CN109266595A

CN109266595A - A kind of building and application of the recombinant bacterium of conversion L-threonine production C4H9NO2

Info

Publication number: CN109266595A
Application number: CN201811119484.6A
Authority: CN
Inventors: 刘立明; 张君轩; 付妍; 刘佳; 宋伟; 张灿
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2018-09-25
Filing date: 2018-09-25
Publication date: 2019-01-25
Anticipated expiration: 2038-09-25
Also published as: CN109266595B

Abstract

The invention discloses the buildings and application of a kind of recombinant bacterium of conversion L-threonine production C4H9NO2, belong to technical field of bioengineering.Production method of the present invention utilizes a kind of recombinant bacterium for expressing double-mass model, the high efficient expression of three kinds of enzymes is realized simultaneously, C4H9NO2 is converted by L-threonine, and it is coupled a Cofactor Regeneration Systems, by converting NADH for NAD+, so that NADH concentration in system is relatively stable, conversion can be carried out efficiently.Further, the ammonium hydroxide generated in transformation system is dissolved in by the CO2 that ammonium formate is transformed in the process, environmental pollution is small, there is industrial application value.This method has many advantages, such as that conversion condition is mild, specificity is strong, low in cost, transformation time is short.C4H9NO2 is prepared using this method, puts into 40g/L L-threonine, the concentration of products therefrom C4H9NO2 is 43.3g/L, and conversion ratio is up to 99.9% or more.

Description

A kind of building and application of the recombinant bacterium of conversion L-threonine production C4H9NO2

Technical field

The present invention relates to the buildings and application of a kind of recombinant bacterium of conversion L-threonine production C4H9NO2, belong to life Object field of engineering technology.

Background technique

C4H9NO2 is a kind of Non-natural chiral amino acid, has and inhibits the transmitting of human nerve information, reinforces grape The activity of sugar phosphate enzyme and the effect for promoting brain cell metabolism.Simultaneously 2-amino-butyric acid be also a kind of important industrial chemicals and Medicine intermediate is widely used in the synthesis of drug, as antituberculotic ebutol and the left second of antiepileptic draw west Smooth synthesis.

Currently, the synthetic method of C4H9NO2 includes chemical method and bioanalysis.Chemical method mainly include ketone butyric acid also Former method, desulphurization reaction method, ammonolysis reaction method, halogenated ammonolysis process, chemical resolution method etc..But such method severe reaction conditions, By-product easily generated；Higher cost should not carry out industrial production；Environmental pollution largely is easily caused using organic solvent simultaneously.

Bioanalysis synthesis C4H9NO2 has the characteristics that stereoselectivity is high, reaction condition is mild, low in the pollution of the environment, With wide industrialized developing prospect.Bioanalysis includes microbe fermentation method and exoenzyme conversion method again.Microbial fermentation Method specificity is stronger, and mild condition is low in the pollution of the environment, but fermentation process can generate by-product similar with target product structure, Reaction product complicated component, later separation are difficult.Enzymatic conversion is then a kind of highly selective reaction, can reach orientation conversion Purpose.But multienzyme conversion process is faced with more, and enzyme activity is low, enzyme stability is low, the addition of coenzyme circular regeneration low efficiency, multienzyme is multiple Miscellaneous, engineering amplifies the problems such as difficult.And the full cell of recombinant bacterium participates in conversion and can solve the above problems to a certain extent, but there are still The problems such as transformation time is long, changing effect is poor.

Summary of the invention

It is an object of the invention to overcome the problems, such as in current production technology, a kind of high-efficient simple is provided, low cost, is easy to The method that the conversion L-threonine of industrialized production prepares C4H9NO2.

Present invention firstly provides a kind of recombinant bacterium of conversion L-threonine production C4H9NO2, the recombinant bacterium is It is host with Escherichia coli, double-plasmid expression system expresses threonine deaminase, hydrogenlyase, leucine dehydrogenase, described Double-plasmid expression system includes PETDuet-1 plasmid and pRSFDuet-1 plasmid.

In one embodiment of the invention, the PETDuet-1 plasmid is de- for expressing threonine deaminase, formic acid Hydrogen enzyme, the pRSFDuet-1 plasmid is for expressing leucine dehydrogenase.

In one embodiment of the invention, the threonine deaminase is selected from Escherichia coli, preferably Escherichia coli Escherichia coli W3110, gene order are SEQ ID NO:1, and amino acid sequence is SEQ ID NO:5.

In one embodiment of the invention, the leucine dehydrogenase is selected from bacillus thuringiensis, preferably Su Yun Golden bacillus thuringiensis serovar kurstaki YBT-1520, gene order are SEQ ID NO:2, amino acid sequence are SEQ ID NO:6.

In one embodiment of the invention, the hydrogenlyase is selected from Candida.

In one embodiment of the invention, it is preferred that nucleotide after the hydrogenlyase codon optimization Sequence is as shown in SEQ ID NO:4, and amino acid sequence is as shown in SEQ ID NO:7.

In one embodiment of the invention, the host is preferably E.coli BL21 (DE3).

The present invention also provides a kind of methods of conversion L-threonine production C4H9NO2, and the method is using upper The recombinant bacterium for the conversion L-threonine production C4H9NO2 stated converts a substrate into C4H9NO2, and coupled cofactor is again Raw body system.

In one embodiment of the invention, the Cofactor Regeneration Systems pass through formate dehydrogenase using ammonium formate as substrate Enzyme is by NAD⁺It is converted into the regenerating coenzyme system of NADH.

In one embodiment of the invention, L-threonine concentration is 30~40g/L, formic acid ammonium concentration in the substrate For 10~30g/L, NAD⁺Concentration is 0.4~1.0g/L, and the recombinant bacterium is added in the form of bacterium solution after cultivation, conversion temperature It is 30~40 DEG C, conversion pH is 7.0~8.5.

In one embodiment of the invention, the time of the conversion is 8-12h.

In one embodiment of the invention, the preparation method of the bacterium solution is to be dissolved in pH after thalline were collected by centrifugation to be 7.0~8.5 NaH₂PO₄-Na₂HPO₄Buffer, the additive amount of thallus are 30~50g/L.

The invention has the benefit that

(1) in the method provided by the present invention using recombinant bacterium conversion L-threonine production C4H9NO2, conversion Substrate is cheap natural amino acid L-threonine, three kinds of enzymes can in a kind of recombinant bacterium high efficient expression simultaneously, it is described heavy Group bacterium can mass propgation, be not required to by treatment processes such as clasmatosis, freeze-dryings, cost is relatively low and easy to operate, can establish One efficient, low cost, the biological enzyme synthesis technology for being easy to industrial amplification production.

(2) production method of the present invention utilizes coenzyme during converting C4H9NO2 for intermediate product Regenerating system, by by NAD⁺It is converted into NADH, so that NADH concentration in system is relatively stable, conversion can be carried out efficiently.

(3) CO being transformed in the process by ammonium formate₂The ammonium hydroxide generated in transformation system is dissolved in, to environment dirt It contaminates small, there is industrial application value.

(4) this method has many advantages, such as that specificity is strong, substrate is at low cost, product optical purity is high, is prepared using this method C4H9NO2 adds threonine 40g/L, and C4H9NO2 yield is 46g/L, and conversion ratio removes this up to 99.9% or more Except, the transformation time of recombinant bacterium of the invention only needs 8-12h, that is, can reach 99% or more conversion ratio, transformation time section and High conversion efficiency.

Detailed description of the invention

Fig. 1: the reaction principle figure of conversion L-threonine production C4H9NO2.

The SDS-PAGE egg of double digestion after Fig. 2: plasmid pRSFDuet-BtLeuDH and pETduet-CbFDH-EcTD expression White detection figure.

The SDS-PAGE Protein Detection figure of bacterium colony PCR after Fig. 3: plasmid pETduet-BtLeuDH-CbFDH-EcTD expression.

Specific embodiment

Following case study on implementation is all using routine experiment method, and experimental material can obtain from commercial channels.

Sample pretreatment: conversion fluid 12000rpm centrifugation 10min is taken to collect supernatant, and using 2-amino-butyric acid as standard Product, preparing standard solution.By the supernatant after moderately diluting and standard solution respectively after 0.22 μm of filtering with microporous membrane, with height Effect liquid phase chromatogram method measures 2-amino-butyric acid.

