CN109266595B

CN109266595B - Construction and application of recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine

Info

Publication number: CN109266595B
Application number: CN201811119484.6A
Authority: CN
Inventors: 刘立明; 张君轩; 付妍; 刘佳; 宋伟; 张灿
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-09-25
Filing date: 2018-09-25
Publication date: 2020-12-29
Anticipated expiration: 2038-09-25
Also published as: CN109266595A

Abstract

The invention discloses construction and application of a recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine, belonging to the technical field of biological engineering. The production method provided by the invention utilizes a recombinant bacterium for expressing double plasmids, realizes efficient expression of three enzymes at the same time, converts L-threonine into L-2-aminobutyric acid, is coupled with a coenzyme regeneration system, and converts NAD + into NADH, so that the concentration of NADH in the system is relatively stable, and the conversion can be efficiently carried out. Furthermore, CO2 converted from ammonium formate in the process can be dissolved in ammonia water generated in a conversion system, so that the method has little environmental pollution and industrial application value. The method has the advantages of mild conversion conditions, strong specificity, low cost, short conversion time and the like. The method is adopted to prepare the L-2-aminobutyric acid, 40g/L L-threonine is added, the concentration of the obtained product L-2-aminobutyric acid is 43.3g/L, and the conversion rate is more than 99.9%.

Description

Construction and application of recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine

Technical Field

The invention relates to construction and application of a recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine, belonging to the technical field of biological engineering.

Background

L-2-aminobutyric acid is an unnatural chiral amino acid and has the effects of inhibiting human neural information transfer, enhancing the activity of glucose phosphatase and promoting brain cell metabolism. Meanwhile, 2-aminobutyric acid is also an important chemical raw material and a medical intermediate, and is widely used for synthesizing medicaments, such as ethambutol hydrochloride serving as an antituberculosis medicament and levetiracetam serving as an antiepileptic medicament.

Currently, the synthesis method of L-2-aminobutyric acid includes a chemical method and a biological method. The chemical method mainly comprises a ketobutyric acid reduction method, a desulfurization reaction method, an ammonolysis method, a halogenated ammonolysis method, a chemical resolution method and the like. However, the method has harsh reaction conditions and is easy to generate byproducts; the cost is high, and the industrial production is not suitable to be carried out; meanwhile, the use of a large amount of organic solvent easily causes environmental pollution.

The biological method for synthesizing the L-2-aminobutyric acid has the characteristics of high stereoselectivity, mild reaction conditions, less environmental pollution and the like, and has wide industrial development prospect. The biological method also comprises a microbial fermentation method and an extracellular enzyme conversion method. The microbial fermentation method has the advantages of strong specificity, mild conditions and less environmental pollution, but byproducts with similar structures with target products are generated in the fermentation process, the components of reaction products are complex, and the subsequent separation is difficult. The enzyme-catalyzed conversion is a high-selectivity reaction, and can achieve the purpose of directional conversion. However, the multienzyme conversion process mostly faces the problems of low enzyme activity, low enzyme stability, low coenzyme cyclic regeneration efficiency, complex multienzyme addition, difficult engineering amplification and the like. The problems can be solved to a certain extent by the participation of the whole cells of the recombinant bacteria in transformation, but the problems of long transformation time, poor transformation effect and the like still exist.

Disclosure of Invention

The invention aims to overcome the problems in the prior production technology and provide a method for preparing L-2-aminobutyric acid by converting L-threonine, which is efficient, simple, low in cost and easy for industrial production.

The invention firstly provides a recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine, wherein the recombinant bacterium takes escherichia coli as a host, and a dual-plasmid expression system expresses threonine deaminase, formate dehydrogenase and leucine dehydrogenase, and the dual-plasmid expression system comprises a PETDuet-1 plasmid and a pRSFDuet-1 plasmid.

In one embodiment of the invention, the PETDuet-1 plasmid is used to express threonine deaminase, formate dehydrogenase and the pRSFDuet-1 plasmid is used to express leucine dehydrogenase.

In one embodiment of the invention, the threonine deaminase is selected from the group consisting of E.coli, preferably E.coli W3110, having the gene sequence SEQ ID NO 1 and the amino acid sequence SEQ ID NO 5.

In one embodiment of the invention, the leucine dehydrogenase is selected from the group consisting of Bacillus thuringiensis, preferably Bacillus thuringiensis serovar kurstaki YBT-1520, having the gene sequence SEQ ID NO 2 and the amino acid sequence SEQ ID NO 6.

In one embodiment of the invention, the formate dehydrogenase is selected from Candida.

In one embodiment of the present invention, preferably, the nucleotide sequence of the formate dehydrogenase is shown as SEQ ID NO. 4 and the amino acid sequence is shown as SEQ ID NO. 7 after codon optimization.

In one embodiment of the invention, the host is preferably e.coli BL21(DE 3).

The invention also provides a method for producing L-2-aminobutyric acid by converting L-threonine, which is characterized in that a substrate is converted into L-2-aminobutyric acid by using the recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine, and a coenzyme regeneration system is coupled.

In one embodiment of the present invention, the coenzyme regeneration system uses ammonium formate as a substrate, and NAD is converted by formate dehydrogenase⁺Coenzyme regeneration system for conversion to NADH.

In one embodiment of the present invention, the substrate has an L-threonine concentration of 30 to 40g/L, an ammonium formate concentration of 10 to 30g/L, and NAD⁺The concentration is 0.4-1.0 g/L, the recombinant bacteria are added in the form of bacterial liquid after being cultured, the transformation temperature is 30-40 ℃, and the transformation pH is 7.0-8.5.

In one embodiment of the invention, the conversion time is 8-12 h.

In one embodiment of the present invention, the bacterial solution is prepared by collecting bacterial cells by centrifugation and dissolving the collected bacterial cells in NaH having a pH of 7.0 to 8.5₂PO₄-Na₂HPO₄And a buffer solution, wherein the addition amount of the bacterial cells is 30-50 g/L.

The invention has the beneficial effects that:

(1) in the method for producing the L-2-aminobutyric acid by converting the L-threonine by using the recombinant bacteria, the conversion substrate is the natural amino acid L-threonine with low price, the three enzymes can be efficiently expressed in one recombinant bacteria at the same time, the recombinant bacteria can be cultured in a large scale, the treatment processes of cell crushing, freeze drying and the like are not needed, the cost is low, the operation is simple and convenient, and a high-efficiency, low-cost and easy-to-industrialize amplification production biological enzyme synthesis process can be established.

(2) The production method utilizes a coenzyme regeneration system in the process of converting the intermediate product into the L-2-aminobutyric acid by NAD⁺The NADH is converted into NADH, so that the concentration of the NADH in the system is relatively stable, and the conversion can be carried out efficiently.

(3) CO converted from ammonium formate in the process₂Can be dissolved in the ammonia water generated in the conversion system, has little pollution to the environment and has industrial application value.

(4) The method has the advantages of strong specificity, low substrate cost, high optical purity of products and the like, the L-2-aminobutyric acid is prepared by the method, 40g/L of threonine is added, the yield of the L-2-aminobutyric acid is 46g/L, the conversion rate reaches more than 99.9%, in addition, the conversion time of the recombinant bacteria only needs 8-12 hours, the conversion rate can reach more than 99%, and the conversion time period is long and the conversion efficiency is high.

Drawings

FIG. 1: a reaction scheme for producing L-2-aminobutyric acid by converting L-threonine.

FIG. 2: double-cleaved SDS-PAGE protein detection map after expression of plasmids pRSFDuet-BtLeuDH and pETduet-CbFDH-EcTD.

FIG. 3: SDS-PAGE protein detection of colony PCR after expression of plasmid pETduet-BtLeuDH-CbFDH-EcTD.

Detailed Description

The following examples are all carried out using conventional experimental methods and experimental materials are commercially available.

Sample pretreatment: centrifuging the transformation solution at 12000rpm for 10min, collecting supernatant, and preparing standard solution with 2-aminobutyric acid as standard substance. Filtering the supernatant and the standard solution after appropriate dilution with 0.22 μm microporous membrane, and measuring 2-aminobutyric acid by high performance liquid chromatography.

