops), air (flow rate controlled at 30-40 mL/min), SM aqueous solution, naOH solution (concentration 2N) controlled system pH 6.5-7.0, heat preservation reaction at 20 ℃ for 35h, sealing reaction system, gas in reaction system connected to MTBE (300 mL) containing receiving device through pipeline, controlling internal temperature at-5 ℃ and gas after receiving device is discharged and absorbed in dilute acid to obtain MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing intermediate 1, an aqueous solution (300 mL) of NaCN (1.1 eq,0.494mol,24.2 g) was added, the reaction solution was cooled to 5℃and dropwise concentrated HCl (concentration: 30%,1.1eq,0.494mol,60.1 g) was added to the reaction flask to react at this temperature for 5 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 time with MTBE (150 mL), and the combined organic phases were concentrated to no drop at 35℃under reduced pressure to give intermediate 2 (55.0 g), yield: 89.8% (yield of starting material SM to intermediate 2).

Intermediate 2 was added to HCl in methanol (275.0 mL, [ HCl ] =4n) at 8 ℃ for 1 hour. Heating to 25 ℃ and stirring for 10 hours to complete conversion, concentrating under reduced pressure at 35 ℃ without dropping, adding water (275.0 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (110.0 mL), separating the liquid, extracting the aqueous phase 1 time with MTBE (110.0 mL), dropping the obtained MTBE solution into an HCl solution of isopropanol (110.0 mL, [ HCl ] = 1N) at-5 ℃, keeping the temperature at-5 ℃ for stirring for 1 hour after the dropping is finished, dropping MTBE (330.0 mL) again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (55.0 mL) to obtain a wet product, and vacuum drying at 40 ℃ for 24 hours to obtain a (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride solid (71.0 g), yield: 85.5% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 76.8%.

Example 6

Step one: preparation of intermediate 1

To the beaker was added raw material SM (50.0 g,0.449 mol), and after dissolving in water (150 mL), the mixture was adjusted to 7.5 with concentrated hydrochloric acid to obtain an aqueous solution of SM.

To the flask was added water (150 mL), monoamine oxidase solution (MAON 6, concentration: 0.2mg/mL,15.0 g), catalase solution (Norwechat catalase solution, 66555U/g,15.0 g), defoamer (3 drops), air (flow rate: 30-40 mL/min) was introduced, SM aqueous solution was added dropwise to the three-necked flask, at the same time, naOH solution (concentration: 2N) was used to control pH of the system to 7.5-8.0, the reaction was carried out at 20℃for 40 hours while sealing the reaction system, gas in the reaction system was introduced into an MTBE (300 mL) -containing receiving apparatus through a pipe, the internal temperature was controlled to-5℃and the gas was discharged after the receiving apparatus was introduced into dilute acid for absorption, to obtain MTBE solution of intermediate 1.

Step two: preparation of intermediate 2

To a reaction flask containing intermediate 1, an aqueous solution (300 mL) of NaCN (1.1 eq,0.494mol,24.2 g) was added, the reaction solution was cooled to 5℃and dropwise concentrated HCl (concentration: 30%,1.1eq,0.494mol,60.1 g) was added to the reaction flask to react at this temperature for 5 hours, after completion of the reaction, the solution was separated, the aqueous phase was extracted 1 time with MTBE (150 mL), and the combined organic phases were concentrated to no drop at 35℃under reduced pressure to give intermediate 2 (56.0 g), yield: 91.4% (yield of starting material SM to intermediate 2).

Intermediate 2 was added to HCl methanol solution (280.0 mL, [ HCl ] =4n) at 8 ℃ for 1 hour. Heating to 25 ℃ and stirring for 10 hours to complete conversion, concentrating under reduced pressure at 35 ℃ without dropping, adding water (280.0 mL), adjusting the pH to 9.0-9.5 with sodium hydroxide (2N), adding MTBE (112.0 mL), separating the liquid, extracting the aqueous phase 1 time with MTBE (112.0 mL), dropping the obtained MTBE solution into an HCl solution of isopropanol (112.0 mL, [ HCl ] = 1N) at-5 ℃, keeping the temperature at-5 ℃ for stirring for 1 hour after the dropping is finished, dropping MTBE (280.0 mL) again, stirring for 4 hours, filtering, rinsing the filter cake with MTBE (56.0 mL) to obtain a wet product, and vacuum drying at 40 ℃ for 24 hours to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride solid (70.0 g), yield: 82.8% (yield of intermediate 2 to (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride).