Threonine deaminase Enzyme activity assay: it takes the threonine deaminase of the 200 final concentration of 5g/L of μ L to generate bacterium solution and is added 3800 μ L substrates (substrate system: use 50mmol/L pH7.5 potassium dihydrogen phosphate -20 μm of dipotassium hydrogen phosphate buffer solution ol/L PLP and 50mmol/L threonine), 15min is reacted in 40 DEG C of waters bath with thermostatic control, is then boiled to terminate reaction.Sample dilutes 10 times, Threonine reduction amount is measured using HPLC-OPA pre-column derivatization.Enzyme-activity unit U is defined as threonine in 1min and reduces by 1 μm of ol institute The enzyme amount needed.

Leucine dehydrogenase Enzyme activity assay: the bacterium of the leucine dehydrogenase producing strains of the 200 final concentration of 10g/L of μ L is taken respectively The bacterium solution of liquid and hydrogenlyase producing strains is added 1600 μ L substrates and (substrate system: uses 50mmol/L pH8.0 biphosphate Sodium-disodium hydrogen phosphate buffer solution 0.6g/L NAD⁺, the 2- batanone acid of 20mmol/L, 40mmol/L ammonium formate), in 30 15min is reacted in DEG C water bath with thermostatic control, then boils to terminate reaction.Sample dilutes 10 times, is surveyed using HPLC-OPA pre-column derivatization Measure 2-amino-butyric acid production quantity.Enzyme-activity unit U is defined as enzyme amount needed for 1 μm of ol of 2-amino-butyric acid increase in 1min.

Hydrogenlyase Enzyme activity assay: in 300 μ L reaction systems, 0.1mol/L beta -mercaptoethanol, 1.67mmol/ is added L NAD⁺, 167mmol/L sodium formate, totally 200 μ L, the bacterium solution of 100 μ L FDH producing strains, buffer are 10mmol/L pH 7.5 Phosphoric acid solution.It reacts, the absorbance using microplate reader every 30s detection NADH at 340nm, and makees under the conditions of 30 DEG C Figure.The NADH standard solution (0-0.6mmol/L) of configuration various concentration measures light absorption value at 340nm, draws standard curve, intends Close regression equation.Enzyme-activity unit U is defined as enzyme amount needed for generating 1 μm of ol NADH in 1min.

The measurement of 2-amino-butyric acid content: high performance liquid chromatography, with o-phthalaldehyde (OPA) for derivatization reagent, color Column: ZORBAX SB-C18 is composed, mobile phase A is 10mmol/L KH₂PO₄(4mol/L KOH adjusts pH 5.3), Mobile phase B is second Nitrile: methanol: A phase=5:3:1 (glacial acetic acid tune pH 5.3) gradient elution, flow velocity 1mL/min, fluorescence detector, Detection wavelength 330,460nm, 30 DEG C of column temperature.

The measurement of 2- butanone acid content: high performance liquid chromatography flows phase constituent: 5mmol/L dilute sulfuric acid, flow velocity 0.6mL/ min；Sampling volume: 10 μ L；Chromatographic column: Aminex HPX-87H Ion Exclusion Column, 300 × 7.8mm；Detection Device: UV detector, wavelength 210nm.

Embodiment 1: the acquisition of the genetic engineering bacterium of production E. coli threonine deaminase

(1) Escherichia coli W3110 is inoculated in LB culture medium, and 37 DEG C of culture 12h are collected thallus, extracted using bacterial genomes Kit extracts genomic DNA.

(2) respectively with primer EcTD-1 (5'CGGGATCCATGGCTGACTCGCAACCCCTG 3', SEQ ID NO:8) and EcTD-2 (5'CCCAAGCTTCTAACCCGCCAAAAAGAACCTGAAC 3', SEQ ID NO:9) clones Soviet Union's ammonia from genome The gene EcTD of sour deaminase；

(3) target gene is connected to the sequencing of PMD19simple cloning vector, choose correct gene segment with BamHI and The plasmid pET28a crossed through same two kinds of enzyme double digestions is connected to after XhoI double digestion；

(4) by the expression plasmid built import E.coli BL21 (DE3), containing card receive mycin LB plate in into Row screening and verifying, select the right-on bacterial strain of target gene, and gene order is SEQ ID NO:1, amino acid sequence SEQ IDNO:5。

(5) engineering bacteria obtained above containing recombinant plasmid is inoculated in the LB liquid containing 100mg/L kanamycins In culture medium, 37 DEG C, 200r/min shaken overnight culture.Above-mentioned overnight culture is inoculated in by 4% inoculum concentration and is contained In the TB culture medium of 100mg/L kanamycins, 37 DEG C, 200r/min shaken cultivation to bacterium solution OD600=0.6-0.8, addition lures Agent IPTG is led, final concentration 100mg/L, 25 DEG C, 200r/min Fiber differentiation 10h, thalline were collected by centrifugation.

(6) thallus that above-mentioned collection obtains is dissolved in potassium dihydrogen phosphate-dipotassium hydrogen phosphate buffer that pH is 7.5, is made Its concentration is 100g/L and detects enzyme activity according to preceding method, and the enzyme activity of threonine deaminase is 1350U.

Embodiment 2: the acquisition of the genetic engineering bacterium of production bacillus thuringiensis leucine dehydrogenase

(1) bacillus thuringiensis is inoculated in LB culture medium, and 37 DEG C of culture 12h are collected thallus, mentioned using bacterial genomes Kit is taken to extract genomic DNA.

(2) respectively with primer BtLeuDH-1 (5 ' CGGGATCCATGCGCGTTATGGTCTTG 3 ', SEQ ID NO:10) With BtLeuDH-2 (5 ' CCCAAGCTTTTAGCGACGGCTAATAATATCGTG 3 ', SEQ ID NO:11) from genomic DNA Clone obtains bacillus thuringiensis leucine dehydrogenase gene BtLeuDH.

(3) target gene is connected to the sequencing of PMD19simple cloning vector, choose correct gene segment with BamHI and The pET28a crossed through same two kinds of enzyme double digestions is connected to after XhoI double digestion；

(4) by the expression plasmid built import E.coli BL21 (DE3), containing card receive mycin LB plate in into Row screening and verifying, select the right-on bacterial strain of target gene, and wherein bacillus thuringiensis leucine dehydrogenase gene is such as SEQ ID NO:2, amino acid sequence are SEQ ID NO:6.

(5) engineering bacteria obtained above containing recombinant plasmid is inoculated in the LB containing 100mg/L kanamycins respectively In fluid nutrient medium, 37 DEG C, 200r/min shaken overnight culture.Above-mentioned overnight culture is inoculated in by 4% inoculum concentration and is contained In the TB culture medium of 100mg/L kanamycins, 37 DEG C, 200r/min shaken cultivation to bacterium solution OD₆₀₀Induction is added in=0.6-0.8 Agent IPTG, final concentration 100mg/L, 25 DEG C, 200r/min Fiber differentiation 10h, thalline were collected by centrifugation.

(6) thallus that above-mentioned collection obtains is dissolved in sodium dihydrogen phosphate-disodium hydrogen phosphate buffer that pH is 8.5, is made Its concentration is 100g/L and detects enzyme activity according to preceding method, and the enzyme activity of leucine dehydrogenase is 184U.

Embodiment 3: the acquisition of the genetic engineering bacterium of hydrogenlyase is produced

Codon optimization (protogene sequence is carried out to from Candida boidinii formate dehydrogenase gene (FDH) Such as SEQID NO:3) make gene order more adapt to large intestine expression system, gene order such as SEQ ID NO:4, amino after optimization Acid sequence such as SEQ ID NO:7.The artificial synthesized FDH genetic fragment containing BamHI and XhoI restriction enzyme site is subjected to double enzymes It cuts, be then connected with the expression vector pET28a that same double digestion obtains construction recombination plasmid pET28a-FDH, will recombinate matter Grain is transferred in expressive host E.coli BL21 (DE3), is screened and is verified in the LB plate for receiving mycin containing card, is screened Correct positive strain out.

The above-mentioned engineering bacteria through codon optimization is inoculated in the LB liquid medium containing 100mg/L kanamycins, 37 DEG C, 200r/min shaken overnight culture.Above-mentioned overnight culture by 4% inoculum concentration is inoculated in card containing 100mg/L, and that is mould In the TB culture medium of element, 37 DEG C, 200r/min shaken cultivation to bacterium solution OD₆₀₀Inducer IPTG, final concentration is added in=0.6-0.8 100mg/L, 25 DEG C, 200r/min Fiber differentiation 10h, thalline were collected by centrifugation.