And (3) detecting the enzymatic activity of threonine deaminase: 200. mu.L of threonine deaminase-producing bacterial solution having a final concentration of 5g/L was taken, added to 3800. mu.L of a substrate (substrate system: 20. mu. mol/L of PLP and 50mmol/L of threonine dissolved in 50mmol/L of potassium dihydrogenphosphate-dipotassium hydrogenphosphate buffer solution having a pH of 7.5), reacted in a thermostatic water bath at 40 ℃ for 15min, and then boiled to terminate the reaction. Samples were diluted 10-fold and threonine reduction was measured using HPLC-OPA pre-column derivatization. The enzyme activity unit U is defined as the amount of enzyme required for a 1. mu. mol reduction of threonine in 1 min.

And (3) detecting the activity of leucine dehydrogenase: 200. mu.L of the bacterial solution of the leucine dehydrogenase-producing bacterium and the bacterial solution of the formate dehydrogenase-producing bacterium with a final concentration of 10g/L were added to 1600. mu.L of a substrate (substrate system: 0.6g/L NAD was dissolved in 50mmol/L sodium dihydrogen phosphate-disodium hydrogen phosphate buffer solution with pH8.0⁺20mmol/L of 2-ketobutyric acid and 40mmol/L of ammonium formate) at 30 ℃ for 15min in a constant-temperature water bath, and then boiling to terminate the reaction. The sample was diluted 10-fold and the amount of 2-aminobutyric acid produced was measured by HPLC-OPA pre-column derivatization. The enzyme activity unit U is defined as the amount of enzyme required for 1. mu. mol increase of 2-aminobutyric acid within 1 min.

Detecting the activity of the formate dehydrogenase: in a reaction system of 300. mu.L, 0.1mol/L beta-mercaptoethanol and 1.67mmol/L NAD are added⁺167mmol/L sodium formate, 200. mu.L total, 100. mu.L FDH-producing bacteria solution, and 10mmol/L pH7.5 phosphate solution as buffer solution. The reaction is carried out at the temperature of 30 ℃, and the absorbance of NADH at 340nm is detected by a microplate reader every 30s and is plotted. Configuring NADH standard solutions (0-0.6mmol/L) with different concentrations, measuring the absorbance at 340nm, drawing a standard curve, and fitting a regression equation. The enzyme activity unit U is defined as the amount of enzyme required to produce 1. mu. mol NADH within 1 min.

Determination of 2-aminobutyric acid content: high performance liquid chromatography with ortho-phthalaldehyde (OPA) as derivatization reagent, ZORBAX SB-C18 as chromatographic column, and 10mmol/L KH as mobile phase A₂PO₄(4mol/L KOH pH 5.3), mobile phase B acetonitrile: methanol: and (3) carrying out gradient elution on the phase A (5: 3:1 (pH 5.3 adjusted by glacial acetic acid), wherein the flow rate is 1mL/min, and the detection wavelength is 330, 460nm and the column temperature is 30 ℃.

Determination of 2-Butyronic acid content: high performance liquid chromatography, mobile phase composition: 5mmol/L dilute sulfuric acid, the flow rate is 0.6 mL/min; sample introduction volume: 10 mu L of the solution; a chromatographic column: aminex HPX-87H Ion Exclusion Column, 300X 7.8 mm; a detector: and an ultraviolet detector with the wavelength of 210 nm.

Example 1: acquisition of genetically engineered bacteria for producing threonine deaminase of escherichia coli

(1) Escherichia coli W3110 was inoculated into LB medium, cultured at 37 ℃ for 12 hours to collect cells, and genomic DNA was extracted using a bacterial genome extraction kit.

(2) Cloning the threonine deaminase gene EcTD from the genome with primers EcTD-1(5'CGGGATCCATGGCTGACTCGCAACCCCTG 3', SEQ ID NO:8) and EcTD-2(5'CCCAAGCTTCTAACCCGCCAAAAAGAACCTGAAC 3', SEQ ID NO:9), respectively;

(3) connecting a target gene to a PMD19simple clone vector for sequencing, selecting a correct gene fragment, carrying out double enzyme digestion by using BamHI and XhoI, and then connecting the correct gene fragment to a plasmid pET28a which is subjected to double enzyme digestion by using the same two enzymes;

(4) the constructed expression plasmid is introduced into E.coli BL21(DE3), and is screened and verified in an LB plate containing kanamycin to select a strain with completely correct target genes, wherein the gene sequence is SEQ ID NO. 1, and the amino acid sequence is SEQ ID NO. 5.

(5) The recombinant plasmid-containing engineered bacteria obtained above were inoculated into LB liquid medium containing 100mg/L kanamycin and cultured overnight at 37 ℃ with shaking at 200 r/min. Inoculating the overnight culture into TB medium containing 100mg/L kanamycin at an inoculum size of 4%, performing shaking culture at 37 deg.C and 200r/min until bacterial liquid OD600 is 0.6-0.8, adding inducer IPTG to a final concentration of 100mg/L, performing induction culture at 25 deg.C and 200r/min for 10h, and centrifuging to collect thallus.

(6) The collected cells were dissolved in a potassium dihydrogen phosphate-dipotassium hydrogen phosphate buffer solution having a pH of 7.5 to give a concentration of 100g/L, and the enzyme activity was measured by the method described above, and the enzyme activity of threonine deaminase was 1350U.

Example 2: acquisition of genetically engineered bacteria for producing leucine dehydrogenase of bacillus thuringiensis

(1) The bacillus thuringiensis is inoculated in an LB culture medium, cultured at 37 ℃ for 12h to collect thalli, and a bacterial genome extraction kit is used for extracting genome DNA.

(2) The Bacillus thuringiensis leucine dehydrogenase gene BtLeuDH is cloned from genome DNA by primers BtLeuDH-1(5 'CGGGATCCATGCGCGTTATGGTCTTG 3', SEQ ID NO:10) and BtLeuDH-2(5 'CCCAAGCTTTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:11), respectively.

(3) Connecting a target gene to a PMD19simple cloning vector for sequencing, selecting a correct gene fragment, carrying out double enzyme digestion by using BamHI and XhoI, and connecting the correct gene fragment to pET28a subjected to double enzyme digestion by using the same two enzymes;

(4) the constructed expression plasmid is introduced into E.coli BL21(DE3), and is screened and verified in an LB plate containing kanamycin to select a strain with completely correct target genes, wherein the gene of the bacillus thuringiensis leucine dehydrogenase is shown as SEQ ID NO. 2, and the amino acid sequence is SEQ ID NO. 6.

(5) The engineered bacteria containing the recombinant plasmids obtained above were inoculated into LB liquid medium containing 100mg/L kanamycin, respectively, and cultured overnight at 37 ℃ with shaking at 200 r/min. Inoculating the overnight culture in TB medium containing 100mg/L kanamycin at 4%, and culturing at 37 deg.C under shaking at 200r/min to OD₆₀₀Adding inducer IPTG to 0.6-0.8, inducing and culturing at 25 deg.C and 200r/min for 10 hr, and centrifuging to collect thallus.

(6) The collected cells were dissolved in a sodium dihydrogen phosphate-disodium hydrogen phosphate buffer solution having a pH of 8.5 to a concentration of 100g/L, and the enzyme activity was detected by the method described above, and the enzyme activity of leucine dehydrogenase was 184U.

Example 3: acquisition of genetically engineered bacterium for producing formate dehydrogenase

Codon optimization (the original gene sequence is shown as SEQ ID NO:3) is carried out on the formate dehydrogenase gene (FDH) derived from Candida boidinii to ensure that the gene sequence is more suitable for a large intestine expression system, the optimized gene sequence is shown as SEQ ID NO:4, and the amino acid sequence is shown as SEQ ID NO: 7. Carrying out double enzyme digestion on an artificially synthesized FDH gene fragment containing BamHI and XhoI enzyme digestion sites, then connecting the FDH gene fragment with an expression vector pET28a obtained by the same double enzyme digestion to construct a recombinant plasmid pET28a-FDH, transferring the recombinant plasmid into an expression host E.coli BL21(DE3), and screening and verifying in an LB plate containing kanamycin to screen out a correct positive strain.

Inoculating the codon-optimized engineering bacteria into LB liquid culture medium containing 100mg/L kanamycin, shaking at 37 deg.C and 200r/minAnd (5) culturing overnight. Inoculating the overnight culture in TB medium containing 100mg/L kanamycin at 4%, and culturing at 37 deg.C under shaking at 200r/min to OD₆₀₀Adding inducer IPTG to 0.6-0.8, inducing and culturing at 25 deg.C and 200r/min for 10 hr, and centrifuging to collect thallus.