Total yield: 75.7%.

Example 7

The difference from example 1 is that MAON1 was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

Example 8

The difference from example 1 is that MAON2 was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

Example 9

The difference from example 1 is that MAON3 was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

Example 10

The difference from example 1 is that MAON4 was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

Example 11

The difference from example 1 is that MAON5 was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

Example 12

The difference from example 1 is that MAON was used as monoamine oxidase in this example at a concentration of 0.2mg/mL, and the remainder was the same as in example 1.

The statistical results of the product yields and the overall reaction yields of examples 1-12 are shown in Table 3.

TABLE 3 Table 3

Group of	Product yield (g)	Total yield (%)
			Example 1	69.9	75.6
Example 2	73.9	79.9
			Example 3	72.6	78.5
Example 4	73.2	79.1
			Example 5	71.0	76.8
Example 6	70.0	75.7
			Example 7	11.0	11.9
Example 8	17.8	19.3
			Example 9	22.1	23.8
Example 10	19.3	20.9
			Example 11	34.4	37.2
Example 12	7.8	8.4

As can be seen from Table 3, in the method for preparing (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride by using the monoamine oxidase of the present application, the total yield is not lower than 11.9%, and compared with examples 7-11, the preparation is carried out by using the preferred mutant strain MAON6 in examples 1-6, the yield and the total yield of the product are significantly improved, and the yield is not lower than 75%.

The applicant states that the present invention illustrates the preparation method of (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride of the present invention by the above examples, but the present invention is not limited to, i.e. it does not mean that the present invention must be practiced depending on the above examples. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.