The thallus that above-mentioned collection obtains is dissolved in sodium dihydrogen phosphate-disodium hydrogen phosphate buffer that pH is 8.5, keeps its dense Degree is 100g/L and detects enzyme activity according to preceding method, and the enzyme activity of hydrogenlyase is 178U.

Embodiment 4: threonine deaminase enzymatic conversion threonine generates 2- batanone acid

Influence of the bacterial concentration to conversion ratio: in 20mL transformation system, the substrate L-threonine in transformation system is dense Degree is set to that 50g/L is constant, and the PLP of 20 μm of ol/L is added, and conversion fluid is the sodium phosphate buffer of pH 7.5.In 37 DEG C of constant-temperature tables Middle conversion, revolving speed 200r/min are sampled in 14~20h, and the bacterial concentration gradient that setting threonine deaminase produces bacterium is 15g/ L,20g/L,25g/L,30g/L,35g/L.It is converted in 37 DEG C of constant-temperature tables, revolving speed 200r/min takes respectively at 12~20h Sample is boiled to make to terminate and be reacted, centrifuging and taking supernatant liquid chromatographic detection 2- butanone acid yield.2 result of analytical table is it is found that at this Most suitable bacterial concentration is 15g/L under part, and 2- butanone acid yield is 41.6g/L, and conversion ratio reaches 97%.

The influence that the different bacterial concentrations of table 1 produce 2- batanone acid.

Influence of the concentration of substrate to conversion ratio: in 20mL transformation system, setting threonine concentration gradient be 20g/L, The bacterium solution of 15g/L threonine deaminase production bacterium, the PLP of 20 μm of ol/L, conversion is added in 30g/L, 40g/L, 50g/L, 60g/L Liquid is the sodium phosphate buffer of pH 7.5.It converts, revolving speed 200r/min, is sampled in 14~20h, liquid phase in 37 DEG C of constant-temperature tables Chromatography detects 2- butanone acid yield in supernatant.As can be known from Table 3, most suitable concentration of substrate is 50g/L, 2- fourth with this condition Ketone acid yield is 41.0g/L, and threonine molar yield reaches 95% or more.

The influence that the different concentration of substrate of table 2 produce 2- batanone acid.

By above-mentioned experimentation, determine that threonine deaminase enzymatic conversion threonine generates the most suitable concentration of substrate of 2- butanone acid system For 50g/L, most suitable bacterial concentration is 15g/L, and threonine conversion ratio reaches 95% or more at this time.

Embodiment 5: leucine deamination enzymatic conversion 2- batanone acid generates 2-amino-butyric acid

Influence of the bacterial concentration to conversion ratio: in 20mL transformation system, setting 2- butanone acid concentration is 50g/L, is added 20g/L ammonium formate, the bacterium solution of 10g/L formate dehydrogenase enzyme-producing bacteria, 0.6g/L NAD⁺, conversion buffer system is pH's 8.0 NaH₂PO₄-Na₂HPO₄Buffer, leucine dehydrogenase production bacterium bacterial concentration gradient be, 15g/L, 20g/L, 25g/L, 30g/L,35g/L.It converts in 37 DEG C of constant-temperature tables, revolving speed 200r/min, is sampled in 14~20h, high performance liquid chromatography inspection Survey 2-amino-butyric acid yield.Result is analyzed from table 4 it is found that most suitable bacterial concentration is 20g/L, at this time 2- batanone acid with this condition Concentration is 32.4g/L, conversion ratio 64.2%.

The influence that the different bacterial concentrations of table 3 produce 2-amino-butyric acid.

Influence of the concentration of substrate to conversion ratio: in 20mL transformation system, setting 2- batanone acid concentration gradient be 25g/L, 10~30g/L ammonium formate, the bacterium solution of 20g/L leucine dehydrogenase production bacterium, 10g/L formic acid is added in 30g/L, 35g/L, 40g/L The bacterium solution of dehydrogenation enzyme-producing bacteria, 0.6g/L NAD⁺, conversion fluid be pH=8.0 NaH₂PO₄-Na₂HPO₄Buffer, in 37 DEG C of perseverances It is converted in warm shaking table, revolving speed 200r/min, 14~20h sampling, high performance liquid chromatography detects 2-amino-butyric acid yield.By table 5 It is found that most suitable concentration of substrate is 35.0g/L with this condition, 2-amino-butyric acid yield is 33.9g/L, and conversion ratio reaches 96.0%.

The influence that the different concentration of substrate of table 4 produce 2-amino-butyric acid.

By above-mentioned experimentation, determine that leucine dehydrogenase conversion 2- batanone acid generates the most suitable substrate of 2-amino-butyric acid system Concentration is 35g/L, and most suitable bacterial concentration is 20g/L, and conversion ratio reaches 96% at this time.

Embodiment 6: threonine concentration cascades the influence of conversion L-threonine production C4H9NO2 system to three enzymes

In 20mL transformation system, bacterium solution, the 20g/L amino acid dehydrogenase of 15g/L threonine deaminase production bacterium is added Bacterium solution, the bacterium solution of 10g/L formate dehydrogenase enzyme-producing bacteria of bacterium are produced, setting threonine concentration gradient is 20g/L, 30g/L, 40g/ L, 50g/L, 10~30g/L ammonium formate, 0.6g/L NAD⁺, 5~20 μm of ol/L PLP, conversion fluid is the NaH of pH=8.0₂PO₄- Na₂HPO₄Buffer.It is converted in 32~37 DEG C of constant-temperature tables, revolving speed 200r/min, 14~20h sampling, high performance liquid chromatography Detect 2-amino-butyric acid yield.As known from Table 6, most suitable threonine concentration is 40g/L under this condition, and C4H9NO2 yield is 34.3g/L, optical purity ee are 99%, and conversion ratio is up to 99% or more.

The influence that the different concentration of substrate of table 5 produce 2-amino-butyric acid.

Embodiment 7: the building of plasmid pRSFDuet-BtLeuDH

Bacillus thuringiensis YBT-1520 is inoculated in LB culture medium, and 37 DEG C of culture 12h collect thallus, use bacterial gene Group extracts kit extracts genomic DNA.Respectively with primer BtLeuDH-1 (5'CATCATCACCACAGCCAGGATCCAATGA CATTAGAAATCTTCGAATACTTAG 3', SEQ ID NO:12) and BtLeuDH-2 (5'GCGGTTTCTTTACCAGACTCG AGTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:13) gene of clone's leucine dehydrogenase from genome BtLeu；The PCR DNA fragmentation obtained is isolated and purified through agarose gel electrophoresis, recycles segment through BamHI and XhoI double digestion Afterwards, the double-promoter high copy expression carrier of recycling is isolated and purified after handling with same double digestion through agarose gel electrophoresis PRSFDuet-1 is connected through a step homologous recombination method.Connection product is converted through chemical transformation to JM109 competent cell, rear to train It is coated on the LB plate containing kanamycins after feeding 1h and cultivates 10h, the bacterium colony grown scribing line is separately cultured 12h, chooses single bacterium Drop into row bacterium colony PCR identification positive colony.Positive colony is inoculated in LB culture medium, extracts plasmid, double enzymes after 37 DEG C of culture 12h SDS-PAGE detection is carried out after cutting, testing result is shown in Fig. 2.Through sequence verification, recombinant plasmid pRSFDuet-BtLeuDH is constructed to obtain.