The collected cells were dissolved in a sodium dihydrogen phosphate-disodium hydrogen phosphate buffer solution having a pH of 8.5 to a concentration of 100g/L, and the enzyme activity was detected by the method described above, and the enzyme activity of formate dehydrogenase was 178U.

Example 4: conversion of threonine to 2-ketobutyric acid by threonine deaminase

Influence of bacterial liquid concentration on conversion rate: in a 20mL transformation system, the concentration of substrate L-threonine in the transformation system was set to 50g/L, 20. mu. mol/L PLP was added, and the transformation solution was a sodium phosphate buffer solution at pH 7.5. And (3) converting in a constant-temperature shaking table at 37 ℃, sampling at the rotating speed of 200r/min for 14-20 h, and setting the bacterial liquid concentration gradient of the threonine deaminase producing strain to be 15g/L, 20g/L, 25g/L, 30g/L and 35 g/L. And (3) converting in a constant-temperature shaking table at 37 ℃, rotating at 200r/min, sampling for 12-20 h respectively, boiling to terminate the reaction, centrifuging, and taking supernatant liquid for liquid chromatography to detect the yield of the 2-ketobutyric acid. As is clear from the results in Table 2, the optimum bacterial liquid concentration under these conditions was 15g/L, the 2-ketobutyric acid yield was 41.6g/L, and the conversion rate reached 97%.

TABLE 1 influence of different bacterial liquid concentrations on the production of 2-ketobutyric acid.

Effect of substrate concentration on conversion: in a 20mL conversion system, threonine concentration gradients of 20g/L, 30g/L, 40g/L, 50g/L and 60g/L were set, 15g/L of threonine deaminase-producing bacteria solution and 20. mu. mol/L of PLP were added, and the conversion solution was a pH7.5 sodium phosphate buffer solution. And (3) converting in a constant-temperature shaking table at 37 ℃, sampling at the rotating speed of 200r/min for 14-20 h, and detecting the yield of the 2-ketobutyric acid in the supernatant by liquid chromatography. As is clear from the results in Table 3, the optimum substrate concentration under these conditions was 50g/L, the yield of 2-ketobutyric acid was 41.0g/L, and the molar conversion of threonine was 95% or more.

TABLE 2 Effect of different substrate concentrations on the production of 2-ketobutyric acid.

From the above experimental process, it was confirmed that the optimal substrate concentration of the system for converting threonine into 2-ketobutyric acid by threonine deaminase was 50g/L, the optimal bacterial liquid concentration was 15g/L, and the conversion rate of threonine at this time was 95% or more.

Example 5: conversion of 2-ketobutyric acid to 2-aminobutyric acid by leucine deaminase

Influence of bacterial liquid concentration on conversion rate: in a 20mL conversion system, the concentration of 2-ketobutyric acid is set to be 50g/L, 20g/L ammonium formate, 10g/L bacterial liquid of formate dehydrogenase producing bacteria and 0.6g/L NAD are added⁺The conversion buffer system is NaH with pH of 8.0₂PO₄-Na₂HPO₄The concentration gradient of the buffer solution and the bacterial liquid of the leucine dehydrogenase producing strain is 15g/L, 20g/L, 25g/L, 30g/L and 35 g/L. And (3) converting in a constant-temperature shaking table at 37 ℃, sampling at the rotating speed of 200r/min for 14-20 h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography. From the analysis results in Table 4, it was found that the optimum bacterial suspension concentration under these conditions was 20g/L, the 2-ketobutyric acid concentration was 32.4g/L and the conversion was 64.2%.

TABLE 3 influence of different bacterial liquid concentrations on the production of 2-aminobutyric acid.

Effect of substrate concentration on conversion: setting the concentration gradient of 2-ketobutyric acid to be 25g/L, 30g/L, 35g/L and 40g/L in a 20mL conversion system, adding 10-30 g/L ammonium formate, 20g/L bacterial liquid of leucine dehydrogenase producing bacteria, 10g/L bacterial liquid of formate dehydrogenase producing bacteria and 0.6g/L NAD⁺The conversion solution is NaH with pH8.0₂PO₄-Na₂HPO₄The buffer solution is transformed in a constant temperature shaking table at 37 ℃, the rotating speed is 200r/min, the sampling is carried out for 14-20 h, and the efficiency is highAnd detecting the yield of the 2-aminobutyric acid by liquid chromatography. As is clear from Table 5, under these conditions, the optimum substrate concentration was 35.0g/L, the yield of 2-aminobutyric acid was 33.9g/L, and the conversion rate reached 96.0%.

TABLE 4 influence of different substrate concentrations on the production of 2-aminobutyric acid.

From the above experimental procedures, it was confirmed that the optimal substrate concentration of the system for converting leucine dehydrogenase into 2-ketobutyric acid to produce 2-aminobutyric acid was 35g/L, the optimal bacterial liquid concentration was 20g/L, and the conversion rate reached 96%.

Example 6: influence of threonine concentration on L-threonine production system by three-enzyme cascade conversion

Adding 15g/L of bacterial liquid of threonine deaminase producing bacteria, 20g/L of bacterial liquid of amino acid dehydrogenase producing bacteria and 10g/L of bacterial liquid of formic acid dehydrogenase producing bacteria into a 20mL conversion system, and setting threonine concentration gradients of 20g/L, 30g/L, 40g/L, 50g/L, 10-30 g/L of ammonium formate and 0.6g/L of NAD⁺5-20 mu mol/L PLP, and the conversion solution is NaH with pH of 8.0₂PO₄-Na₂HPO₄And (4) a buffer solution. And (3) converting in a constant-temperature shaking table at the temperature of 32-37 ℃, sampling at the rotating speed of 200r/min for 14-20 h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography. As is clear from Table 6, under these conditions, the optimum threonine concentration was 40g/L, the L-2-aminobutyric acid yield was 34.3g/L, the optical purity ee was 99%, and the conversion rate was 99% or more.

TABLE 5 influence of different substrate concentrations on the production of 2-aminobutyric acid.

Example 7: construction of plasmid pRSFDuet-BtLeuDH

Inoculating bacillus thuringiensis YBT-1520 to LB culture medium, culturing at 37 ℃ for 12h, collecting thalli, and extracting genome DNA by using a bacterial genome extraction kit. Cloning gene BtLeu of leucine dehydrogenase from genome by primer BtLeuDH-1(5'CATCATCACCACAGCCAGGATCCAATGACATTAGAAATCTTCGAATACTTAG 3', SEQ ID NO:12) and BtLeuDH-2(5'GCGGTTTCTTTACCAGACTCGAGTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:13) respectively; and carrying out agarose gel electrophoresis separation and purification on the DNA fragment obtained by PCR, carrying out BamHI and XhoI double digestion on the recovered fragment, and connecting the double-promoter high-copy expression vector pRSFDuet-1 subjected to same double digestion treatment, agarose gel electrophoresis separation and purification and recovery by a one-step homologous recombination method. And (3) transforming the ligation product into JM109 competent cells by a chemical transformation method, culturing for 1h, coating the cells on an LB plate containing kanamycin, culturing for 10h, carrying out streak isolation culture on grown colonies for 12h, and selecting single colonies to carry out colony PCR (polymerase chain reaction) to identify positive clones. And inoculating the positive clone into an LB culture medium, culturing at 37 ℃ for 12h, extracting a plasmid, carrying out SDS-PAGE detection after double enzyme digestion, and obtaining a detection result shown in figure 2. And (3) carrying out sequencing verification to construct a recombinant plasmid pRSFDuet-BtLeuDH.