Sequence listing

<110> Jin Dawei Biotechnology (Jiangsu) Co., ltd

Betula platyphylla Biotechnology Co.Ltd

Inner Mongolia Jindawei pharmaceutical Co.Ltd

<120> a process for preparing fused bicyclic proline methyl ester hydrochloride

<130> 2022

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 486

<212> PRT

<213> Pseudogymnoascus

<400> 1

Met Ala Ser Lys Asp Gly Phe Ser Trp Thr Lys Ala His Gly Leu Lys

1 5 10 15

Thr Gly Val Pro Cys Ile Gly Ala Ile Glu Pro Pro Ser Asn Leu Lys

20 25 30

Gly Thr Asp Ser Arg Phe Asp Val Ile Val Val Gly Ala Gly Tyr Cys

35 40 45

Gly Leu Thr Ala Ala Arg Asp Ala Ser Leu Ser Gly Leu Lys Val Leu

50 55 60

Leu Leu Glu Ala Arg Asp Arg Ile Gly Gly Arg Ser Trp Ser Ser Asn

65 70 75 80

Ile Asp Gly Tyr Pro Tyr Glu Met Gly Gly Thr Trp Val Tyr Trp Gly

85 90 95

Gln Ala Asn Val Trp Arg Glu Ile Ala Arg Tyr Gly Met Gln Asp Glu

100 105 110

Leu Glu Ile Ser Tyr Asp Phe Ser Arg Gly Ile Asn Gln Tyr Leu Leu

115 120 125

Ala Asn Ala Gln Gly Thr Gln His Phe Ser His Asp Glu Glu Asp Asp

130 135 140

Met Met Glu Ser Ser Leu Ser Lys Leu Val Asn Val Asp Glu Ser Phe

145 150 155 160

Gly Arg Lys Val Val Pro Phe Pro His Ser Gly Val Leu Ser Pro Glu

165 170 175

Ala Arg Arg Tyr Asp His Met Ser Ile Ala Asp Arg Leu Ala Glu Ile

180 185 190

Lys Asn Asp Leu Thr Leu Asn Glu Arg Leu Cys Val Glu Ala Phe Val

195 200 205

Leu Leu Cys Ser Gly Gly Thr Leu Glu Thr Thr Ser Phe Tyr Glu Phe

210 215 220

Leu His Trp Trp Ala Leu Ser Gly Tyr Ser Tyr Glu Gly Cys Val Asn

225 230 235 240

His Leu Val Lys Tyr Lys Phe Arg Gly Gly Gln Ser Ser Phe Ala Ile

245 250 255

Arg Phe Phe Gln Glu Ala Leu Ala Thr Gly Asn Phe Thr Tyr Ala Phe

260 265 270

Ser Arg Pro Val Ala Ser Ile Lys Asp Arg Gly Gly Thr Val Gln Val

275 280 285

Thr Thr Arg Asp Gly Gln Thr Phe Glu Ala Ala Lys Met Ile Ser Ala

290 295 300

Ile Pro Leu Asn Val Leu Ser Asp Val Thr Phe Asp Pro Pro Phe Thr

305 310 315 320

Ala Gly Arg Arg Thr Ala Ala Ser Ile Gly His Val Asn Gln Thr Val

325 330 335

Lys Val His Ala Glu Ile Ser Asp Arg Asp Leu Arg Ser Phe Thr Gly

340 345 350

Ile Ser Tyr Pro His Asn Gly Leu Ile Tyr Gly Phe Gly Asp Gly Glu

355 360 365

Thr Pro Val Gly Asn Thr His Val Val Ala Phe Gly Gly Gln His Asn

370 375 380

His Phe His Pro Glu Asp Asn Ile Asp His Thr Ile Ala Ala Phe Gln

385 390 395 400

Gly Phe Thr Pro Met Asn Val Glu Arg Leu Val Phe His Asn Trp Ser

405 410 415

Arg Asp Glu Phe Ala Lys Gly Ala Trp Phe Phe Pro Ala Pro Gly Leu

420 425 430

Leu Ser Thr Tyr Leu Lys Asp Met Arg Ala Arg Gln Gly Asn Ile Ile

435 440 445

Phe Ala Cys Ser Asp Trp Ala Leu Gly Trp Arg Ser Phe Ile Asp Gly

450 455 460

Ala Ile Glu Glu Gly Ala Arg Ala Ala Ala Ala Val Gln Ala Asp Leu

465 470 475 480

Thr Gly Arg Ala Lys Leu

485

<210> 2

<211> 1461

<212> DNA

<213> Pseudogymnoascus

<400> 2

atggccagta aagatggctt tagctggacc aaagcccatg gcctgaaaac cggcgttccg 60

tgcattggtg caattgaacc gccgagcaat ctgaaaggta ccgatagccg ctttgatgtg 120

attgttgtgg gcgccggcta ttgcggtctg accgcagccc gcgatgccag tctgagtggt 180

ctgaaagtgc tgctgctgga agcacgtgat cgcattggtg gtcgcagttg gagtagcaat 240

attgatggct atccgtatga aatgggcggc acctgggttt attggggtca ggccaatgtt 300

tggcgcgaaa ttgcccgtta tggtatgcag gatgaactgg aaattagtta tgattttagc 360

cgtggtatta accagtatct gctggcaaat gcccagggca cccagcattt tagtcatgat 420

gaagaagatg atatgatgga aagcagtctg agtaaactgg tgaatgtgga tgaaagtttt 480

ggtcgtaaag tggtgccgtt tccgcatagc ggtgttctga gtccggaagc ccgtcgctat 540

gatcacatga gcattgcaga tcgcctggcc gaaattaaaa atgatctgac cctgaatgaa 600

cgcctgtgtg ttgaagcctt tgtgctgctg tgtagcggtg gtaccctgga aaccaccagc 660

ttttatgaat ttctgcattg gtgggcactg agcggttata gctatgaagg ctgcgtgaat 720

catctggtta aatataaatt ccgtggtggt cagagtagct ttgcaattcg tttttttcag 780

gaagccctgg caaccggtaa ttttacctat gcctttagtc gcccggtggc aagcattaaa 840

gatcgtggcg gtaccgttca ggttaccacc cgcgatggcc agacctttga agccgcaaaa 900

atgattagtg ccattccgct gaatgttctg agtgatgtga cctttgatcc gccgtttacc 960

gccggccgtc gtaccgctgc cagcattggt catgttaatc agaccgttaa agttcatgca 1020

gaaattagcg atcgtgatct gcgcagtttt accggtatta gctatccgca taatggcctg 1080

atttatggct ttggtgatgg tgaaaccccg gttggtaata cccatgtggt tgcctttggt 1140

ggtcagcata atcattttca tccggaagat aatatcgatc ataccattgc cgcctttcag 1200

ggttttaccc cgatgaatgt tgaacgtctg gtttttcata attggagtcg tgatgaattt 1260

gccaaaggtg cctggttttt tccggccccg ggtctgctga gtacctatct gaaagatatg 1320

cgtgcacgtc agggcaatat tatttttgca tgtagtgatt gggcactggg ttggcgcagt 1380

tttattgatg gtgcaattga ggaaggcgca cgtgcagccg ccgccgttca ggcagatctg 1440

accggtcgtg caaaactgta a 1461

<210> 3

<211> 30

<212> DNA

<213> artificial sequence

<400> 3

gaattccata tggccagtaa agatggcttt 30

<210> 4

<211> 33

<212> DNA

<213> artificial sequence

<400> 4

ccgctcgagt tacagttttg cacgaccggt cag 33

Claims

1. A process for the preparation of (1 r,2s,5 s) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride, characterized in that the process comprises the steps of:

the monoamine oxidase in the step (1) is a monoamine oxidase mutant with amino acid mutation;

the amino acid mutation is any one of the following mutations on the basis of the amino acid sequence shown in SEQ ID No. 1:

(1) H394A, I396K, A397M and Q400E;

(2) N333S, D344S, R345P, H394A, I396K, A397M and Q400E;

(3) V239I, N240D, H C, V243M, N333S, D344S, R345P, H394A, I396K, A397M and Q400E.

2. The method of claim 1, wherein the monoamine oxidase coding sequence comprises the nucleotide sequence set forth in SEQ ID No. 2.

3. The method of claim 1, wherein the monoamine oxidase is derived from pseudonymoascus.

4. The method of claim 1, wherein the method of preparing the monoamine oxidase mutant comprises the steps of:

5. The preparation method according to claim 1, wherein the solvent for the reaction in the step (1) is water, and the amount of the solvent is 3 to 8 times the mass of the compound SM.

6. The process according to claim 1, wherein the compound SM is dissolved in water before the reaction in step (1), and the pH is adjusted with an acid to obtain an aqueous solution of SM.

7. The method according to claim 6, wherein the acid is concentrated hydrochloric acid, concentrated sulfuric acid or concentrated phosphoric acid.

8. The method according to claim 6, wherein the pH is 6.0 to 8.0.

9. The method of claim 8, wherein the pH is 7.0-7.5.

10. The method according to claim 1, wherein the catalase in step (1) is used in an amount of 0.1 to 0.5 times by mass of the compound SM.

11. The method according to claim 10, wherein the catalase of step (1) is used in an amount of 0.2 to 0.3 times by mass of the compound SM.

12. The preparation method according to claim 1, wherein the monoamine oxidase is used in an amount of 0.1 to 0.5 times by mass of the compound SM.

13. The method according to claim 12, wherein the monoamine oxidase is used in an amount of 0.2 to 0.3 times the mass of the compound SM.

14. The method according to claim 1, wherein air is introduced during the reaction in the step (1), and the flow rate of the air is 10-100mL/min.

15. The method of claim 14, wherein the air is introduced at a flow rate of 30-40mL/min.

16. The process according to claim 1, wherein the reaction liquid of the reaction in the step (1) has a pH of 6.0 to 8.0.

17. The process of claim 16, wherein the pH of the reaction solution of the reaction of step (1) is 7.0 to 7.5.

18. The method according to claim 1, wherein the pH of the reaction solution of the reaction in step (1) is controlled by an alkaline solution, which is an organic base or an inorganic base.

19. The method of claim 18, wherein the organic base comprises any one or a combination of at least two of triethylamine, diisopropylethylamine, diethylamine, DBU.

20. The method of claim 18, wherein the inorganic base comprises any one or a combination of at least two of potassium hydroxide, sodium hydroxide, lithium hydroxide, potassium carbonate, sodium carbonate, cesium carbonate, or aqueous ammonia.

21. The method according to claim 1, wherein the reaction in step (1) is carried out at a temperature of 5 to 35℃for a period of 5 to 48 hours.

22. The process according to claim 1, wherein the temperature is controlled to be-5 to 5 ℃ when the gas produced in the reaction in step (1) is introduced into methyl tertiary butyl ether.

23. The process according to claim 1, wherein the methyl tert-butyl ether is used in an amount of 3 to 10 times the mass of compound SM in step (1).

24. The process according to claim 23, wherein the methyl tert-butyl ether is used in an amount of 5 to 8 times the mass of compound SM in step (1).

25. The method according to claim 1, wherein in the step (1), the gas generated by the reaction is introduced into methyl tertiary butyl ether, and the tail gas generated after the absorption is introduced into dilute acid for absorption, wherein the dilute acid is an inorganic acid or an organic acid.