Embodiment 8: the building of plasmid pETduet-CbFDH-EcTD

Escherichia coli W3110, Candida are inoculated in LB culture medium, extract genomic DNA by 7 the method for embodiment. Respectively with primer CbFDH-1 (5'CCATCATCACCACAGCCAGGATCCAATGAAGATCGTGTTAGTCCTTTACGACG 3', SEQ ID NO:14) and CbFDH-2 (5'GGTACCTTTCTCCTCTTTAATCTGCAGTTATTATTTTTTATCGTGTTTCCC GTAG 3', SEQ ID NO:15) the gene C bFDH of clone's hydrogenlyase from genome；Respectively with primer EcTD-1 (5' CTGCAGATTAAAGAGGAGAAAGGTACCATGGCTGACTCGCAACCCC 3', SEQ ID NO:16) and EcTD-2 (5'AG CGGTTTCTTTACCAGACTCGAGTTAACCCGCCAAAAAGAACCTG 3', SEQ ID NO:17) Soviet Union is cloned from genome The gene EcTD of propylhomoserin deaminase.By two DNA fragmentations of PCR acquisition respectively after BamHI and XhoI double digestion, using a step Homologous recombination method connection, obtains CbFDH and the concatenated connection product CbFDH-EcTD of two genetic fragment of EcTD, through Ago-Gel It is correct that electrophoresis verifies fragment length.Respectively with primer CbFDH-1 (5'CCATCATCACCACAGCCAGGATCCAATGAAGATCG TGTTAGTCCTTTACGACG 3', SEQ ID NO:14) and EcTD-2 (5'AGCGGTTTCTTTACCAGACTCGAGTTAACC CGCCAAAAAGAACCTG 3', SEQ ID NO:17) amplified fragments CbFDH-EcTD, the CbFDH-EcTD segment warp that PCR is obtained Agarose gel electrophoresis isolates and purifies, and segment is recycled after BamHI and XhoI double digestion, through agar after handling with same double digestion Single promoter low-copy expression vector PETDuet-1 that sugared gel electrophoresis isolates and purifies recycling is connected through a step homologous recombination method, Connection product is converted through chemical transformation to JM109 competent cell, and it is flat to be coated on LB with ampicillin after rear culture 1h 10h is cultivated on plate, the bacterium colony grown scribing line is separately cultured 12h, is chosen single colonie and is carried out bacterium colony PCR identification positive colony.It will Positive colony is inoculated in LB culture medium, and plasmid is extracted after 37 DEG C of culture 12h, and SDS-PAGE detection, detection knot are carried out after double digestion Fruit sees Fig. 2.Through sequence verification, recombinant plasmid pETduet-CbFDH-EcTD is constructed to obtain.

Embodiment 9: the building of plasmid pETduet-BtLeuDH-CbFDH-EcTD

Bacillus thuringiensis YBT-1520 is inoculated in LB culture medium, and 37 DEG C of culture 12h collect thallus, use bacterial gene Group extracts kit extracts genomic DNA.Respectively with primer BtLeuDH-1 (5'CATCATCACCACAGCCAGGATCCAATGA CATTAGAAATCTTCGAATACTTAG 3', SEQ ID NO:12) and BtLeuDH-3 (5'GTAAAGGACTAACACGATCTT CATGAGCTCTTTCTCCTCTTTGATATCTTAGCGACGGCTAATAATATCGTG 3', SEQ ID NO:18) from genome The gene BtLeu of middle clone's leucine dehydrogenase.The pETduet-CbFDH-EcTD plasmid BamH1 that 8 structure of embodiment is obtained is mono- It after digestion, is isolated and purified through agarose gel electrophoresis, recycles segment, the mono- step homologous recombination of segment BtLeu obtained with PCR amplification Connection, connection product are converted through chemical transformation to JM109 competent cell, are coated on after rear culture 1h with ampicillin 10h is cultivated on LB plate, the bacterium colony grown scribing line is separately cultured 12h, single colonie is chosen and carries out positive gram of bacterium colony PCR identification Grand, SDS-PAGE testing result is shown in Fig. 3.Positive colony is inoculated in LB culture medium, extracts plasmid after 37 DEG C of culture 12h.Through surveying Sequence verifying, constructs to obtain recombinant plasmid pETduet-BtLeuDH-CbFDH-EcTD.

Embodiment 10: building, expression, conversion, the screening of simple substance grain recombinant bacterium

The plasmid pETduet-BtLeuDH-CbFDH-EcTD that 9 structure of embodiment obtains is converted through chemical transformation to BL21 and is felt By state cell, it is coated on LB plate with ampicillin after culture 1h cultivates 10h afterwards, the bacterium colony grown is crossed and separates training 12h is supported, three single colonies of picking are inoculated in respectively in the LB liquid medium containing 100mg/L ampicillin, 37 DEG C, 200r/min shaken overnight culture.Above-mentioned overnight culture is inoculated in the benzyl mould of ammonia containing 100mg/L by 4% inoculum concentration respectively In the TB culture medium of element, inducer IPTG is added in 37 DEG C, 200r/min shaken cultivation to bacterium solution OD600=0.6-0.8, dense eventually 100mg/L, 25 DEG C, 200r/min Fiber differentiation 10h are spent, respectively thalline were collected by centrifugation A1 (BL21/pETduet-BtLeuDH- CbFDH-EcTD)、A2(BL21/pETduet-BtLeuDH-CbFDH-EcTD)、A3(BL21/pETduet-BtLeuDH- CbFDH-EcTD).

In 20mL transformation system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD is added⁺、20μmol/L PLP, 45g/L simple substance grain recombinant bacterium, conversion fluid are the NaH of pH=8.0₂PO₄-Na₂HPO₄Buffer.It is shaken in 32~37 DEG C of constant temperature It is converted in bed, revolving speed 200r/min, 8-24h sampling, it is known that its transformation time is 18h, and high performance liquid chromatography detects 2- amino Butyric acid yield.As known from Table 6, best simple substance grain recombinant bacterium is A2 under this condition, and C4H9NO2 yield is 36.2g/L, is turned Rate is up to 83.5%.

The catalytic effect of 6 simple substance grain recombinant bacterium of table.

Embodiment 11: building, expression, conversion, the screening of double-mass model recombinant bacterium

By the plasmid pRSFDuet-BtLeuDH that 7 structure of embodiment the obtains and plasmid pETduet-CbFDH- that 8 structure of embodiment obtains EcTD is converted simultaneously through chemical transformation to BL21 competent cell, is coated on after rear culture 1h while containing ampicillin and card 10h is cultivated on the LB plate of that mycin, the bacterium colony grown scribing line is separately cultured 12h, three single colonies of picking are inoculated in respectively In LB liquid medium containing 100mg/L ampicillin and 100mg/L kanamycins, 37 DEG C, 200r/min shaken overnight Culture.By above-mentioned overnight culture by 4% inoculum concentration be inoculated in respectively ampicillin containing 100mg/L and 100mg/L card that In the TB culture medium of mycin, 37 DEG C, 200r/min shaken cultivation to bacterium solution OD₆₀₀Inducer IPTG is added in=0.6-0.8, dense eventually 100mg/L, 25 DEG C, 200r/min Fiber differentiation 10h are spent, respectively thalline were collected by centrifugation B1 (BL21/pRSFDuet-BtLeuDH+ PETduet-CbFDH-EcTD), B2 (BL21/pRSFDuet-BtLeuDH+pETduet-CbFDH-EcTD) and B3 (BL21/ pRSFDuet-BtLeuDH+pETduet-CbFDH-EcTD)。

In 20mL transformation system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD is added⁺、20μmol/L PLP, 45g/L double-mass model recombinant bacterium, conversion fluid are the NaH of pH=8.0₂PO₄-Na₂HPO₄Buffer.It is shaken in 32~37 DEG C of constant temperature It is converted in bed, revolving speed 200r/min, 8-20h sampling, completely, high performance liquid chromatography detects 2-amino-butyric acid yield for 10h conversion. As known from Table 7, best double-mass model recombinant bacterium is B1 under this condition, and C4H9NO2 yield is 43.3g/L, and conversion ratio reaches 99.9% or more.