Example 8: construction of plasmid pETduet-CbFDH-EcTD

Escherichia coli W3110 and Candida were inoculated into LB medium, and genomic DNA was extracted as described in example 7. Cloning the gene CbFDH of formate dehydrogenase from genome with primers CbFDH-1(5'CCATCATCACCACAGCCAGGATCCAATGAAGATCGTGTTAGTCCTTTACGACG 3', SEQ ID NO:14) and CbFDH-2(5'GGTACCTTTCTCCTCTTTAATCTGCAGTTATTATTTTTTATCGTGTTTCCCGTAG 3', SEQ ID NO:15), respectively; the threonine deaminase gene EcTD was cloned from the genome with primers EcTD-1(5'CTGCAGATTAAAGAGGAGAAAGGTACCATGGCTGACTCGCAACCCC 3', SEQ ID NO:16) and EcTD-2(5'AGCGGTTTCTTTACCAGACTCGAGTTAACCCGCCAAAAAGAACCTG 3', SEQ ID NO:17), respectively. After BamHI and XhoI double enzyme digestion is carried out on two DNA fragments obtained by PCR, a one-step homologous recombination method is adopted for connection to obtain a connection product CbFDH-EcTD of two gene fragments of CbFDH and EcTD in series connection, and agarose gel electrophoresis is carried out to verify that the length of the fragments is correct. Amplifying a fragment CbFDH-EcTD by using primers CbFDH-1(5'CCATCATCACCACAGCCAGGATCCAATGAAGATCGTGTTAGTCCTTTACGACG 3', SEQ ID NO:14) and EcTD-2(5'AGCGGTTTCTTTACCAGACTCGAGTTAACCCGCCAAAAAGAACCTG 3', SEQ ID NO:17), separating and purifying the CbFDH-EcTD fragment obtained by PCR through agarose gel electrophoresis, separating and purifying the recovered fragment through BamHI and XhoI double digestion, connecting the recovered fragment with a single promoter low-copy expression vector PETDuet-1 which is separated and purified through agarose gel electrophoresis after the same double digestion treatment through a one-step homologous recombination method, transforming a connecting product into JM109 competent cells through a chemical transformation method, culturing for 1h, coating the competent cells on an LB plate containing ampicillin for culturing for 10h, carrying out streak separation and culture on the grown colonies for 12h, and selecting a single colony for carrying out colony PCR to identify positive clones. And inoculating the positive clone into an LB culture medium, culturing at 37 ℃ for 12h, extracting a plasmid, carrying out SDS-PAGE detection after double enzyme digestion, and obtaining a detection result shown in figure 2. And (3) sequencing and verifying to construct a recombinant plasmid pETduet-CbFDH-EcTD.

Example 9: construction of plasmid pETduet-BtLeuDH-CbFDH-EcTD

Inoculating bacillus thuringiensis YBT-1520 to LB culture medium, culturing at 37 ℃ for 12h, collecting thalli, and extracting genome DNA by using a bacterial genome extraction kit. The gene BtLeu of leucine dehydrogenase was cloned from the genome with primers BtLeuDH-1(5'CATCATCACCACAGCCAGGATCCAATGACATTAGAAATCTTCGAATACTTAG 3', SEQ ID NO:12) and BtLeuDH-3(5'GTAAAGGACTAACACGATCTTCATGAGCTCTTTCTCCTCTTTGATATCTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:18), respectively. The pETduet-CbFDH-EcTD plasmid constructed in the embodiment 8 is subjected to single enzyme digestion by BamH1, separated and purified by agarose gel electrophoresis, the fragment is recovered and is subjected to one-step homologous recombination and connection with BtLeu fragment obtained by PCR amplification, the connection product is converted into JM109 competent cells by a chemical conversion method, the competent cells are cultured for 1h and then spread on an LB plate containing ampicillin for 10h, the grown colonies are streaked, separated and cultured for 12h, the single colonies are selected for colony PCR identification of positive clones, and the SDS-PAGE detection result is shown in figure 3. The positive clone is inoculated in LB culture medium, cultured for 12h at 37 ℃ and extracted into plasmid. And (3) constructing a recombinant plasmid pETduet-BtLeuDH-CbFDH-EcTD through sequencing verification.

Example 10: construction, expression, transformation and screening of simple substance granule recombinant bacteria

The plasmid pETduet-BtLeuDH-CbFDH-EcTD constructed in the example 9 is transformed into BL21 competent cells by a chemical transformation method, the competent cells are cultured for 1h and then spread on an LB plate containing ampicillin to be cultured for 10h, grown colonies are subjected to streak isolation culture for 12h, and three single colonies are selected and respectively inoculated into an LB liquid culture medium containing 100mg/L of ampicillin to be cultured with shaking at 37 ℃ and 200r/min overnight. Inoculating the overnight culture into TB culture medium containing 100mg/L ampicillin at 4%, shaking at 37 deg.C and 200r/min to culture bacterial solution OD600 ═ 0.6-0.8, adding inducer IPTG to obtain final concentration of 100mg/L, inducing at 25 deg.C and 200r/min for 10h, and centrifuging to collect thallus A1(BL 21/pETduet-BtLeuDH-CbFDH-TD), A2(BL 21/pETduet-BtLeuDH-CbFDH-TD) and A3(BL 21/pETduet-BtLeuDH-CbFDH-TD).

In a 20mL conversion system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD were added⁺20 mu mol/L PLP, 45g/L recombinant bacteria, and the conversion solution is NaH with pH of 8.0₂PO₄-Na₂HPO₄And (4) a buffer solution. And (3) converting in a constant-temperature shaking table at the temperature of 32-37 ℃, sampling at the rotating speed of 200r/min for 8-24h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography, wherein the conversion time is 18 h. As can be seen from Table 6, the best recombinant plasmid under these conditions was A2, the yield of L-2-aminobutyric acid was 36.2g/L, and the conversion rate was 83.5%.

Table 6 catalytic effect of recombinant bacteria.

Example 11: construction, expression, transformation and screening of double plasmid recombinant bacteria

The plasmid pRSFDuet-BtLeuDH obtained in example 7 and the plasmid pETduet-CbFDH-EcTD obtained in example 8 were transformed into BL21 competent cells simultaneously by chemical transformation, and after 1 hour of the post-culture, the cells were plated on LB plates containing ampicillin and kanamycin simultaneously and cultured for 10 hours, the grown colonies were streaked and isolated for 12 hours, and three single colonies were selected and inoculated into LB liquid medium containing 100mg/L ampicillin and 100mg/L kanamycin, respectively, and cultured overnight at 37 ℃ with shaking at 200 r/min. Inoculating the overnight culture in TB medium containing 100mg/L ampicillin and 100mg/L kanamycin at 4%, respectively, and culturing at 37 deg.C and 200r/min under shaking to obtain bacterial liquid OD₆₀₀Adding inducer IPTG to final concentration of 10 ═ 0.6-0.80mg/L, induction culture at 25 ℃ and 200r/min for 10h, and respectively centrifuging and collecting thalli B1(BL21/pRSFDuet-BtLeuDH + pETduet-CbFDH-EcTD), B2(BL21/pRSFDuet-BtLeuDH + pETduet-CbFDH-EcTD) and B3(BL21/pRSFDuet-BtLeuDH + pETduet-CbFDH-EcTD).

In a 20mL conversion system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD were added⁺20 mu mol/L PLP, 45g/L double-plasmid recombinant bacteria, and the conversion solution is NaH with pH of 8.0₂PO₄-Na₂HPO₄And (4) a buffer solution. And (3) converting in a constant-temperature shaking table at the temperature of 32-37 ℃, sampling at the rotation speed of 200r/min for 8-20h, completely converting for 10h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography. As can be seen from Table 7, the best recombinant plasmid under these conditions was B1, the yield of L-2-aminobutyric acid was 43.3g/L, and the conversion rate was 99.9% or more.

TABLE 7 catalytic Effect of Dual plasmid recombinant bacteria (pRSFDuet-BtLeuDH + pETduet-CbFDH-EcTD)

Comparative example 1: construction sequence Change of enzyme genes CbFDH and EcTD in plasmid pETduet-1

The tandem fragment EcTD-CbFDH obtained in the example 8 is amplified by primers EcTD-1(SEQ ID NO:16) and CbFDH-2(SEQ ID NO:15), the EcTD-CbFDH fragment obtained by PCR is separated and purified by agarose gel electrophoresis, the recovered fragment is subjected to double enzyme digestion by BamHI and XhoI, the recovered fragment and a single promoter low copy expression vector PETDuet-1 which is separated and purified and recovered by agarose gel electrophoresis after the same double enzyme digestion treatment are connected by a one-step homologous recombination method, the connection product is transformed into JM109 competent cells by a chemical transformation method, the competent cells are cultured for 1h and then spread on an LB plate containing ampicillin for 10h, the grown colony is streaked, separated and cultured for 12h, and the single colony is selected for colony PCR to identify positive clones. Inoculating the positive clone into an LB culture medium, culturing at 37 ℃ for 12h, extracting plasmids, performing double enzyme digestion, and performing SDS-PAGE detection. And (3) sequencing and verifying to construct a recombinant plasmid pETduet-EcTD-CbFDH.