26. The method of claim 25, wherein the mineral acid is dilute hydrochloric acid or dilute sulfuric acid.

27. The method of claim 25, wherein the organic acid is benzenesulfonic acid, methanesulfonic acid, or tartaric acid.

28. The process according to claim 1, wherein the molar ratio of NaCN in step (2) to compound SM in step (1) is from 1.0 to 1.5:1.

29. the process according to claim 28, wherein the molar ratio of NaCN in step (2) to compound SM in step (1) is from 1.0 to 1.2:1.

30. the process according to claim 1, wherein the molar ratio of concentrated hydrochloric acid in step (2) to compound SM in step (1) is from 1.0 to 1.5:1.

31. the process of claim 30, wherein the molar ratio of concentrated hydrochloric acid in step (2) to compound SM in step (1) is 1.0-1.2:1.

32. The process according to claim 1, wherein the temperature of the reaction in step (2) is 0 to 10 ℃.

33. The process of claim 1, wherein the reaction time in step (2) is 1 to 10 hours.

34. The process according to claim 1, wherein the concentration of HCl in the methanolic hydrochloric acid solution of step (3) is 1N-5N.

35. The process of claim 34, wherein the HCl in the methanolic HCl solution of step (3) is at a concentration of 4N.

36. The method according to claim 1, wherein the amount of the hydrochloric acid methanol solution in the step (3) is 3 to 8 times by mass of the compound 2.

37. The method according to claim 36, wherein the amount of the hydrochloric acid methanol solution in the step (3) is 5 to 6 times by mass of the compound 2.

38. The preparation method according to claim 1, wherein the compound 2 in the step (3) is reacted in a methanol solution of hydrochloric acid at a temperature of 5-10 ℃ for 1-3 hours and then heated to 20-25 ℃ for 5-12 hours.

39. The preparation method according to claim 1, wherein the compound 2 in the step (3) is reacted in a hydrochloric acid methanol solution, after the reaction is finished, the solution is concentrated under reduced pressure until no drop is generated, a proper amount of water is added, the pH is adjusted to be alkaline by alkali, the solution is separated, and the aqueous phase is extracted by MTBE.

40. The process of claim 39 wherein the reduced pressure concentration is at a temperature of 20-60 ℃.

41. The process of claim 40 wherein the reduced pressure concentration is at a temperature of 30-40 ℃.

42. The process according to claim 39, wherein the alkali used for adjusting the pH to be alkaline is an organic alkali or an inorganic alkali.

43. The process of claim 42 wherein the organic base comprises any one or a combination of at least two of triethylamine, diisopropylethylamine, diethylamine, or DBU.

44. The process of claim 42 wherein the inorganic base comprises any one or a combination of at least two of potassium hydroxide, sodium hydroxide, lithium hydroxide, potassium carbonate, sodium carbonate, cesium carbonate, or aqueous ammonia.

45. The process of claim 44 wherein the inorganic base is aqueous sodium hydroxide.

46. The process of claim 45 wherein the inorganic base is 1N-4N aqueous sodium hydroxide.

47. The process of claim 39 wherein the alkaline adjustment of pH to alkaline means adjusting pH to 9.0-11.0.

48. The process of claim 47, wherein the alkaline pH is adjusted to a pH of 9.0 to 9.5.

49. The method according to claim 1, wherein the HCl concentration in the isopropanol hydrochloride solution in step (3) is 1N to 5N.

50. The process of claim 49, wherein the HCl concentration in the isopropyl alcohol solution of step (3) is 1N.

51. The preparation method according to claim 1, wherein the amount of the MTBE solution in the step (3) is 4 to 8 times the mass of the compound 2.

52. The process of claim 51, wherein the MTBE solution in step (3) is used in an amount of 5 to 6 times the mass of compound 2.

53. The process according to claim 1, wherein the MTBE solution obtained in step (3) is added to isopropanol hydrochloride solution and stirred at-10 to 0 ℃ for 1 to 8 hours.

54. The preparation method according to claim 1, wherein the MTBE solution obtained in the step (3) is added to an isopropyl alcohol hydrochloride solution, filtered after the reaction is completed, and the filter cake is rinsed with MTBE to obtain a wet product, and then dried in vacuum for 8-24 hours to obtain (1R, 2S, 5S) -6, 6-dimethyl-3-azabicyclo- [3.1.0] hexane-2-carboxylic acid methyl ester hydrochloride.

55. The method of claim 54, wherein the vacuum drying temperature is 20-60 ℃.

56. The method of claim 55, wherein the vacuum drying temperature is 35-45 ℃.