The catalytic effect of 7 double-mass model recombinant bacterium (pRSFDuet-BtLeuDH+pETduet-CbFDH-EcTD) of table

Comparative example 1: the Build Order of enzyme gene CbFDH and EcTD change in plasmid pETduet-1

It is obtained respectively with primer EcTD-1 (SEQ ID NO:16) and CbFDH-2 (SEQ ID NO:15) amplification embodiment 8 Series connection segment EcTD-CbFDH, the EcTD-CbFDH segment that PCR is obtained isolates and purifies through agarose gel electrophoresis, recycles segment After BamHI and XhoI double digestion, start with the single of recycling is isolated and purified through agarose gel electrophoresis after the processing of same double digestion Sub- low-copy expression vector PETDuet-1 is connected through a step homologous recombination method, and connection product is converted through chemical transformation to JM109 Competent cell is coated on LB plate with ampicillin after culture 1h cultivates 10h afterwards, the bacterium colony grown is crossed and is separated 12h is cultivated, single colonie is chosen and carries out bacterium colony PCR identification positive colony.Positive colony is inoculated in LB culture medium, 37 DEG C of cultures Plasmid is extracted after 12h, carries out SDS-PAGE detection after double digestion.Through sequence verification, recombinant plasmid pETduet-EcTD- is constructed to obtain CbFDH。

The plasmid pRSFDuet-BtLeuDH that plasmid pETduet-EcTD-CbFDH and 7 structure of embodiment are obtained turns through chemistry Change method is converted simultaneously to BL21 competent cell, is coated on after rear culture 1h while the LB containing ampicillin and kanamycins is flat 10h is cultivated on plate, the bacterium colony grown scribing line is separately cultured 12h, three single colonies of picking are inoculated in respectively containing 100mg/L ammonia In the LB liquid medium of parasiticin and 100mg/L kanamycins, 37 DEG C, 200r/min shaken overnight culture.By above-mentioned mistake Night culture is inoculated in the TB culture medium of ampicillin containing 100mg/L and 100mg/L kanamycins by 4% inoculum concentration respectively In, inducer IPTG, final concentration 100mg/L, 25 is added in 37 DEG C, 200r/min shaken cultivation to bacterium solution OD600=0.6-0.8 DEG C, 200r/min Fiber differentiation 10h, respectively thalline were collected by centrifugation C1 (BL21/pRSFDuet-BtLeuDH+pETduet-EcTD- CbFDH), C2 (BL21/pRSFDuet-BtLeuDH+pETduet-EcTD-CbFDH) and C3 (BL21/pRSFDuet-BtLeuDH +pETduet-EcTD-CbFDH)。

In 20mL transformation system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD is added⁺、20μmol/L PLP, 45g/L double-mass model recombinant bacterium, conversion fluid are the NaH of pH=8.0₂PO₄-Na₂HPO₄Buffer.It is shaken in 32~37 DEG C of constant temperature It is converted in bed, sampling in revolving speed 200r/min, 8-20h, completely, high performance liquid chromatography detects 2-amino-butyric acid and produces for 14h conversion Amount.As known from Table 8, best double-mass model recombinant bacterium is C3 under this condition, and C4H9NO2 yield is 35.8g/L, and conversion ratio reaches 82.7%.

Compared with embodiment 11, change the order of connection of CbFDH and EcTD, so that its time converted completely increases, and C4H9NO2 yield and conversion ratio are decreased obviously.

The catalytic effect of 8 double-mass model recombinant bacterium (pRSFDuet-BtLeuDH+pETduet-EcTD-CbFDH) of table

Comparative example 2: the collocation of different plasmids and enzyme

The EcTD genetic fragment obtained of PCR in embodiment 8 is isolated and purified through agarose gel electrophoresis, recycling segment warp After BamHI and XhoI double digestion, with the double-promoter for isolating and purifying recycling after the processing of same double digestion through agarose gel electrophoresis High copy expression carrier pRSFDuet-1 is connected through a step homologous recombination method.Connection product is converted through chemical transformation to JM109 Competent cell is coated on the LB plate containing kanamycins after culture 1h cultivates 10h afterwards, the bacterium colony grown is crossed and separates training 12h is supported, single colonie is chosen and carries out bacterium colony PCR identification positive colony.Positive colony is inoculated in LB culture medium, 37 DEG C of culture 12h After extract plasmid, SDS-PAGE detection is carried out after double digestion, testing result is shown in Fig. 3.Through sequence verification, recombinant plasmid is constructed to obtain pRSFDuet-EcTD。

By the CbFDH genetic fragment point that PCR is obtained in the obtained BtLeu genetic fragment of PCR in embodiment 7 and embodiment 8 Not after BamHI and XhoI double digestion, is connected using a step homologous recombination method, obtain BtLeu and connect with two genetic fragment of CbFDH Connection product BtLeu-CbFDH, through agarose gel electrophoresis verifying fragment length it is correct.Respectively with primer BtLeu-1 (SEQ ID NO:12) and CbFDH-2 (SEQ ID NO:15) amplified fragments BtLeu-CbFDH, the BtLeu-CbFDH segment that PCR is obtained It is isolated and purified through agarose gel electrophoresis, segment is recycled after BamHI and XhoI double digestion, through fine jade after handling with same double digestion Single promoter low-copy expression vector PETDuet-1 of sepharose electrophoretic separation purification and recovery connects through a step homologous recombination method It connects, connection product is converted through chemical transformation to JM109 competent cell, is coated on LB with ampicillin after rear culture 1h 10h is cultivated on plate, the bacterium colony grown scribing line is separately cultured 12h, is chosen single colonie and is carried out bacterium colony PCR identification positive colony. Positive colony is inoculated in LB culture medium, plasmid is extracted after 37 DEG C of culture 12h, SDS-PAGE detection, detection are carried out after double digestion As a result see Fig. 3.Through sequence verification, recombinant plasmid pETduet-BtLeu-CbFDH is constructed to obtain.

Plasmid pRSFDuet-EcTD and plasmid pETduet-BtLeu-CbFDH is converted extremely simultaneously through chemical transformation BL21 competent cell is coated on after cultivating 1h afterwards while cultivating 10h on the LB plate containing ampicillin and kanamycins, will The bacterium colony scribing line grown is separately cultured 12h, three single colonies of picking be inoculated in respectively containing 100mg/L ampicillin and In the LB liquid medium of 100mg/L kanamycins, 37 DEG C, 200r/min shaken overnight culture.Above-mentioned overnight culture is pressed 4% inoculum concentration is inoculated in respectively in the TB culture medium of ampicillin containing 100mg/L and 100mg/L kanamycins, 37 DEG C, Inducer IPTG, final concentration 100mg/L, 25 DEG C, 200r/ are added to bacterium solution OD600=0.6-0.8 in 200r/min shaken cultivation Min Fiber differentiation 10h, respectively thalline were collected by centrifugation D1 (BL21/pRSFDuet-EcTD+pETduet-BtLeu-CbFDH), D2 (BL21/pRSFDuet-EcTD+pETduet-BtLeu-CbFDH) and D3 (BL21/pRSFDuet-EcTD+pETduet- BtLeu-CbFDH)。

In 20mL transformation system, 40g/L threonine, 42g/L ammonium formate, 0.6g/L NAD is added⁺、20μmol/L PLP, 45g/L double-mass model recombinant bacterium, conversion fluid are the NaH of pH=8.0₂PO₄-Na₂HPO₄Buffer.It is shaken in 32~37 DEG C of constant temperature It is converted in bed, revolving speed 200r/min, 8-20h sampling, 16h is converted completely, and high performance liquid chromatography detects 2-amino-butyric acid yield. As known from Table 9, best double-mass model recombinant bacterium is D1 under this condition, and C4H9NO2 yield is 30.8g/L, and conversion ratio reaches 71.1%.

Compared with embodiment 11, the recombinant bacterium obtained under this comparative example is in conversion L-threonine production C4H9NO2 In the process, transformation time is longer, and C4H9NO2 yield and conversion ratio are decreased obviously.

The catalytic effect of 9 double-mass model recombinant bacterium (pRSFDuet-EcTD+pETduet-BtLeu-CbFDH) of table

Comparative example 3 carries out the recombination of double-mass model recombinant bacterium using the formate dehydrogenase gene that codon is not optimised

Formate dehydrogenase gene is denoted as CbFDH using the gene being not optimised in this comparative example⁰, according to embodiment 7,8,11 In method construct to obtain double-mass model recombinant bacterium, pRSFDuet-BtLeuDH+pETduet-CbFDH0-EcTD, in identical item It is converted under part, 8-20h sampling, completely, high performance liquid chromatography detects 2-amino-butyric acid yield for 12h conversion.It can from table 10 Know, best double-mass model recombinant bacterium is E1 under this condition, and C4H9NO2 yield is 36.8g/L, and conversion ratio is up to 88.6%.

Compared with embodiment 11, the recombinant bacterium that the FDH gene under this comparative example without codon optimization participates in building is turning During changing L-threonine production C4H9NO2, transformation time is longer, and C4H9NO2 yield and conversion ratio are equal It is decreased obviously.

10 double-mass model recombinant bacterium (pRSFDuet-BtLeuDH+pETduet-CbFDH of table⁰- EcTD) catalytic effect

Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention Enclosing subject to the definition of the claims.