The plasmid pETduet-EcTD-CbFDH and the plasmid pRSFDuet-BtLeuDH obtained in example 7 were transformed into BL21 competent cells simultaneously by the chemical transformation method, and then cultured for 1 hour, and spread on an LB plate containing ampicillin and kanamycin simultaneously to culture for 10 hours, and the grown colonies were streaked and isolated to culture for 12 hours, and three single colonies were selected and inoculated into LB liquid medium containing 100mg/L ampicillin and 100mg/L kanamycin respectively, and cultured overnight at 37 ℃ with shaking at 200 r/min. The overnight cultures were inoculated at 4% inoculum size into TB medium containing 100mg/L ampicillin and 100mg/L kanamycin, respectively, cultured with shaking at 37 ℃ and 200r/min until OD600 of the culture liquid became 0.6-0.8, added with inducer IPTG, cultured at a final concentration of 100mg/L and 25 ℃ and 200r/min for 10 hours, and centrifuged to collect cells C1(BL21/pRSFDuet-BtLeuDH + pETduet-EcTD-CbFDH), C2(BL21/pRSFDuet-BtLeuDH + pETduet-EcTD-CbFDH) and C3 (21/pRSFDuet-BtDH + pETBtD-CbFDH).

In a 20mL conversion system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD were added⁺20 mu mol/L PLP, 45g/L double-plasmid recombinant bacteria, and the conversion solution is NaH with pH of 8.0₂PO₄-Na₂HPO₄And (4) a buffer solution. And (3) converting in a constant-temperature shaking table at the temperature of 32-37 ℃, sampling within 8-20h at the rotating speed of 200r/min, completely converting within 14h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography. As can be seen from Table 8, under these conditions, the best recombinant plasmid was C3, the yield of L-2-aminobutyric acid was 35.8g/L, and the conversion rate reached 82.7%.

Compared with example 11, the connection sequence of CbFDH and EcTD is changed, so that the time for complete conversion is increased, and the yield and the conversion rate of L-2-aminobutyric acid are obviously reduced.

TABLE 8 catalytic Effect of Dual plasmid recombinant bacteria (pRSFDuet-BtLeuDH + pETduet-EcTD-CbFDH)

Comparative example 2: collocation of different plasmids and enzymes

The EcTD gene fragment obtained by PCR in example 8 was separated and purified by agarose gel electrophoresis, and the recovered fragment was digested with BamHI and XhoI, and then ligated with the recovered dual promoter high copy expression vector pRSFDuet-1, which was separated and purified by agarose gel electrophoresis after the same double digestion, by one-step homologous recombination. And (3) transforming the ligation product into JM109 competent cells by a chemical transformation method, culturing for 1h, coating the cells on an LB plate containing kanamycin, culturing for 10h, carrying out streak isolation culture on grown colonies for 12h, and selecting single colonies to carry out colony PCR (polymerase chain reaction) to identify positive clones. And inoculating the positive clone into an LB culture medium, culturing at 37 ℃ for 12h, extracting a plasmid, carrying out SDS-PAGE detection after double enzyme digestion, and obtaining a detection result shown in figure 3. And (5) carrying out sequencing verification to construct a recombinant plasmid pRSFDuet-EcTD.

The BtLeu gene fragment obtained by PCR in example 7 and the CbFDH gene fragment obtained by PCR in example 8 are respectively subjected to BamHI and XhoI double enzyme digestion, and then are connected by adopting a one-step homologous recombination method to obtain a connection product BtLeu-CbFDH in which the BtLeu and CbFDH gene fragments are connected in series, and the fragment length is verified to be correct by agarose gel electrophoresis. Respectively amplifying a segment BtLeu-CbFDH by primers BtLeu-1(SEQ ID NO:12) and CbFDH-2(SEQ ID NO:15), carrying out agarose gel electrophoresis separation and purification on the BtLeu-CbFDH segment obtained by PCR, carrying out double enzyme digestion on the recovered segment by BamHI and XhoI, connecting the recovered segment with a single-promoter low-copy expression vector PETDuet-1 which is subjected to the same double enzyme digestion treatment and then is separated and purified by agarose gel electrophoresis to recover a product, transforming the product of the connection into a JM109 competent cell by a chemical transformation method, culturing for 1h, coating the competent cell on an LB plate containing ampicillin, culturing for 10h, carrying out streak separation and culture on the grown colony for 12h, and selecting a single colony to carry out colony PCR to identify positive clones. And inoculating the positive clone into an LB culture medium, culturing at 37 ℃ for 12h, extracting a plasmid, carrying out SDS-PAGE detection after double enzyme digestion, and obtaining a detection result shown in figure 3. And (3) sequencing and verifying to construct a recombinant plasmid pETduet-BtLeu-CbFDH.

The plasmid pRSFDuet-EcTD and the plasmid pETduet-BtLeu-CbFDH are simultaneously transformed into BL21 competent cells by a chemical transformation method, the competent cells are cultured for 1h and then spread on an LB plate containing ampicillin and kanamycin simultaneously for 10h, the grown colonies are streaked, separated and cultured for 12h, three single colonies are selected and respectively inoculated into an LB liquid culture medium containing 100mg/L of ampicillin and 100mg/L of kanamycin, and the LB liquid culture medium is shaken at 37 ℃ and 200r/min for overnight culture. The overnight cultures were inoculated at 4% inoculum size into TB medium containing 100mg/L ampicillin and 100mg/L kanamycin, respectively, shake-cultured at 37 ℃ and 200r/min until the OD600 of the culture liquid became 0.6-0.8, added with inducer IPTG, induced-cultured at 25 ℃ and 200r/min for 10 hours to a final concentration of 100mg/L, and centrifuged to collect D1(BL21/pRSFDuet-EcTD + pETduet-BtLeu-CbFDH), D2(BL21/pRSFDuet-EcTD + pETduet-BtLeu-CbFDH), and D3(BL21/pRSFDuet-EcTD + pETduet-BtLeu-CbFDH).

In a 20mL conversion system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD were added⁺20 mu mol/L PLP, 45g/L double-plasmid recombinant bacteria, and the conversion solution is NaH with pH of 8.0₂PO₄-Na₂HPO₄And (4) a buffer solution. And (3) converting in a constant-temperature shaking table at the temperature of 32-37 ℃, sampling at the rotation speed of 200r/min for 8-20h, completely converting for 16h, and detecting the yield of the 2-aminobutyric acid by using a high performance liquid chromatography. As can be seen from Table 9, the best recombinant plasmid D1 was obtained under these conditions, the yield of L-2-aminobutyric acid was 30.8g/L, and the conversion rate was 71.1%.

Compared with example 11, the recombinant bacterium obtained in the comparative example has longer transformation time in the process of producing L-2-aminobutyric acid by transforming L-threonine, and the yield and the transformation rate of the L-2-aminobutyric acid are obviously reduced.

TABLE 9 catalytic Effect of Dual plasmid recombinant bacteria (pRSFDuet-EcTD + pETduet-BtLeu-CbFDH)

Comparative example 3 recombination of Dual plasmid recombinant bacteria Using formate dehydrogenase Gene not optimized by codons

In this comparative example, the formate dehydrogenase gene was used as an unoptimized gene and designated CbFDH⁰The double plasmid recombinant strain pRSFDuet-BtLeuDH + pETduet-CbFDH0-EcTD was constructed according to the methods of examples 7, 8 and 11, and the transformation was carried out under the same conditions, sampling was carried out for 8-20 hours, the transformation was completed for 12 hours, and the yield of 2-aminobutyric acid was determined by high performance liquid chromatography. As can be seen from Table 10, under these conditions, the best recombinant plasmid was E1, the yield of L-2-aminobutyric acid was 36.8g/L, and the conversion rate was 88.6%.

Compared with example 11, the recombinant bacterium constructed by the FDH gene without codon optimization in the comparative example has longer conversion time and obviously reduced L-2-aminobutyric acid yield and conversion rate in the process of producing L-2-aminobutyric acid by converting L-threonine.

TABLE 10 double plasmid recombinant bacteria (pRSFDuet-BtLeuDH + pETduet-CbFDH)⁰-EcTD) catalytic Effect

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> construction and application of recombinant bacterium for producing L-2-aminobutyric acid by converting L-threonine

<160> 18

<170> PatentIn version 3.3

<210> 1

<211> 1545

<212> DNA

<213> Escherichia coli W3110

<400> 1

atggctgact cgcaacccct gtccggtgct ccggaaggtg ccgaatattt aagagcagtg 60

ctgcgcgcgc cggtttacga ggcggcgcag gttacgccgc tacaaaaaat ggaaaaactg 120

tcgtcgcgtc ttgataacgt cattctggtg aagcgcgaag atcgccagcc agtgcacagc 180

tttaagctgc gcggcgcata cgccatgatg gcgggcctga cggaagaaca gaaagcgcac 240

ggcgtgatca ctgcttctgc gggtaaccac gcgcagggcg tcgcgttttc ttctgcgcgg 300

ttaggcgtga aggccctgat cgttatgcca accgccaccg ccgacatcaa agtcgacgcg 360

gtgcgcggct tcggcggcga agtgctgctc cacggcgcga actttgatga agcgaaagcc 420

aaagcgatcg aactgtcaca gcagcagggg ttcacctggg tgccgccgtt cgaccatccg 480

atggtgattg ccgggcaagg cacgctggcg ctggaactgc tccagcagga cgcccatctc 540

gaccgcgtat ttgtgccagt cggcggcggc ggtctggctg ctggcgtggc ggtgctgatc 600

aaacaactga tgccgcaaat caaagtgatc gccgtagaag cggaagactc cgcctgcctg 660

aaagcagcgc tggatgcggg tcatccggtt gatctgccgc gcgtagggct atttgctgaa 720

ggcgtagcgg taaaacgcat cggtgacgaa accttccgtt tatgccagga gtatctcgac 780

gacatcatca ccgtcgatag cgatgcgatc tgtgcggcga tgaaggattt attcgaagat 840

gtgcgcgcgg tggcggaacc ctctggcgcg ctggcgctgg cgggaatgaa aaaatatatc 900

gccctgcaca acattcgcgg cgaacggctg gcgcatattc tttccggtgc caacgtgaac 960

ttccacggcc tgcgctacgt ctcagaacgc tgcgaactgg gcgaacagcg tgaagcgttg 1020

ttggcggtga ccattccgga agaaaaaggc agcttcctca aattctgcca actgcttggc 1080

gggcgttcgg tcaccgagtt caactaccgt tttgccgatg ccaaaaacgc ctgcatcttt 1140

gtcggtgtgc gcctgagccg cggcctcgaa gagcgcaaag aaattttgca gatgctcaac 1200

gacggcggct acagcgtggt tgatctctcc gacgacgaaa tggcgaagct acacgtgcgc 1260

tatatggtcg gcggacgtcc atcgcatccg ttgcaggaac gcctctacag cttcgaattc 1320

ccggaatcac cgggcgcgct gctgcgcttc ctcaacacgc tgggtacgta ctggaacatt 1380

tctttgttcc actatcgcag ccatggcacc gactacgggc gcgtactggc ggcgttcgaa 1440

cttggcgacc atgaaccgga tttcgaaacc cggctgaatg agctgggcta cgattgccac 1500

gacgaaacca ataacccggc gttcaggttc tttttggcgg gttaa 1545

<210> 2

<211> 1101

<212> DNA

<213> Bacillus thuringiensis YBT-1520

<400> 2

atgacattag aaatcttcga atacttagaa aaatatgatt atgagcaagt agtattttgt 60

caagataaag aatctggttt aaaagcaatt attgcaattc atgatacaac acttggaccg 120

gctcttggtg gaacaagaat gtggacatat gattctgaag aagcggcgat tgaagatgca 180

ttgcgtcttg caaaagggat gacatataaa aacgcagcag ctggtttaaa cttaggtggt 240

gcgaaaacag taattatcgg tgatcctcgt aaagataaga gcgaagcaat gttccgtgca 300

ctaggacgtt atatccaagg actaaacgga cgttacatta cagctgaaga tgttggtaca 360

acagtagatg atatggatat tatccatgaa gaaactgact ttgtaacagg tatctcacca 420

tcattcggtt cttctggtaa cccatctcca gtaactgcat acggtgttta ccgtggtatg 480

aaagcagctg caaaagaagc tttcggtact gacaatttag aaggaaaagt aattgctgtt 540

caaggcgttg gtaacgtagc atatcaccta tgcaaacatt tacacgctga aggagcaaaa 600

ttaatcgtta cagatattaa taaagaagct gtacaacgtg ctgtagaaga attcggtgca 660

tcagcagttg aaccaaatga aatttatggt gttgaatgcg atatttacgc accatgtgca 720

ttaggcgcaa cagttaatga tgaaactatt ccacaactta aagcaaaagt aatcgcaggt 780

tctgcaaata accaattaaa agaaaatcgt cacggtgaca tcattcatga aatgggtatt 840

gtatacgcac cagattatgt aattaatgca ggtggcgtaa ttaacgtagc agacgaatta 900

tatggataca atagagaacg tgcactaaaa cgtgttgagt ctatttatga cacaattgca 960

aaagtaatcg aaatttcaaa acgcgatggc atagcaactt atgtagcggc agatcgtcta 1020

gctgaagagc gcattgcaag cttgaaaaat tctcgtagca cttacttacg caacggtcac 1080

gatattatta gccgtcgcta a 1101

<210> 3

<211> 1098

<212> DNA

<213> Candida protogene

<400> 3

atgaagatcg tgttagtcct ttacgacgca ggaaagcatg ccgcggacga ggaaaagtta 60

tacggatgta ccgaaaataa acttggtatc gcgaattggc ttaaagatca aggccatgag 120

ctgattacta ccagtgataa agaaggcggg aacagtgttt tagaccaaca tatcccagac 180

gcggatatta tcattaccac cccgtttcac ccggcttata tcacgaagga gcgtattgat 240

aaagccaaga agttgaagct ggtggtagtc gccggggttg gtagtgacca catcgactta 300

gactatatca accaaactgg taaaaaaatt agtgttttgg aagttactgg atcaaacgta 360

gtgtccgtgg ccgaacatgt tgtaatgacg atgctggtgc ttgttcgcaa ctttgtgccc 420

gcgcacgagc aaattattaa ccatgactgg gaagtcgctg ctattgcgaa agacgcttac 480

gatatcgaag ggaagactat tgcaaccatt ggtgccggtc gcatcggtta ccgcgtgtta 540

gagcgccttg tcccgtttaa ccctaaggaa cttttgtatt atgactatca agcgctgcca 600

aaggacgcgg aggagaaagt gggagctcgc cgcgtagaga atatcgagga gttagtagcc 660

caggcggata tcgttactgt aaacgcccct ttgcacgccg gaactaaggg cctgattaat 720

aaagagttat taagcaaatt taagaaggga gcttggttag tcaacactgc tcgcggtgct 780

atttgtgtgg cagaggatgt tgctgctgct ttggaatcag ggcagttacg tggatacggt 840

ggtgatgttt ggttccctca accagcgccg aaagaccacc cgtggcgcga catgcgtaat 900

aagtatgggg cagggaacgc tatgacgccg cactattctg gcactacatt ggatgcgcag 960

acacgttacg ctcaagggac taaaaacatt ttggagtctt tcttcaccgg taagttcgat 1020

taccgccctc aagatatcat tcttttgaat ggagaatacg tcacaaaggc ctacgggaaa 1080

cacgataaaa aataataa 1098

<210> 4

<211> 1098

<212> DNA

<213> Artificial sequence

<400> 4

atgaaaattg tgctggtgct gtatgatgcg ggcaaacatg cggcggatga agaaaaactg 60

tatggctgca ccgaaaataa actgggcatt gcgaactggc tgaaagatca gggccatgaa 120

ctgattacca cctctgataa agaaggcggc aacagcgttc tggatcagca tattccggat 180

gcggatatta ttattaccac cccgtttcat ccggcgtata tcaccaaaga acgcatcgat 240

aaagcgaaaa aactgaaact ggtggtggtg gcgggcgtgg gcagcgatca tattgatctg 300

gattatatca accagaccgg taaaaaaatt agcgtgctgg aagtgaccgg cagcaacgtg 360

gtgagcgtgg cggaacatgt ggtgatgacc atgctggtgc tggtgcgtaa ctttgtgccg 420

gcgcatgaac aaattattaa ccacgattgg gaagtggcgg cgattgcgaa agatgcgtat 480