SEQUENCE LISTING

<110>Southern Yangtze University

<120>a kind of building and application of the recombinant bacterium of conversion L-threonine production C4H9NO2

<160> 18

<170> PatentIn version 3.3

<210> 1

<211> 1545

<212> DNA

<213>Escherichia coli W3110

<400> 1

atggctgact cgcaacccct gtccggtgct ccggaaggtg ccgaatattt aagagcagtg 60

ctgcgcgcgc cggtttacga ggcggcgcag gttacgccgc tacaaaaaat ggaaaaactg 120

tcgtcgcgtc ttgataacgt cattctggtg aagcgcgaag atcgccagcc agtgcacagc 180

tttaagctgc gcggcgcata cgccatgatg gcgggcctga cggaagaaca gaaagcgcac 240

ggcgtgatca ctgcttctgc gggtaaccac gcgcagggcg tcgcgttttc ttctgcgcgg 300

ttaggcgtga aggccctgat cgttatgcca accgccaccg ccgacatcaa agtcgacgcg 360

gtgcgcggct tcggcggcga agtgctgctc cacggcgcga actttgatga agcgaaagcc 420

aaagcgatcg aactgtcaca gcagcagggg ttcacctggg tgccgccgtt cgaccatccg 480

atggtgattg ccgggcaagg cacgctggcg ctggaactgc tccagcagga cgcccatctc 540

gaccgcgtat ttgtgccagt cggcggcggc ggtctggctg ctggcgtggc ggtgctgatc 600

aaacaactga tgccgcaaat caaagtgatc gccgtagaag cggaagactc cgcctgcctg 660

aaagcagcgc tggatgcggg tcatccggtt gatctgccgc gcgtagggct atttgctgaa 720

ggcgtagcgg taaaacgcat cggtgacgaa accttccgtt tatgccagga gtatctcgac 780

gacatcatca ccgtcgatag cgatgcgatc tgtgcggcga tgaaggattt attcgaagat 840

gtgcgcgcgg tggcggaacc ctctggcgcg ctggcgctgg cgggaatgaa aaaatatatc 900

gccctgcaca acattcgcgg cgaacggctg gcgcatattc tttccggtgc caacgtgaac 960

ttccacggcc tgcgctacgt ctcagaacgc tgcgaactgg gcgaacagcg tgaagcgttg 1020

ttggcggtga ccattccgga agaaaaaggc agcttcctca aattctgcca actgcttggc 1080

gggcgttcgg tcaccgagtt caactaccgt tttgccgatg ccaaaaacgc ctgcatcttt 1140

gtcggtgtgc gcctgagccg cggcctcgaa gagcgcaaag aaattttgca gatgctcaac 1200

gacggcggct acagcgtggt tgatctctcc gacgacgaaa tggcgaagct acacgtgcgc 1260

tatatggtcg gcggacgtcc atcgcatccg ttgcaggaac gcctctacag cttcgaattc 1320

ccggaatcac cgggcgcgct gctgcgcttc ctcaacacgc tgggtacgta ctggaacatt 1380

tctttgttcc actatcgcag ccatggcacc gactacgggc gcgtactggc ggcgttcgaa 1440

cttggcgacc atgaaccgga tttcgaaacc cggctgaatg agctgggcta cgattgccac 1500

gacgaaacca ataacccggc gttcaggttc tttttggcgg gttaa 1545

<210> 2

<211> 1101

<212> DNA

<213>bacillus thuringiensis YBT-1520

<400> 2

atgacattag aaatcttcga atacttagaa aaatatgatt atgagcaagt agtattttgt 60

caagataaag aatctggttt aaaagcaatt attgcaattc atgatacaac acttggaccg 120

gctcttggtg gaacaagaat gtggacatat gattctgaag aagcggcgat tgaagatgca 180

ttgcgtcttg caaaagggat gacatataaa aacgcagcag ctggtttaaa cttaggtggt 240

gcgaaaacag taattatcgg tgatcctcgt aaagataaga gcgaagcaat gttccgtgca 300

ctaggacgtt atatccaagg actaaacgga cgttacatta cagctgaaga tgttggtaca 360

acagtagatg atatggatat tatccatgaa gaaactgact ttgtaacagg tatctcacca 420

tcattcggtt cttctggtaa cccatctcca gtaactgcat acggtgttta ccgtggtatg 480

aaagcagctg caaaagaagc tttcggtact gacaatttag aaggaaaagt aattgctgtt 540

caaggcgttg gtaacgtagc atatcaccta tgcaaacatt tacacgctga aggagcaaaa 600

ttaatcgtta cagatattaa taaagaagct gtacaacgtg ctgtagaaga attcggtgca 660

tcagcagttg aaccaaatga aatttatggt gttgaatgcg atatttacgc accatgtgca 720

ttaggcgcaa cagttaatga tgaaactatt ccacaactta aagcaaaagt aatcgcaggt 780

tctgcaaata accaattaaa agaaaatcgt cacggtgaca tcattcatga aatgggtatt 840

gtatacgcac cagattatgt aattaatgca ggtggcgtaa ttaacgtagc agacgaatta 900

tatggataca atagagaacg tgcactaaaa cgtgttgagt ctatttatga cacaattgca 960

aaagtaatcg aaatttcaaa acgcgatggc atagcaactt atgtagcggc agatcgtcta 1020

gctgaagagc gcattgcaag cttgaaaaat tctcgtagca cttacttacg caacggtcac 1080

gatattatta gccgtcgcta a 1101

<210> 3

<211> 1098

<212> DNA

<213>Candida protogene

<400> 3

atgaagatcg tgttagtcct ttacgacgca ggaaagcatg ccgcggacga ggaaaagtta 60

tacggatgta ccgaaaataa acttggtatc gcgaattggc ttaaagatca aggccatgag 120

ctgattacta ccagtgataa agaaggcggg aacagtgttt tagaccaaca tatcccagac 180

gcggatatta tcattaccac cccgtttcac ccggcttata tcacgaagga gcgtattgat 240

aaagccaaga agttgaagct ggtggtagtc gccggggttg gtagtgacca catcgactta 300

gactatatca accaaactgg taaaaaaatt agtgttttgg aagttactgg atcaaacgta 360

gtgtccgtgg ccgaacatgt tgtaatgacg atgctggtgc ttgttcgcaa ctttgtgccc 420

gcgcacgagc aaattattaa ccatgactgg gaagtcgctg ctattgcgaa agacgcttac 480

gatatcgaag ggaagactat tgcaaccatt ggtgccggtc gcatcggtta ccgcgtgtta 540

gagcgccttg tcccgtttaa ccctaaggaa cttttgtatt atgactatca agcgctgcca 600

aaggacgcgg aggagaaagt gggagctcgc cgcgtagaga atatcgagga gttagtagcc 660

caggcggata tcgttactgt aaacgcccct ttgcacgccg gaactaaggg cctgattaat 720

aaagagttat taagcaaatt taagaaggga gcttggttag tcaacactgc tcgcggtgct 780

atttgtgtgg cagaggatgt tgctgctgct ttggaatcag ggcagttacg tggatacggt 840

ggtgatgttt ggttccctca accagcgccg aaagaccacc cgtggcgcga catgcgtaat 900

aagtatgggg cagggaacgc tatgacgccg cactattctg gcactacatt ggatgcgcag 960

acacgttacg ctcaagggac taaaaacatt ttggagtctt tcttcaccgg taagttcgat 1020

taccgccctc aagatatcat tcttttgaat ggagaatacg tcacaaaggc ctacgggaaa 1080

cacgataaaa aataataa 1098

<210> 4

<211> 1098

<212> DNA

<213>artificial sequence

<400> 4

atgaaaattg tgctggtgct gtatgatgcg ggcaaacatg cggcggatga agaaaaactg 60

tatggctgca ccgaaaataa actgggcatt gcgaactggc tgaaagatca gggccatgaa 120

ctgattacca cctctgataa agaaggcggc aacagcgttc tggatcagca tattccggat 180

gcggatatta ttattaccac cccgtttcat ccggcgtata tcaccaaaga acgcatcgat 240

aaagcgaaaa aactgaaact ggtggtggtg gcgggcgtgg gcagcgatca tattgatctg 300

gattatatca accagaccgg taaaaaaatt agcgtgctgg aagtgaccgg cagcaacgtg 360

gtgagcgtgg cggaacatgt ggtgatgacc atgctggtgc tggtgcgtaa ctttgtgccg 420

gcgcatgaac aaattattaa ccacgattgg gaagtggcgg cgattgcgaa agatgcgtat 480

gatatcgaag gcaaaaccat tgcgaccatt ggcgcgggtc gtattggcta tcgtgtgctg 540