gatatcgaag gcaaaaccat tgcgaccatt ggcgcgggtc gtattggcta tcgtgtgctg 540

gaacgtctgg tgccgtttaa tccgaaagaa ctgctgtatt atgattatca ggcgctgccg 600

aaagatgcgg aagaaaaagt gggtgcgcgt cgtgtggaaa acattgaaga actggtggcg 660

caggcggata ttgtgaccgt gaacgcgccg ctgcatgcgg gcaccaaagg cctgatcaac 720

aaagagctgc tgtctaagtt taaaaaaggc gcgtggctgg tgaataccgc gcgtggcgcg 780

atttgcgtgg ccgaagatgt tgcggcggcg ctggaaagcg gtcagctgcg tggctatggc 840

ggtgatgtgt ggtttccgca gccggcgccg aaagatcatc cgtggcgtga tatgcgtaac 900

aaatatggcg cgggtaacgc catgaccccg cattatagcg gcaccaccct ggatgcgcag 960

acccgttatg cgcagggcac caaaaacatt ctggaaagct ttttcaccgg caaatttgat 1020

tatcgtccgc aggacattat tctgctgaac ggcgaatatg tgaccaaagc gtatggcaaa 1080

cacgataaaa aataataa 1098

<210> 5

<211> 514

<212> PRT

<213> Escherichia coli W3110

<400> 5

Met Ala Asp Ser Gln Pro Leu Ser Gly Ala Pro Glu Gly Ala Glu Tyr

1 5 10 15

Leu Arg Ala Val Leu Arg Ala Pro Val Tyr Glu Ala Ala Gln Val Thr

20 25 30

Pro Leu Gln Lys Met Glu Lys Leu Ser Ser Arg Leu Asp Asn Val Ile

35 40 45

Leu Val Lys Arg Glu Asp Arg Gln Pro Val His Ser Phe Lys Leu Arg

50 55 60

Gly Ala Tyr Ala Met Met Ala Gly Leu Thr Glu Glu Gln Lys Ala His

65 70 75 80

Gly Val Ile Thr Ala Ser Ala Gly Asn His Ala Gln Gly Val Ala Phe

85 90 95

Ser Ser Ala Arg Leu Gly Val Lys Ala Leu Ile Val Met Pro Thr Ala

100 105 110

Thr Ala Asp Ile Lys Val Asp Ala Val Arg Gly Phe Gly Gly Glu Val

115 120 125

Leu Leu His Gly Ala Asn Phe Asp Glu Ala Lys Ala Lys Ala Ile Glu

130 135 140

Leu Ser Gln Gln Gln Gly Phe Thr Trp Val Pro Pro Phe Asp His Pro

145 150 155 160

Met Val Ile Ala Gly Gln Gly Thr Leu Ala Leu Glu Leu Leu Gln Gln

165 170 175

Asp Ala His Leu Asp Arg Val Phe Val Pro Val Gly Gly Gly Gly Leu

180 185 190

Val Ala Gly Val Ala Val Leu Ile Lys Gln Leu Met Pro Gln Ile Lys

195 200 205

Val Ile Ala Val Glu Ala Glu Asp Ser Ala Cys Leu Lys Ala Ala Leu

210 215 220

Asp Ala Gly His Pro Val Asp Leu Pro Arg Val Gly Leu Phe Ala Glu

225 230 235 240

Gly Val Ala Val Lys Arg Ile Gly Asp Glu Thr Phe Arg Leu Cys Gln

245 250 255

Glu Tyr Leu Asp Asp Ile Ile Thr Val Asp Ser Asp Ala Ile Cys Ala

260 265 270

Ala Met Lys Asp Leu Phe Glu Asp Val Arg Ala Val Ala Glu Pro Ser

275 280 285

Gly Ala Leu Ala Leu Ala Gly Met Lys Lys Tyr Ile Ala Leu His Asn

290 295 300

Ile Arg Gly Glu Arg Leu Ala His Ile Leu Ser Gly Ala Asn Val Asn

305 310 315 320

Phe His Gly Leu Arg Tyr Val Ser Glu Arg Cys Glu Leu Gly Glu Gln

325 330 335

Arg Glu Ala Leu Leu Ala Val Thr Ile Pro Glu Glu Lys Gly Ser Phe

340 345 350

Leu Lys Phe Cys Gln Leu Leu Gly Gly Arg Ser Val Thr Glu Phe Asn

355 360 365

Tyr Arg Phe Ala Asp Ala Lys Asn Ala Cys Ile Phe Val Gly Val Arg

370 375 380

Leu Ser Arg Gly Leu Glu Glu Arg Lys Glu Ile Leu Gln Met Leu Asn

385 390 395 400

Asp Gly Gly Tyr Ser Val Val Asp Leu Ser Asp Asp Glu Met Ala Lys

405 410 415

Leu His Val Arg Tyr Met Val Gly Gly Arg Pro Ser His Pro Leu Gln

420 425 430

Glu Arg Leu Tyr Ser Phe Glu Phe Pro Glu Ser Pro Gly Ala Leu Leu

435 440 445

Arg Phe Leu Asn Thr Leu Gly Thr Tyr Trp Asn Ile Ser Leu Phe His

450 455 460

Tyr Arg Ser His Gly Thr Asp Tyr Gly Arg Val Leu Ala Ala Phe Glu

465 470 475 480

Leu Gly Asp His Glu Pro Asp Phe Glu Thr Arg Leu Asn Glu Leu Gly

485 490 495

Tyr Asp Cys His Asp Glu Thr Asn Asn Pro Ala Phe Arg Phe Phe Leu

500 505 510

Ala Gly

<210> 6

<211> 366

<212> PRT

<213> Bacillus thuringiensis YBT-1520

<400> 6

Met Thr Leu Glu Ile Phe Glu Tyr Leu Glu Lys Tyr Asp Tyr Glu Gln

1 5 10 15

Val Val Phe Cys Gln Asp Lys Glu Ser Gly Leu Lys Ala Ile Ile Ala

20 25 30

Ile His Asp Thr Thr Leu Gly Pro Ala Leu Gly Gly Thr Arg Met Trp

35 40 45

Thr Tyr Asp Ser Glu Glu Ala Ala Ile Glu Asp Ala Leu Arg Leu Ala

50 55 60

Lys Gly Met Thr Tyr Lys Asn Ala Ala Ala Gly Leu Asn Leu Gly Gly

65 70 75 80

Ala Lys Thr Val Ile Ile Gly Asp Pro Arg Lys Asp Lys Ser Glu Ala

85 90 95

Met Phe Arg Ala Leu Gly Arg Tyr Ile Gln Gly Leu Asn Gly Arg Tyr

100 105 110

Ile Thr Ala Glu Asp Val Gly Thr Thr Val Asp Asp Met Asp Ile Ile

115 120 125

His Glu Glu Thr Asp Phe Val Thr Gly Ile Ser Pro Ser Phe Gly Ser

130 135 140

Ser Gly Asn Pro Ser Pro Val Thr Ala Tyr Gly Val Tyr Arg Gly Met

145 150 155 160

Lys Ala Ala Ala Lys Glu Ala Phe Gly Thr Asp Asn Leu Glu Gly Lys

165 170 175

Val Ile Ala Val Gln Gly Val Gly Asn Val Ala Tyr His Leu Cys Lys

180 185 190

His Leu His Ala Glu Gly Ala Lys Leu Ile Val Thr Asp Ile Asn Lys

195 200 205

Glu Ala Val Gln Arg Ala Val Glu Glu Phe Gly Ala Ser Ala Val Glu

210 215 220

Pro Asn Glu Ile Tyr Gly Val Glu Cys Asp Ile Tyr Ala Pro Cys Ala

225 230 235 240

Leu Gly Ala Thr Val Asn Asp Glu Thr Ile Pro Gln Leu Lys Ala Lys

245 250 255

Val Ile Ala Gly Ser Ala Asn Asn Gln Leu Lys Glu Asn Arg His Gly

260 265 270

Asp Ile Ile His Glu Met Gly Ile Val Tyr Ala Pro Asp Tyr Val Ile

275 280 285

Asn Ala Gly Gly Val Ile Asn Val Ala Asp Glu Leu Tyr Gly Tyr Asn

290 295 300

Arg Glu Arg Ala Leu Lys Arg Val Glu Ser Ile Tyr Asp Thr Ile Ala

305 310 315 320

Lys Val Ile Glu Ile Ser Lys Arg Asp Gly Ile Ala Thr Tyr Val Ala

325 330 335

Ala Asp Arg Leu Ala Glu Glu Arg Ile Ala Ser Leu Lys Asn Ser Arg

340 345 350

Ser Thr Tyr Leu Arg Asn Gly His Asp Ile Ile Ser Arg Arg

355 360 365

<210> 7

<211> 364

<212> PRT

<213> Artificial sequence

<400> 7

Met Lys Ile Val Leu Val Leu Tyr Asp Ala Gly Lys His Ala Ala Asp

1 5 10 15

Glu Glu Lys Leu Tyr Gly Cys Thr Glu Asn Lys Leu Gly Ile Ala Asn

20 25 30

Trp Leu Lys Asp Gln Gly His Glu Leu Ile Thr Thr Ser Asp Lys Glu

35 40 45

Gly Gly Asn Ser Val Leu Asp Gln His Ile Pro Asp Ala Asp Ile Ile

50 55 60