gaacgtctgg tgccgtttaa tccgaaagaa ctgctgtatt atgattatca ggcgctgccg 600

aaagatgcgg aagaaaaagt gggtgcgcgt cgtgtggaaa acattgaaga actggtggcg 660

caggcggata ttgtgaccgt gaacgcgccg ctgcatgcgg gcaccaaagg cctgatcaac 720

aaagagctgc tgtctaagtt taaaaaaggc gcgtggctgg tgaataccgc gcgtggcgcg 780

atttgcgtgg ccgaagatgt tgcggcggcg ctggaaagcg gtcagctgcg tggctatggc 840

ggtgatgtgt ggtttccgca gccggcgccg aaagatcatc cgtggcgtga tatgcgtaac 900

aaatatggcg cgggtaacgc catgaccccg cattatagcg gcaccaccct ggatgcgcag 960

acccgttatg cgcagggcac caaaaacatt ctggaaagct ttttcaccgg caaatttgat 1020

tatcgtccgc aggacattat tctgctgaac ggcgaatatg tgaccaaagc gtatggcaaa 1080

cacgataaaa aataataa 1098

<210> 5

<211> 514

<212> PRT

<213>Escherichia coli W3110

<400> 5

Met Ala Asp Ser Gln Pro Leu Ser Gly Ala Pro Glu Gly Ala Glu Tyr

1 5 10 15

Leu Arg Ala Val Leu Arg Ala Pro Val Tyr Glu Ala Ala Gln Val Thr

20 25 30

Pro Leu Gln Lys Met Glu Lys Leu Ser Ser Arg Leu Asp Asn Val Ile

35 40 45

Leu Val Lys Arg Glu Asp Arg Gln Pro Val His Ser Phe Lys Leu Arg

50 55 60

Gly Ala Tyr Ala Met Met Ala Gly Leu Thr Glu Glu Gln Lys Ala His

65 70 75 80

Gly Val Ile Thr Ala Ser Ala Gly Asn His Ala Gln Gly Val Ala Phe

85 90 95

Ser Ser Ala Arg Leu Gly Val Lys Ala Leu Ile Val Met Pro Thr Ala

100 105 110

Thr Ala Asp Ile Lys Val Asp Ala Val Arg Gly Phe Gly Gly Glu Val

115 120 125

Leu Leu His Gly Ala Asn Phe Asp Glu Ala Lys Ala Lys Ala Ile Glu

130 135 140

Leu Ser Gln Gln Gln Gly Phe Thr Trp Val Pro Pro Phe Asp His Pro

145 150 155 160

Met Val Ile Ala Gly Gln Gly Thr Leu Ala Leu Glu Leu Leu Gln Gln

165 170 175

Asp Ala His Leu Asp Arg Val Phe Val Pro Val Gly Gly Gly Gly Leu

180 185 190

Val Ala Gly Val Ala Val Leu Ile Lys Gln Leu Met Pro Gln Ile Lys

195 200 205

Val Ile Ala Val Glu Ala Glu Asp Ser Ala Cys Leu Lys Ala Ala Leu

210 215 220

Asp Ala Gly His Pro Val Asp Leu Pro Arg Val Gly Leu Phe Ala Glu

225 230 235 240

Gly Val Ala Val Lys Arg Ile Gly Asp Glu Thr Phe Arg Leu Cys Gln

245 250 255

Glu Tyr Leu Asp Asp Ile Ile Thr Val Asp Ser Asp Ala Ile Cys Ala

260 265 270

Ala Met Lys Asp Leu Phe Glu Asp Val Arg Ala Val Ala Glu Pro Ser

275 280 285

Gly Ala Leu Ala Leu Ala Gly Met Lys Lys Tyr Ile Ala Leu His Asn

290 295 300

Ile Arg Gly Glu Arg Leu Ala His Ile Leu Ser Gly Ala Asn Val Asn

305 310 315 320

Phe His Gly Leu Arg Tyr Val Ser Glu Arg Cys Glu Leu Gly Glu Gln

325 330 335

Arg Glu Ala Leu Leu Ala Val Thr Ile Pro Glu Glu Lys Gly Ser Phe

340 345 350

Leu Lys Phe Cys Gln Leu Leu Gly Gly Arg Ser Val Thr Glu Phe Asn

355 360 365

Tyr Arg Phe Ala Asp Ala Lys Asn Ala Cys Ile Phe Val Gly Val Arg

370 375 380

Leu Ser Arg Gly Leu Glu Glu Arg Lys Glu Ile Leu Gln Met Leu Asn

385 390 395 400

Asp Gly Gly Tyr Ser Val Val Asp Leu Ser Asp Asp Glu Met Ala Lys

405 410 415

Leu His Val Arg Tyr Met Val Gly Gly Arg Pro Ser His Pro Leu Gln

420 425 430

Glu Arg Leu Tyr Ser Phe Glu Phe Pro Glu Ser Pro Gly Ala Leu Leu

435 440 445

Arg Phe Leu Asn Thr Leu Gly Thr Tyr Trp Asn Ile Ser Leu Phe His

450 455 460

Tyr Arg Ser His Gly Thr Asp Tyr Gly Arg Val Leu Ala Ala Phe Glu

465 470 475 480

Leu Gly Asp His Glu Pro Asp Phe Glu Thr Arg Leu Asn Glu Leu Gly

485 490 495

Tyr Asp Cys His Asp Glu Thr Asn Asn Pro Ala Phe Arg Phe Phe Leu

500 505 510

Ala Gly

<210> 6

<211> 366

<212> PRT

<213>bacillus thuringiensis YBT-1520

<400> 6

Met Thr Leu Glu Ile Phe Glu Tyr Leu Glu Lys Tyr Asp Tyr Glu Gln

1 5 10 15

Val Val Phe Cys Gln Asp Lys Glu Ser Gly Leu Lys Ala Ile Ile Ala

20 25 30

Ile His Asp Thr Thr Leu Gly Pro Ala Leu Gly Gly Thr Arg Met Trp

35 40 45

Thr Tyr Asp Ser Glu Glu Ala Ala Ile Glu Asp Ala Leu Arg Leu Ala

50 55 60

Lys Gly Met Thr Tyr Lys Asn Ala Ala Ala Gly Leu Asn Leu Gly Gly

65 70 75 80

Ala Lys Thr Val Ile Ile Gly Asp Pro Arg Lys Asp Lys Ser Glu Ala

85 90 95

Met Phe Arg Ala Leu Gly Arg Tyr Ile Gln Gly Leu Asn Gly Arg Tyr

100 105 110

Ile Thr Ala Glu Asp Val Gly Thr Thr Val Asp Asp Met Asp Ile Ile

115 120 125

His Glu Glu Thr Asp Phe Val Thr Gly Ile Ser Pro Ser Phe Gly Ser

130 135 140

Ser Gly Asn Pro Ser Pro Val Thr Ala Tyr Gly Val Tyr Arg Gly Met

145 150 155 160

Lys Ala Ala Ala Lys Glu Ala Phe Gly Thr Asp Asn Leu Glu Gly Lys

165 170 175

Val Ile Ala Val Gln Gly Val Gly Asn Val Ala Tyr His Leu Cys Lys

180 185 190

His Leu His Ala Glu Gly Ala Lys Leu Ile Val Thr Asp Ile Asn Lys

195 200 205

Glu Ala Val Gln Arg Ala Val Glu Glu Phe Gly Ala Ser Ala Val Glu

210 215 220

Pro Asn Glu Ile Tyr Gly Val Glu Cys Asp Ile Tyr Ala Pro Cys Ala

225 230 235 240

Leu Gly Ala Thr Val Asn Asp Glu Thr Ile Pro Gln Leu Lys Ala Lys

245 250 255

Val Ile Ala Gly Ser Ala Asn Asn Gln Leu Lys Glu Asn Arg His Gly

260 265 270

Asp Ile Ile His Glu Met Gly Ile Val Tyr Ala Pro Asp Tyr Val Ile

275 280 285

Asn Ala Gly Gly Val Ile Asn Val Ala Asp Glu Leu Tyr Gly Tyr Asn

290 295 300

Arg Glu Arg Ala Leu Lys Arg Val Glu Ser Ile Tyr Asp Thr Ile Ala

305 310 315 320

Lys Val Ile Glu Ile Ser Lys Arg Asp Gly Ile Ala Thr Tyr Val Ala

325 330 335

Ala Asp Arg Leu Ala Glu Glu Arg Ile Ala Ser Leu Lys Asn Ser Arg

340 345 350

Ser Thr Tyr Leu Arg Asn Gly His Asp Ile Ile Ser Arg Arg

355 360 365

<210> 7

<211> 364

<212> PRT

<213>artificial sequence

<400> 7

Met Lys Ile Val Leu Val Leu Tyr Asp Ala Gly Lys His Ala Ala Asp

1 5 10 15

Glu Glu Lys Leu Tyr Gly Cys Thr Glu Asn Lys Leu Gly Ile Ala Asn

20 25 30

Trp Leu Lys Asp Gln Gly His Glu Leu Ile Thr Thr Ser Asp Lys Glu

35 40 45

Gly Gly Asn Ser Val Leu Asp Gln His Ile Pro Asp Ala Asp Ile Ile

50 55 60

Ile Thr Thr Pro Phe His Pro Ala Tyr Ile Thr Lys Glu Arg Ile Asp

65 70 75 80

Lys Ala Lys Lys Leu Lys Leu Val Val Val Ala Gly Val Gly Ser Asp

85 90 95

His Ile Asp Leu Asp Tyr Ile Asn Gln Thr Gly Lys Lys Ile Ser Val

100 105 110

Leu Glu Val Thr Gly Ser Asn Val Val Ser Val Ala Glu His Val Val

115 120 125

Met Thr Met Leu Val Leu Val Arg Asn Phe Val Pro Ala His Glu Gln

130 135 140

Ile Ile Asn His Asp Trp Glu Val Ala Ala Ile Ala Lys Asp Ala Tyr

145 150 155 160

Asp Ile Glu Gly Lys Thr Ile Ala Thr Ile Gly Ala Gly Arg Ile Gly

165 170 175

Tyr Arg Val Leu Glu Arg Leu Val Pro Phe Asn Pro Lys Glu Leu Leu

180 185 190

Tyr Tyr Asp Tyr Gln Ala Leu Pro Lys Asp Ala Glu Glu Lys Val Gly

195 200 205

Ala Arg Arg Val Glu Asn Ile Glu Glu Leu Val Ala Gln Ala Asp Ile

210 215 220

Val Thr Val Asn Ala Pro Leu His Ala Gly Thr Lys Gly Leu Ile Asn

225 230 235 240

Lys Glu Leu Leu Ser Lys Phe Lys Lys Gly Ala Trp Leu Val Asn Thr

245 250 255

Ala Arg Gly Ala Ile Cys Val Ala Glu Asp Val Ala Ala Ala Leu Glu

260 265 270

Ser Gly Gln Leu Arg Gly Tyr Gly Gly Asp Val Trp Phe Pro Gln Pro

275 280 285

Ala Pro Lys Asp His Pro Trp Arg Asp Met Arg Asn Lys Tyr Gly Ala

290 295 300

Gly Asn Ala Met Thr Pro His Tyr Ser Gly Thr Thr Leu Asp Ala Gln

305 310 315 320

Thr Arg Tyr Ala Gln Gly Thr Lys Asn Ile Leu Glu Ser Phe Phe Thr

325 330 335

Gly Lys Phe Asp Tyr Arg Pro Gln Asp Ile Ile Leu Leu Asn Gly Glu

340 345 350

Tyr Val Thr Lys Ala Tyr Gly Lys His Asp Lys Lys

355 360

<210> 8

<211> 29

<212> DNA

<213>artificial sequence

<400> 8

cgggatccat ggctgactcg caacccctg 29

<210> 9

<211> 34

<212> DNA

<213>artificial sequence

<400> 9

cccaagcttc taacccgcca aaaagaacct gaac 34

<210> 10

<211> 26

<212> DNA

<213>artificial sequence

<400> 10

cgggatccat gcgcgttatg gtcttg 26

<210> 11

<211> 33

<212> DNA

<213>artificial sequence

<400> 11

cccaagcttt tagcgacggc taataatatc gtg 33

<210> 12

<211> 52

<212> DNA

<213>artificial sequence

<400> 12

catcatcacc acagccagga tccaatgaca ttagaaatct tcgaatactt ag 52

<210> 13

<211> 47

<212> DNA

<213>artificial sequence

<400> 13

gcggtttctt taccagactc gagttagcga cggctaataa tatcgtg 47

<210> 14

<211> 53

<212> DNA

<213>artificial sequence

<400> 14

ccatcatcac cacagccagg atccaatgaa gatcgtgtta gtcctttacg acg 53

<210> 15

<211> 55

<212> DNA

<213>artificial sequence

<400> 15

ggtacctttc tcctctttaa tctgcagtta ttatttttta tcgtgtttcc cgtag 55

<210> 16

<211> 46

<212> DNA

<213>artificial sequence

<400> 16

ctgcagatta aagaggagaa aggtaccatg gctgactcgc aacccc 46

<210> 17

<211> 46

<212> DNA

<213>artificial sequence

<400> 17

agcggtttct ttaccagact cgagttaacc cgccaaaaag aacctg 46

<210> 18

<211> 72

<212> DNA

<213>artificial sequence

<400> 18

gtaaaggact aacacgatct tcatgagctc tttctcctct ttgatatctt agcgacggct 60

aataatatcg tg 72

Claims

1. a kind of recombinant bacterium of conversion L-threonine production C4H9NO2, which is characterized in that the recombinant bacterium is with large intestine Bacillus is host, and double-plasmid expression system expresses threonine deaminase, hydrogenlyase, leucine dehydrogenase, described double-mass model Expression system includes PETDuet-1 plasmid and pRSFDuet-1 plasmid.

2. a kind of recombinant bacterium of conversion L-threonine production C4H9NO2 according to claim 1, which is characterized in that For the PETDuet-1 plasmid for expressing threonine deaminase, hydrogenlyase, the pRSFDuet-1 plasmid is bright for expressing Propylhomoserin dehydrogenase.

3. a kind of recombinant bacterium of conversion L-threonine production C4H9NO2 according to claim 1 or 2, feature exist In the threonine deaminase is selected from Escherichia coli, and the leucine dehydrogenase is selected from bacillus thuringiensis；The formic acid is de- Hydrogen enzyme is selected from Candida.

4. a kind of recombinant bacterium of conversion L-threonine production C4H9NO2 according to claim 1 to 3, special Sign is that the host is E.coli BL21.

5. a kind of recombinant bacterium of conversion L-threonine production C4H9NO2 according to claim 1 to 4, special Sign is that the hydrogenlyase codon optimization, the nucleotide sequence after optimization is as shown in SEQ ID NO:4, amino Acid sequence is as shown in SEQ ID NO:7.

6. a kind of method of conversion L-threonine production C4H9NO2, which is characterized in that the method utilizes claim 1 ~5 any recombinant bacteriums convert a substrate into C4H9NO2, and coupled cofactor regenerating system.

7. a kind of method of conversion L-threonine production C4H9NO2 according to claim 6, which is characterized in that institute Cofactor Regeneration Systems are stated using ammonium formate as substrate, by hydrogenlyase by NAD⁺It is converted into the regenerating coenzyme system of NADH.

8. a kind of method of conversion L-threonine production C4H9NO2 according to claim 6 or 7, feature exist In L-threonine concentration is 30~40g/L in the substrate, and formic acid ammonium concentration is 10~30g/L, NAD⁺Concentration be 0.4~ 1.0g/L, the recombinant bacterium after cultivation in the form of bacterium solution add, conversion temperature be 30~40 DEG C, conversion pH be 7.0~ 8.5。

9. according to a kind of method of conversion L-threonine production C4H9NO2 as claimed in claim 6 to 8, feature It is, the preparation method of the bacterium solution is to be dissolved in the NaH that pH is 7.0~8.5 after thalline were collected by centrifugation₂PO₄-Na₂HPO₄Buffering Liquid, the additive amount of bacterium solution are 30~50g/L.

10. a kind of recombinant bacterium of any conversion L-threonine production C4H9NO2 of claim 1-5 is raw in medicine It produces, the application of chemical field.