Ile Thr Thr Pro Phe His Pro Ala Tyr Ile Thr Lys Glu Arg Ile Asp

65 70 75 80

Lys Ala Lys Lys Leu Lys Leu Val Val Val Ala Gly Val Gly Ser Asp

85 90 95

His Ile Asp Leu Asp Tyr Ile Asn Gln Thr Gly Lys Lys Ile Ser Val

100 105 110

Leu Glu Val Thr Gly Ser Asn Val Val Ser Val Ala Glu His Val Val

115 120 125

Met Thr Met Leu Val Leu Val Arg Asn Phe Val Pro Ala His Glu Gln

130 135 140

Ile Ile Asn His Asp Trp Glu Val Ala Ala Ile Ala Lys Asp Ala Tyr

145 150 155 160

Asp Ile Glu Gly Lys Thr Ile Ala Thr Ile Gly Ala Gly Arg Ile Gly

165 170 175

Tyr Arg Val Leu Glu Arg Leu Val Pro Phe Asn Pro Lys Glu Leu Leu

180 185 190

Tyr Tyr Asp Tyr Gln Ala Leu Pro Lys Asp Ala Glu Glu Lys Val Gly

195 200 205

Ala Arg Arg Val Glu Asn Ile Glu Glu Leu Val Ala Gln Ala Asp Ile

210 215 220

Val Thr Val Asn Ala Pro Leu His Ala Gly Thr Lys Gly Leu Ile Asn

225 230 235 240

Lys Glu Leu Leu Ser Lys Phe Lys Lys Gly Ala Trp Leu Val Asn Thr

245 250 255

Ala Arg Gly Ala Ile Cys Val Ala Glu Asp Val Ala Ala Ala Leu Glu

260 265 270

Ser Gly Gln Leu Arg Gly Tyr Gly Gly Asp Val Trp Phe Pro Gln Pro

275 280 285

Ala Pro Lys Asp His Pro Trp Arg Asp Met Arg Asn Lys Tyr Gly Ala

290 295 300

Gly Asn Ala Met Thr Pro His Tyr Ser Gly Thr Thr Leu Asp Ala Gln

305 310 315 320

Thr Arg Tyr Ala Gln Gly Thr Lys Asn Ile Leu Glu Ser Phe Phe Thr

325 330 335

Gly Lys Phe Asp Tyr Arg Pro Gln Asp Ile Ile Leu Leu Asn Gly Glu

340 345 350

Tyr Val Thr Lys Ala Tyr Gly Lys His Asp Lys Lys

355 360

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence

<400> 8

cgggatccat ggctgactcg caacccctg 29

<210> 9

<211> 34

<212> DNA

<213> Artificial sequence

<400> 9

cccaagcttc taacccgcca aaaagaacct gaac 34

<210> 10

<211> 26

<212> DNA

<213> Artificial sequence

<400> 10

cgggatccat gcgcgttatg gtcttg 26

<210> 11

<211> 33

<212> DNA

<213> Artificial sequence

<400> 11

cccaagcttt tagcgacggc taataatatc gtg 33

<210> 12

<211> 52

<212> DNA

<213> Artificial sequence

<400> 12

catcatcacc acagccagga tccaatgaca ttagaaatct tcgaatactt ag 52

<210> 13

<211> 47

<212> DNA

<213> Artificial sequence

<400> 13

gcggtttctt taccagactc gagttagcga cggctaataa tatcgtg 47

<210> 14

<211> 53

<212> DNA

<213> Artificial sequence

<400> 14

ccatcatcac cacagccagg atccaatgaa gatcgtgtta gtcctttacg acg 53

<210> 15

<211> 55

<212> DNA

<213> Artificial sequence

<400> 15

ggtacctttc tcctctttaa tctgcagtta ttatttttta tcgtgtttcc cgtag 55

<210> 16

<211> 46

<212> DNA

<213> Artificial sequence

<400> 16

ctgcagatta aagaggagaa aggtaccatg gctgactcgc aacccc 46

<210> 17

<211> 46

<212> DNA

<213> Artificial sequence

<400> 17

agcggtttct ttaccagact cgagttaacc cgccaaaaag aacctg 46

<210> 18

<211> 72

<212> DNA

<213> Artificial sequence

<400> 18

gtaaaggact aacacgatct tcatgagctc tttctcctct ttgatatctt agcgacggct 60

aataatatcg tg 72

Claims

1. The recombinant bacterium for producing the L-2-aminobutyric acid by transforming the L-threonine is characterized in that the recombinant bacterium takes escherichia coli as a host, and a dual-plasmid expression system expresses threonine deaminase, formate dehydrogenase and leucine dehydrogenase, wherein the dual-plasmid expression system comprises a PETDuet-1 plasmid and a pRSFDuet-1 plasmid; the PETDuet-1 plasmid is used for expressing threonine deaminase and formate dehydrogenase, and the pRSFDuet-1 plasmid is used for expressing leucine dehydrogenase; the formate dehydrogenase and the threonine deaminase are connected in sequence on a PETDuet-1 plasmid; the threonine deaminase is selected from escherichia coli, and the leucine dehydrogenase is selected from bacillus thuringiensis; the formate dehydrogenase is selected from candida; the formate dehydrogenase is optimized by a codon, the optimized nucleotide sequence is shown as SEQ ID NO. 4, and the amino acid sequence is shown as SEQ ID NO. 7; the amino acid sequence of the threonine deaminase is SEQ ID NO. 5; the amino acid sequence of the leucine dehydrogenase is SEQ ID NO 6.

2. The recombinant bacterium for producing L-2-aminobutyric acid by transforming L-threonine according to claim 1, wherein the host is E.coli BL 21.

3. A method for producing L-2-aminobutyric acid by converting L-threonine, which is characterized in that a substrate is converted into the L-2-aminobutyric acid by using the recombinant bacterium of any one of claims 1 to 2, and a coenzyme regeneration system is coupled.

4. The method for producing L-2-aminobutyric acid by converting L-threonine according to claim 3, wherein the coenzyme regeneration system uses ammonium formate as a substrate, and NAD is converted by formate dehydrogenase⁺Coenzyme regeneration system for conversion to NADH.

5. The method for producing L-2-aminobutyric acid by converting L-threonine according to claim 4, wherein the concentration of L-threonine in the substrate is 30-40 g/L, the concentration of ammonium formate is 10-30 g/L, and NAD (nicotinamide adenine dinucleotide) is added⁺The concentration is 0.4-1.0 g/L, the recombinant bacteria are added in the form of bacterial liquid after being cultured, the transformation temperature is 30-40 ℃, and the transformation pH is 7.0-8.5.

6. The method for producing L-2-aminobutyric acid by converting L-threonine according to claim 5, wherein the bacterial liquid is prepared by collecting bacteria centrifugally and dissolving the bacteria in a solution with a pH of 7.0-8.NaH of 5₂PO₄-Na₂HPO₄Buffer solution, the addition amount of the bacterial liquid is 30-50 g/L.

7. Use of the recombinant bacterium of any one of claims 1-2 for the production of L-2-aminobutyric acid by transformation of L-threonine.